miRNA Card

miRNA General Information
miRNA ID hsa-miR-5590-5p
Description Homo sapiens miR-5590 stem-loop
Comment None
Experiment
Sequence UUGCCAUACAUAGACUUUAUU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:207076171|207076305 hsa-miR-5590-5p 0 1 0
chr11:119336480|119336618 hsa-miR-5590-5p 0 1 0
chr18:57738012|57738164 hsa-miR-5590-5p 0 1 0
chr22:25663685|25667800 hsa-miR-5590-5p 0 1 0
chr2:210028012|210028182 hsa-miR-5590-5p 0 1 0
chr16:72788196|72788282 hsa-miR-5590-5p 0 1 0
chr14:75958224|75958332 hsa-miR-5590-5p 0 1 0
chr12:110339332|110339640 hsa-miR-5590-5p 0 1 0
chr21:34787963|34788264 hsa-miR-5590-5p 0 1 0
chr22:36141172|36141259 hsa-miR-5590-5p 0 1 0
chr19:7905135|7905351 hsa-miR-5590-5p 0 1 0
chr17:40628858|40628982 hsa-miR-5590-5p 0 1 0
chr22:36141172|36141265 hsa-miR-5590-5p 0 1 0
chr19:7905175|7905306 hsa-miR-5590-5p 0 1 0
chr17:40356571|40356716 hsa-miR-5590-5p 0 1 0
chr21:34787973~34788272 hsa-miR-5590-5p 0 1 0
chr17:62063145~62063290 hsa-miR-5590-5p 0 1 0
chr17:40356571~40356716 hsa-miR-5590-5p 0 1 0
chr22:36141172~36141274 hsa-miR-5590-5p 0 1 0
chr4:77048287|77048385 hsa-miR-5590-5p 0 1 0
chr19:40944335~40944476 hsa-miR-5590-5p 0 1 0
chr2:189003430~189004000 hsa-miR-5590-5p 0 1 0
chr4:99947181|99947300 hsa-miR-5590-5p 0 1 0
chr17:81060156|81060300 hsa-miR-5590-5p 0 1 0
chr5:143048539|143048639 hsa-miR-5590-5p 0 1 0
chrX:301289|301421 hsa-miR-5590-5p 0 1 0
chr1:39563614|39563741 hsa-miR-5590-5p 0 1 0
chr1:55066395|55066539 hsa-miR-5590-5p 1 0 0
chr6:36484240|36484388 hsa-miR-5590-5p 0 1 0
chr1:247360685|247360793 hsa-miR-5590-5p 0 1 0
chr10:7918316|7918436 hsa-miR-5590-5p 0 1 0
chr17:40356593|40356716 hsa-miR-5590-5p 0 1 0
chr1:206455438|206455590 hsa-miR-5590-5p 1 0 0
chr2:28411563|28411725 hsa-miR-5590-5p 0 1 0
chr10:79614608|79614790 hsa-miR-5590-5p 0 1 0
chr17:48060890|48061162 hsa-miR-5590-5p 0 1 0
chr14:69708684|69708889 hsa-miR-5590-5p 0 1 0
chr4:105235917|105236093 hsa-miR-5590-5p 0 1 0
chr9:136440669|136440903 hsa-miR-5590-5p 0 1 0
chr3:113002890|113003065 hsa-miR-5590-5p 0 1 0
chr10:79614589|79614790 hsa-miR-5590-5p 0 1 0
chr14:24189369|24189512 hsa-miR-5590-5p 0 1 0
chr3:48985858|48986002 hsa-miR-5590-5p 0 1 0
chr10:79614627|79614790 hsa-miR-5590-5p 0 1 0
chr2:54644358|54644550 hsa-miR-5590-5p 0 1 0
chr2:189003037|189003770 hsa-miR-5590-5p 0 1 0
chr17:48060861|48061162 hsa-miR-5590-5p 0 1 0
chr12:110339353|110339640 hsa-miR-5590-5p -9 1 0
chr14:102081567|102081688 hsa-miR-5590-5p 0 1 0
chr7:134515246|134515387 hsa-miR-5590-5p 0 1 0
chr22:50266671|50266746 hsa-miR-5590-5p 0 1 0
chr2:189003430|189004074 hsa-miR-5590-5p 0 1 0
chr2:189003411|189003787 hsa-miR-5590-5p 0 1 0
chr2:189003430|189004000 hsa-miR-5590-5p 0 1 0
chr11:66263670|66263911 hsa-miR-5590-5p 0 1 0
chr9:86036382|86036471 hsa-miR-5590-5p 0 1 0
chr8:144096155|144096250 hsa-miR-5590-5p 0 1 0
chr1:174393999|174394093 hsa-miR-5590-5p 0 1 0
chr11:121631191|121631312 hsa-miR-5590-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5590-5p SNRPE small nuclear ribonucleoprotein polypeptide E HGNC:11161 details
hsa-miR-5590-5p RAB6C RAB6C, member RAS oncogene family HGNC:16525 details
hsa-miR-5590-5p WAC WW domain containing adaptor with coiled-coil HGNC:17327 details
hsa-miR-5590-5p VMP1 vacuole membrane protein 1 HGNC:29559 details
hsa-miR-5590-5p EEF1A1 eukaryotic translation elongation factor 1 alpha 1 HGNC:3189 details
hsa-miR-5590-5p ENDOD1 endonuclease domain containing 1 HGNC:29129 details
hsa-miR-5590-5p GLCCI1 glucocorticoid induced 1 HGNC:18713 details
hsa-miR-5590-5p TMEM81 transmembrane protein 81 HGNC:32349 details
hsa-miR-5590-5p PITPNM3 PITPNM family member 3 HGNC:21043 details
hsa-miR-5590-5p DENND4C DENN domain containing 4C HGNC:26079 details
hsa-miR-5590-5p SVOP SV2 related protein HGNC:25417 details
hsa-miR-5590-5p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-5590-5p CD38 CD38 molecule HGNC:1667 details
hsa-miR-5590-5p ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-5590-5p SBNO1 strawberry notch homolog 1 HGNC:22973 details
hsa-miR-5590-5p details
hsa-miR-5590-5p WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-5590-5p details
hsa-miR-5590-5p GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 HGNC:20883 details
hsa-miR-5590-5p NOM1 nucleolar protein with MIF4G domain 1 HGNC:13244 details
hsa-miR-5590-5p ABCG8 ATP binding cassette subfamily G member 8 HGNC:13887 details
hsa-miR-5590-5p CTC1 CST telomere replication complex component 1 HGNC:26169 details
hsa-miR-5590-5p CHRM3 cholinergic receptor muscarinic 3 HGNC:1952 details
hsa-miR-5590-5p MCM4 minichromosome maintenance complex component 4 HGNC:6947 details
hsa-miR-5590-5p ADCY7 adenylate cyclase 7 HGNC:238 details
hsa-miR-5590-5p TCN2 transcobalamin 2 HGNC:11653 details
hsa-miR-5590-5p RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-5590-5p GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-5590-5p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-5590-5p VLDLR very low density lipoprotein receptor HGNC:12698 details
hsa-miR-5590-5p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-5590-5p FRAT2 FRAT regulator of WNT signaling pathway 2 HGNC:16048 details
hsa-miR-5590-5p ZNF138 zinc finger protein 138 HGNC:12922 details
hsa-miR-5590-5p PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma HGNC:23786 details
hsa-miR-5590-5p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-5590-5p DBN1 drebrin 1 HGNC:2695 details
hsa-miR-5590-5p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-5590-5p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-5590-5p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-5590-5p BRPF3 bromodomain and PHD finger containing 3 HGNC:14256 details
hsa-miR-5590-5p RAB7A RAB7A, member RAS oncogene family HGNC:9788 details
hsa-miR-5590-5p RBMXL1 RBMX like 1 HGNC:25073 details
hsa-miR-5590-5p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-5590-5p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-5590-5p RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-5590-5p SERPINA3 serpin family A member 3 HGNC:16 details
hsa-miR-5590-5p details
hsa-miR-5590-5p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-5590-5p KCNK5 potassium two pore domain channel subfamily K member 5 HGNC:6280 details
hsa-miR-5590-5p IPO9 importin 9 HGNC:19425 details
hsa-miR-5590-5p EBF1 EBF transcription factor 1 HGNC:3126 details
hsa-miR-5590-5p MVK mevalonate kinase HGNC:7530 details
hsa-miR-5590-5p ZNF274 zinc finger protein 274 HGNC:13068 details
hsa-miR-5590-5p RFX1 regulatory factor X1 HGNC:9982 details
hsa-miR-5590-5p NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 HGNC:7700 details
hsa-miR-5590-5p CUBN cubilin HGNC:2548 details
hsa-miR-5590-5p PRDM10 PR/SET domain 10 HGNC:13995 details
hsa-miR-5590-5p HMOX1 heme oxygenase 1 HGNC:5013 details
hsa-miR-5590-5p ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 HGNC:10871 details
hsa-miR-5590-5p GPR26 G protein-coupled receptor 26 HGNC:4481 details
hsa-miR-5590-5p TIMM8B translocase of inner mitochondrial membrane 8 homolog B HGNC:11818 details
hsa-miR-5590-5p TMEM199 transmembrane protein 199 HGNC:18085 details
hsa-miR-5590-5p TRPM7 transient receptor potential cation channel subfamily M member 7 HGNC:17994 details
hsa-miR-5590-5p PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-5590-5p NR4A3 nuclear receptor subfamily 4 group A member 3 HGNC:7982 details
hsa-miR-5590-5p NWD1 NACHT and WD repeat domain containing 1 HGNC:27619 details
hsa-miR-5590-5p HNF4A hepatocyte nuclear factor 4 alpha HGNC:5024 details
hsa-miR-5590-5p SERP1 stress associated endoplasmic reticulum protein 1 HGNC:10759 details
hsa-miR-5590-5p C1RL complement C1r subcomponent like HGNC:21265 details
hsa-miR-5590-5p CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-5590-5p SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-5590-5p SP110 SP110 nuclear body protein HGNC:5401 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab