miRNA Card

miRNA General Information
miRNA ID hsa-miR-5590-3p
Description Homo sapiens miR-5590 stem-loop
Comment None
Experiment
Sequence AAUAAAGUUCAUGUAUGGCAA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:166987032|166987113 hsa-miR-5590-3p 1 1 0
chr2:222624425|222624754 hsa-miR-5590-3p 1 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5590-3p PEX2 peroxisomal biogenesis factor 2 HGNC:9717 details
hsa-miR-5590-3p TRIM59 tripartite motif containing 59 HGNC:30834 details
hsa-miR-5590-3p NRIP3 nuclear receptor interacting protein 3 HGNC:1167 details
hsa-miR-5590-3p LLPH LLP homolog, long-term synaptic facilitation factor HGNC:28229 details
hsa-miR-5590-3p PROX2 prospero homeobox 2 HGNC:26715 details
hsa-miR-5590-3p EIF2A eukaryotic translation initiation factor 2A HGNC:3254 details
hsa-miR-5590-3p SLC38A1 solute carrier family 38 member 1 HGNC:13447 details
hsa-miR-5590-3p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-5590-3p STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-5590-3p TSR1 TSR1 ribosome maturation factor HGNC:25542 details
hsa-miR-5590-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-5590-3p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-5590-3p BAG2 BAG cochaperone 2 HGNC:938 details
hsa-miR-5590-3p SEM1 SEM1 26S proteasome subunit HGNC:10845 details
hsa-miR-5590-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-5590-3p TRIP10 thyroid hormone receptor interactor 10 HGNC:12304 details
hsa-miR-5590-3p TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-5590-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-5590-3p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-5590-3p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-5590-3p SLC22A23 solute carrier family 22 member 23 HGNC:21106 details
hsa-miR-5590-3p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-5590-3p HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-5590-3p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-5590-3p FAM107B family with sequence similarity 107 member B HGNC:23726 details
hsa-miR-5590-3p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-5590-3p details
hsa-miR-5590-3p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-5590-3p B2M beta-2-microglobulin HGNC:914 details
hsa-miR-5590-3p ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-5590-3p ATL3 atlastin GTPase 3 HGNC:24526 details
hsa-miR-5590-3p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-5590-3p ZNFX1 zinc finger NFX1-type containing 1 HGNC:29271 details
hsa-miR-5590-3p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-5590-3p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-5590-3p ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-5590-3p ERH ERH mRNA splicing and mitosis factor HGNC:3447 details
hsa-miR-5590-3p PEBP1 phosphatidylethanolamine binding protein 1 HGNC:8630 details
hsa-miR-5590-3p ZFYVE21 zinc finger FYVE-type containing 21 HGNC:20760 details
hsa-miR-5590-3p SCARB2 scavenger receptor class B member 2 HGNC:1665 details
hsa-miR-5590-3p PCBP1 poly(rC) binding protein 1 HGNC:8647 details
hsa-miR-5590-3p LAPTM4A lysosomal protein transmembrane 4 alpha HGNC:6924 details
hsa-miR-5590-3p DUSP2 dual specificity phosphatase 2 HGNC:3068 details
hsa-miR-5590-3p CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-5590-3p CAPN15 calpain 15 HGNC:11182 details
hsa-miR-5590-3p ANKRD33B ankyrin repeat domain 33B HGNC:35240 details
hsa-miR-5590-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-5590-3p SEMA7A semaphorin 7A (John Milton Hagen blood group) HGNC:10741 details
hsa-miR-5590-3p TMEM30B transmembrane protein 30B HGNC:27254 details
hsa-miR-5590-3p FAM71F2 family with sequence similarity 71 member F2 HGNC:27998 details
hsa-miR-5590-3p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-5590-3p PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-5590-3p FRAT2 FRAT regulator of WNT signaling pathway 2 HGNC:16048 details
hsa-miR-5590-3p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-5590-3p ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-5590-3p SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 HGNC:17148 details
hsa-miR-5590-3p PFKP phosphofructokinase, platelet HGNC:8878 details
hsa-miR-5590-3p NAGK N-acetylglucosamine kinase HGNC:17174 details
hsa-miR-5590-3p MAPK1 mitogen-activated protein kinase 1 HGNC:6871 details
hsa-miR-5590-3p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-5590-3p HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-5590-3p FIGN fidgetin, microtubule severing factor HGNC:13285 details
hsa-miR-5590-3p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-5590-3p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-5590-3p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-5590-3p details
hsa-miR-5590-3p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-5590-3p ZNF701 zinc finger protein 701 HGNC:25597 details
hsa-miR-5590-3p ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-5590-3p RBM8A RNA binding motif protein 8A HGNC:9905 details
hsa-miR-5590-3p SLC24A2 solute carrier family 24 member 2 HGNC:10976 details
hsa-miR-5590-3p PRKD3 protein kinase D3 HGNC:9408 details
hsa-miR-5590-3p PPIG peptidylprolyl isomerase G HGNC:14650 details
hsa-miR-5590-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-5590-3p BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-5590-3p ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-5590-3p ZNF93 zinc finger protein 93 HGNC:13169 details
hsa-miR-5590-3p SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-5590-3p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-5590-3p SNX24 sorting nexin 24 HGNC:21533 details
hsa-miR-5590-3p MYORG myogenesis regulating glycosidase (putative) HGNC:19918 details
hsa-miR-5590-3p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-5590-3p SPTLC2 serine palmitoyltransferase long chain base subunit 2 HGNC:11278 details
hsa-miR-5590-3p U2SURP U2 snRNP associated SURP domain containing HGNC:30855 details
hsa-miR-5590-3p TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-5590-3p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-5590-3p RNASEH1 ribonuclease H1 HGNC:18466 details
hsa-miR-5590-3p REST RE1 silencing transcription factor HGNC:9966 details
hsa-miR-5590-3p GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-5590-3p ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-5590-3p ELOVL6 ELOVL fatty acid elongase 6 HGNC:15829 details
hsa-miR-5590-3p EFNA5 ephrin A5 HGNC:3225 details
hsa-miR-5590-3p CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-5590-3p CCSAP centriole, cilia and spindle associated protein HGNC:29578 details
hsa-miR-5590-3p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-5590-3p ANKRD28 ankyrin repeat domain 28 HGNC:29024 details
hsa-miR-5590-3p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-5590-3p RAB34 RAB34, member RAS oncogene family HGNC:16519 details
hsa-miR-5590-3p GLO1 glyoxalase I HGNC:4323 details
hsa-miR-5590-3p SLC25A46 solute carrier family 25 member 46 HGNC:25198 details
hsa-miR-5590-3p GDF11 growth differentiation factor 11 HGNC:4216 details
hsa-miR-5590-3p CC2D2A coiled-coil and C2 domain containing 2A HGNC:29253 details
hsa-miR-5590-3p PLS1 plastin 1 HGNC:9090 details
hsa-miR-5590-3p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-5590-3p AIMP1 aminoacyl tRNA synthetase complex interacting multifunctional protein 1 HGNC:10648 details
hsa-miR-5590-3p GTF2B general transcription factor IIB HGNC:4648 details
hsa-miR-5590-3p FOXO3 forkhead box O3 HGNC:3821 details
hsa-miR-5590-3p PRELID1 PRELI domain containing 1 HGNC:30255 details
hsa-miR-5590-3p TRIM66 tripartite motif containing 66 HGNC:29005 details
hsa-miR-5590-3p PDZRN4 PDZ domain containing ring finger 4 HGNC:30552 details
hsa-miR-5590-3p SIGLEC9 sialic acid binding Ig like lectin 9 HGNC:10878 details
hsa-miR-5590-3p DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-5590-3p SNRPD3 small nuclear ribonucleoprotein D3 polypeptide HGNC:11160 details
hsa-miR-5590-3p ZNF805 zinc finger protein 805 HGNC:23272 details
hsa-miR-5590-3p ZNF275 zinc finger protein 275 HGNC:13069 details
hsa-miR-5590-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-5590-3p USP48 ubiquitin specific peptidase 48 HGNC:18533 details
hsa-miR-5590-3p ULK1 unc-51 like autophagy activating kinase 1 HGNC:12558 details
hsa-miR-5590-3p SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-5590-3p MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-5590-3p FJX1 four-jointed box kinase 1 HGNC:17166 details
hsa-miR-5590-3p EGLN3 egl-9 family hypoxia inducible factor 3 HGNC:14661 details
hsa-miR-5590-3p CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 HGNC:28680 details
hsa-miR-5590-3p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-5590-3p LUZP2 leucine zipper protein 2 HGNC:23206 details
hsa-miR-5590-3p TRAPPC2 trafficking protein particle complex subunit 2 HGNC:23068 details
hsa-miR-5590-3p PVR PVR cell adhesion molecule HGNC:9705 details
hsa-miR-5590-3p MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-5590-3p TTC8 tetratricopeptide repeat domain 8 HGNC:20087 details
hsa-miR-5590-3p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-5590-3p UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-5590-3p TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-5590-3p SZRD1 SUZ RNA binding domain containing 1 HGNC:30232 details
hsa-miR-5590-3p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-5590-3p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-5590-3p SAMD12 sterile alpha motif domain containing 12 HGNC:31750 details
hsa-miR-5590-3p RRN3 RRN3 homolog, RNA polymerase I transcription factor HGNC:30346 details
hsa-miR-5590-3p ROBO1 roundabout guidance receptor 1 HGNC:10249 details
hsa-miR-5590-3p RHOC ras homolog family member C HGNC:669 details
hsa-miR-5590-3p RGPD4 RANBP2 like and GRIP domain containing 4 HGNC:32417 details
hsa-miR-5590-3p RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-5590-3p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-5590-3p RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-5590-3p RAB10 RAB10, member RAS oncogene family HGNC:9759 details
hsa-miR-5590-3p PTPDC1 protein tyrosine phosphatase domain containing 1 HGNC:30184 details
hsa-miR-5590-3p PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma HGNC:23786 details
hsa-miR-5590-3p MED17 mediator complex subunit 17 HGNC:2375 details
hsa-miR-5590-3p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-5590-3p FOXJ2 forkhead box J2 HGNC:24818 details
hsa-miR-5590-3p details
hsa-miR-5590-3p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-5590-3p EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-5590-3p DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 HGNC:1297 details
hsa-miR-5590-3p DDX5 DEAD-box helicase 5 HGNC:2746 details
hsa-miR-5590-3p details
hsa-miR-5590-3p SLC30A7 solute carrier family 30 member 7 HGNC:19306 details
hsa-miR-5590-3p TMEM98 transmembrane protein 98 HGNC:24529 details
hsa-miR-5590-3p ZNF324B zinc finger protein 324B HGNC:33107 details
hsa-miR-5590-3p DEGS1 delta 4-desaturase, sphingolipid 1 HGNC:13709 details
hsa-miR-5590-3p MRPL36 mitochondrial ribosomal protein L36 HGNC:14490 details
hsa-miR-5590-3p TNFRSF10A TNF receptor superfamily member 10a HGNC:11904 details
hsa-miR-5590-3p ZNF281 zinc finger protein 281 HGNC:13075 details
hsa-miR-5590-3p ZBTB43 zinc finger and BTB domain containing 43 HGNC:17908 details
hsa-miR-5590-3p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-5590-3p SIVA1 SIVA1 apoptosis inducing factor HGNC:17712 details
hsa-miR-5590-3p MSH6 mutS homolog 6 HGNC:7329 details
hsa-miR-5590-3p MFSD9 major facilitator superfamily domain containing 9 HGNC:28158 details
hsa-miR-5590-3p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-5590-3p KIAA0895 KIAA0895 HGNC:22206 details
hsa-miR-5590-3p details
hsa-miR-5590-3p TNIP2 TNFAIP3 interacting protein 2 HGNC:19118 details
hsa-miR-5590-3p LRPAP1 LDL receptor related protein associated protein 1 HGNC:6701 details
hsa-miR-5590-3p DSPP dentin sialophosphoprotein HGNC:3054 details
hsa-miR-5590-3p KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-5590-3p PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 HGNC:28954 details
hsa-miR-5590-3p BAAT bile acid-CoA:amino acid N-acyltransferase HGNC:932 details
hsa-miR-5590-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-5590-3p RASEF RAS and EF-hand domain containing HGNC:26464 details
hsa-miR-5590-3p LEPROT leptin receptor overlapping transcript HGNC:29477 details
hsa-miR-5590-3p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-5590-3p CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-5590-3p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-5590-3p BCOR BCL6 corepressor HGNC:20893 details
hsa-miR-5590-3p ATP13A3 ATPase 13A3 HGNC:24113 details
hsa-miR-5590-3p RRAS2 RAS related 2 HGNC:17271 details
hsa-miR-5590-3p BBS10 Bardet-Biedl syndrome 10 HGNC:26291 details
hsa-miR-5590-3p DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-5590-3p MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-5590-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-5590-3p HAUS8 HAUS augmin like complex subunit 8 HGNC:30532 details
hsa-miR-5590-3p PRKCB protein kinase C beta HGNC:9395 details
hsa-miR-5590-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-5590-3p details
hsa-miR-5590-3p SLC6A4 solute carrier family 6 member 4 HGNC:11050 details
hsa-miR-5590-3p FFAR4 free fatty acid receptor 4 HGNC:19061 details
hsa-miR-5590-3p SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-5590-3p RIMS4 regulating synaptic membrane exocytosis 4 HGNC:16183 details
hsa-miR-5590-3p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-5590-3p TMEM43 transmembrane protein 43 HGNC:28472 details
hsa-miR-5590-3p SLCO1B3 solute carrier organic anion transporter family member 1B3 HGNC:10961 details
hsa-miR-5590-3p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-5590-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-5590-3p RYBP RING1 and YY1 binding protein HGNC:10480 details
hsa-miR-5590-3p ZNF619 zinc finger protein 619 HGNC:26910 details
hsa-miR-5590-3p ADI1 acireductone dioxygenase 1 HGNC:30576 details
hsa-miR-5590-3p SDAD1 SDA1 domain containing 1 HGNC:25537 details
hsa-miR-5590-3p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-5590-3p CD47 CD47 molecule HGNC:1682 details
hsa-miR-5590-3p CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-5590-3p RETSAT retinol saturase HGNC:25991 details
hsa-miR-5590-3p TNS1 tensin 1 HGNC:11973 details
hsa-miR-5590-3p TPRA1 transmembrane protein adipocyte associated 1 HGNC:30413 details
hsa-miR-5590-3p ACTC1 actin alpha cardiac muscle 1 HGNC:143 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab