CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-5687
Description	Homo sapiens miR-5687 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	UUAGAACGUUUUAGGGUCAAAU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chrX:32518008\|32595876	hsa-miR-5687	1	0	1
chr1:62606729\|62606851	hsa-miR-5687	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:75320253\|75320501	hsa-miR-5687	1	0
chr7:44213460\|44213559	hsa-miR-5687	0	1
chr7:44213444\|44213559	hsa-miR-5687	0	1
chr6:31969163\|31969327	hsa-miR-5687	0	1
chr20:63933740\|63933884	hsa-miR-5687	0	1
chr2:226735995\|226736241	hsa-miR-5687	0	1
chr18:46104424\|46105322	hsa-miR-5687	0	1
chr7:44213444\|44213601	hsa-miR-5687	0	1
chr7:40094397\|40094684	hsa-miR-5687	0	1
chr22:49773331\|49773480	hsa-miR-5687	0	1
chr1:45013661\|45013929	hsa-miR-5687	0	1
chr17:43211300\|43211539	hsa-miR-5687	0	1
chr2:202206825\|202206930	hsa-miR-5687	0	1
chr11:64247074~64247183	hsa-miR-5687	0	1
chr19:8321758~8321901	hsa-miR-5687	0	1
chr7:44213460~44213559	hsa-miR-5687	0	1
chr2:75664409~75664532	hsa-miR-5687	0	1
chr9:113388155~113388308	hsa-miR-5687	0	1
chr7:66731993~66732221	hsa-miR-5687	0	1
chr4:6642427\|6642643	hsa-miR-5687	0	1
chr16:87410172\|87410284	hsa-miR-5687	0	1
chr3:195244065\|195244184	hsa-miR-5687	0	1
chr5:179666320\|179666462	hsa-miR-5687	0	1
chr19:44099272\|44099361	hsa-miR-5687	0	1
chr1:224415817\|224415983	hsa-miR-5687	0	1
chr16:31371342\|31371484	hsa-miR-5687	0	1
chr11:2317163\|2317293	hsa-miR-5687	0	1
chr17:64470895\|64471055	hsa-miR-5687	0	1
chr5:76661612\|76661746	hsa-miR-5687	0	1
chr17:75320253\|75320535	hsa-miR-5687	1	0
chr2:215375338\|215375718	hsa-miR-5687	0	1
chr6:31969012\|31969393	hsa-miR-5687	0	1
chr21:33357199\|33357299	hsa-miR-5687	0	1
chr1:44218395\|44218731	hsa-miR-5687	0	1
chr11:68262761\|68262889	hsa-miR-5687	0	1
chr4:6642400\|6642643	hsa-miR-5687	0	1
chr17:59946825\|59946932	hsa-miR-5687	0	1
chr2:238167904\|238168088	hsa-miR-5687	0	1
chr17:50741102\|50741731	hsa-miR-5687	0	1
chr11:118372637\|118373179	hsa-miR-5687	0	1
chr6:31969280\|31969387	hsa-miR-5687	0	1
chr2:75191557\|75191775	hsa-miR-5687	0	1
chr17:50464487\|50464614	hsa-miR-5687	0	1
chr16:10923039\|10923132	hsa-miR-5687	0	1
chr19:2435315\|2435456	hsa-miR-5687	0	1
chr20:2838432\|2838682	hsa-miR-5687	0	1
chr3:52395563\|52395678	hsa-miR-5687	0	1
chr15:68779187\|68779396	hsa-miR-5687	0	1
chr1:45013646\|45013929	hsa-miR-5687	0	1
chr2:167954357\|167954440	hsa-miR-5687	0	1
chr17:68423979\|68424162	hsa-miR-5687	0	1
chr15:75049490\|75049628	hsa-miR-5687	-3	1
chrX:10454890\|10455077	hsa-miR-5687	0	1
chr16:84662817\|84663037	hsa-miR-5687	0	1
chr8:116846821\|116846936	hsa-miR-5687	0	1
chr9:83978222\|83978439	hsa-miR-5687	0	1
chr19:10468063\|10468180	hsa-miR-5687	0	1
chr16:31371444\|31371570	hsa-miR-5687	0	1
chr16:2764839\|2765081	hsa-miR-5687	0	1
chr1:45013648\|45013939	hsa-miR-5687	0	1
chr10:24937192\|24937290	hsa-miR-5687	0	1
chr20:20571519\|20571913	hsa-miR-5687	0	1
chr15:75049499\|75049628	hsa-miR-5687	0	1
chr9:92258854\|92260170	hsa-miR-5687	0	1
chr1:43622172\|43622267	hsa-miR-5687	0	1
chr8:29068325\|29068500	hsa-miR-5687	0	1
chr6:30883723\|30883908	hsa-miR-5687	0	1
chr10:128108503\|128108672	hsa-miR-5687	0	1
chr13:27066828\|27067005	hsa-miR-5687	1	0
chr4:118282038\|118282243	hsa-miR-5687	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-5687	TMEM64	transmembrane protein 64	HGNC:25441	details
hsa-miR-5687	RER1	retention in endoplasmic reticulum sorting receptor 1	HGNC:30309	details
hsa-miR-5687	GSE1	Gse1 coiled-coil protein	HGNC:28979	details
hsa-miR-5687	CREBRF	CREB3 regulatory factor	HGNC:24050	details
hsa-miR-5687	MKNK2	MAPK interacting serine/threonine kinase 2	HGNC:7111	details
hsa-miR-5687	OTUB2	OTU deubiquitinase, ubiquitin aldehyde binding 2	HGNC:20351	details
hsa-miR-5687	C6orf120	chromosome 6 open reading frame 120	HGNC:21247	details
hsa-miR-5687	PRKD3	protein kinase D3	HGNC:9408	details
hsa-miR-5687	IPO9	importin 9	HGNC:19425	details
hsa-miR-5687	ERGIC2	ERGIC and golgi 2	HGNC:30208	details
hsa-miR-5687	PRKAB2	protein kinase AMP-activated non-catalytic subunit beta 2	HGNC:9379	details
hsa-miR-5687	RNF146	ring finger protein 146	HGNC:21336	details
hsa-miR-5687	PURB	purine rich element binding protein B	HGNC:9702	details
hsa-miR-5687	NOLC1	nucleolar and coiled-body phosphoprotein 1	HGNC:15608	details
hsa-miR-5687	KIF3A	kinesin family member 3A	HGNC:6319	details
hsa-miR-5687	ZBTB18	zinc finger and BTB domain containing 18	HGNC:13030	details
hsa-miR-5687	PTMA	prothymosin alpha	HGNC:9623	details
hsa-miR-5687	ZNF805	zinc finger protein 805	HGNC:23272	details
hsa-miR-5687	GPSM2	G protein signaling modulator 2	HGNC:29501	details
hsa-miR-5687	TMPPE	transmembrane protein with metallophosphoesterase domain	HGNC:33865	details
hsa-miR-5687	SPAST	spastin	HGNC:11233	details
hsa-miR-5687	DCTN6	dynactin subunit 6	HGNC:16964	details
hsa-miR-5687	TFCP2	transcription factor CP2	HGNC:11748	details
hsa-miR-5687	PIP4K2A	phosphatidylinositol-5-phosphate 4-kinase type 2 alpha	HGNC:8997	details
hsa-miR-5687	FNIP1	folliculin interacting protein 1	HGNC:29418	details
hsa-miR-5687	RABGEF1	RAB guanine nucleotide exchange factor 1	HGNC:17676	details
hsa-miR-5687	ARGLU1	arginine and glutamate rich 1	HGNC:25482	details
hsa-miR-5687	WBP11	WW domain binding protein 11	HGNC:16461	details
hsa-miR-5687	CRCP	CGRP receptor component	HGNC:17888	details
hsa-miR-5687	MAP4K4	mitogen-activated protein kinase kinase kinase kinase 4	HGNC:6866	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)