miRNA Card

miRNA General Information
miRNA ID hsa-miR-5688
Description Homo sapiens miR-5688 stem-loop
Comment None
Experiment Illumina [1]
Sequence UAACAAACACCUGUAAAACAGC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:14441593|14441760 hsa-miR-5688 1 1 0
chr11:17145668|17145942 hsa-miR-5688 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:85319991|85320184 hsa-miR-5688 0 1 0
chr3:15648828|15648990 hsa-miR-5688 0 1 0
chr12:78977799|78977931 hsa-miR-5688 0 1 0
chr17:9242965|9243145 hsa-miR-5688 0 1 0
chr4:76779165|76779310 hsa-miR-5688 0 1 0
chr6:30676397|30676478 hsa-miR-5688 0 1 0
chr1:78642545|78642670 hsa-miR-5688 0 1 0
chr19:33692307|33692421 hsa-miR-5688 0 1 0
chr20:10639511|10639680 hsa-miR-5688 0 1 0
chr20:647692|647864 hsa-miR-5688 0 1 0
chr7:26196857|26197004 hsa-miR-5688 0 1 0
chr7:152135967~152136097 hsa-miR-5688 0 1 0
chr4:76779165~76779310 hsa-miR-5688 0 1 0
chr11:126294613~126294730 hsa-miR-5688 0 1 0
chr19:37363189~37363297 hsa-miR-5688 0 1 0
chr3:150585038~150585274 hsa-miR-5688 0 1 0
chr2:227560592~227560650 hsa-miR-5688 0 1 0
chr16:67685107|67685270 hsa-miR-5688 0 1 0
chr7:155194649~155194839 hsa-miR-5688 0 1 0
chr14:96520071|96520228 hsa-miR-5688 0 1 0
chr2:177234304|177234538 hsa-miR-5688 0 1 0
chr20:8225597|8225868 hsa-miR-5688 0 1 0
chr19:45472131|45472419 hsa-miR-5688 0 1 0
chr6:6758955|6759087 hsa-miR-5688 0 1 0
chr9:114341207|114341349 hsa-miR-5688 0 1 0
chr11:47412610|47412753 hsa-miR-5688 0 1 0
chr17:42571619|42571789 hsa-miR-5688 0 1 0
chr6:89554096|89554231 hsa-miR-5688 0 1 0
chr12:123659543|123659867 hsa-miR-5688 0 1 0
chr8:145054115|145054235 hsa-miR-5688 0 1 0
chr6:158765829|158765980 hsa-miR-5688 0 1 0
chr3:50362190|50362375 hsa-miR-5688 0 1 0
chr11:62152542|62152659 hsa-miR-5688 0 1 0
chr1:161158510|161158795 hsa-miR-5688 0 1 0
chr7:158879767|158884585 hsa-miR-5688 0 1 0
chr6:158097913|158098039 hsa-miR-5688 0 1 0
chr20:49114662|49114771 hsa-miR-5688 0 1 0
chr2:26779501|26779599 hsa-miR-5688 0 1 0
chr4:76779179|76779310 hsa-miR-5688 0 1 0
chr1:151408122|151408473 hsa-miR-5688 0 1 0
chr10:69632963|69633097 hsa-miR-5688 0 1 0
chr14:96520055|96521072 hsa-miR-5688 0 1 0
chr3:23807339|23807421 hsa-miR-5688 0 1 0
chr17:46032357|46032467 hsa-miR-5688 0 1 0
chr4:152332596|152337936 hsa-miR-5688 0 1 0
chr5:93580850|93581156 hsa-miR-5688 0 1 0
chr5:661436|661647 hsa-miR-5688 0 1 0
chr6:33083328|33083550 hsa-miR-5688 0 1 0
chr11:65573402|65573520 hsa-miR-5688 0 1 0
chr19:37363189|37363297 hsa-miR-5688 0 1 0
chr3:49012037|49012270 hsa-miR-5688 0 1 0
chr1:161158629|161158781 hsa-miR-5688 -7 1 0
chr7:21908247|21908409 hsa-miR-5688 0 1 0
chr20:49114573|49114723 hsa-miR-5688 0 1 0
chr4:150582223|150582394 hsa-miR-5688 0 1 0
chr4:76779258|76779390 hsa-miR-5688 0 1 0
chr1:161158521|161158728 hsa-miR-5688 0 1 0
chr3:49012118|49012270 hsa-miR-5688 0 1 0
chr22:32111472|32111673 hsa-miR-5688 0 1 0
chr16:58281043|58281119 hsa-miR-5688 0 1 0
chr15:97449571|97449736 hsa-miR-5688 0 1 0
chr7:134065000|134065170 hsa-miR-5688 0 1 0
chr11:126294613|126294730 hsa-miR-5688 0 1 0
chr22:32111488|32111673 hsa-miR-5688 0 1 0
chr2:96860205|96860393 hsa-miR-5688 0 1 0
chr17:38726488|38726624 hsa-miR-5688 0 1 0
chr11:62152527|62152673 hsa-miR-5688 0 1 0
chr16:30710097|30711088 hsa-miR-5688 0 1 0
chr7:5528974|5529144 hsa-miR-5688 0 1 0
chr13:98452488|98452681 hsa-miR-5688 0 1 0
chr13:98452438|98452621 hsa-miR-5688 0 1 0
chr9:34338713|34338814 hsa-miR-5688 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5688 SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-5688 ZNF354C zinc finger protein 354C HGNC:16736 details
hsa-miR-5688 ZNF573 zinc finger protein 573 HGNC:26420 details
hsa-miR-5688 RAB31 RAB31, member RAS oncogene family HGNC:9771 details
hsa-miR-5688 TMEM68 transmembrane protein 68 HGNC:26510 details
hsa-miR-5688 EIF5AL1 eukaryotic translation initiation factor 5A like 1 HGNC:17419 details
hsa-miR-5688 HMGN1 high mobility group nucleosome binding domain 1 HGNC:4984 details
hsa-miR-5688 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 HGNC:7701 details
hsa-miR-5688 details
hsa-miR-5688 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-5688 SDC2 syndecan 2 HGNC:10659 details
hsa-miR-5688 RNF41 ring finger protein 41 HGNC:18401 details
hsa-miR-5688 MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-5688 KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-5688 KDM5B lysine demethylase 5B HGNC:18039 details
hsa-miR-5688 FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-5688 COIL coilin HGNC:2184 details
hsa-miR-5688 CD164 CD164 molecule HGNC:1632 details
hsa-miR-5688 C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-5688 B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-5688 ARL10 ADP ribosylation factor like GTPase 10 HGNC:22042 details
hsa-miR-5688 ANKRD40 ankyrin repeat domain 40 HGNC:28233 details
hsa-miR-5688 TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-5688 INHBA inhibin subunit beta A HGNC:6066 details
hsa-miR-5688 NCK2 NCK adaptor protein 2 HGNC:7665 details
hsa-miR-5688 HSPA5 heat shock protein family A (Hsp70) member 5 HGNC:5238 details
hsa-miR-5688 COL4A1 collagen type IV alpha 1 chain HGNC:2202 details
hsa-miR-5688 TRIM67 tripartite motif containing 67 HGNC:31859 details
hsa-miR-5688 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-5688 UBE2Z ubiquitin conjugating enzyme E2 Z HGNC:25847 details
hsa-miR-5688 TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-5688 TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-5688 MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-5688 NUP62 nucleoporin 62 HGNC:8066 details
hsa-miR-5688 DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-5688 NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-5688 DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-5688 NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-5688 PRNP prion protein HGNC:9449 details
hsa-miR-5688 HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-5688 CASP16P caspase 16, pseudogene HGNC:27290 details
hsa-miR-5688 ZBTB47 zinc finger and BTB domain containing 47 HGNC:26955 details
hsa-miR-5688 PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-5688 CRLF3 cytokine receptor like factor 3 HGNC:17177 details
hsa-miR-5688 MTRNR2L7 MT-RNR2 like 7 HGNC:37164 details
hsa-miR-5688 MTRNR2L3 MT-RNR2 like 3 HGNC:37157 details
hsa-miR-5688 NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-5688 CASP8 caspase 8 HGNC:1509 details
hsa-miR-5688 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 HGNC:27030 details
hsa-miR-5688 MTAP methylthioadenosine phosphorylase HGNC:7413 details
hsa-miR-5688 SIGLEC14 sialic acid binding Ig like lectin 14 HGNC:32926 details
hsa-miR-5688 ACBD7 acyl-CoA binding domain containing 7 HGNC:17715 details
hsa-miR-5688 GALNT8 polypeptide N-acetylgalactosaminyltransferase 8 HGNC:4130 details
hsa-miR-5688 SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-5688 SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-5688 QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-5688 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 HGNC:20610 details
hsa-miR-5688 PCDH1 protocadherin 1 HGNC:8655 details
hsa-miR-5688 MYO10 myosin X HGNC:7593 details
hsa-miR-5688 MTRNR2L11 MT-RNR2 like 11 HGNC:37168 details
hsa-miR-5688 MTRNR2L10 MT-RNR2 like 10 HGNC:37167 details
hsa-miR-5688 LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-5688 HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-5688 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 HGNC:20363 details
hsa-miR-5688 SCO1 synthesis of cytochrome C oxidase 1 HGNC:10603 details
hsa-miR-5688 CBX4 chromobox 4 HGNC:1554 details
hsa-miR-5688 SLC25A46 solute carrier family 25 member 46 HGNC:25198 details
hsa-miR-5688 TAB2 TGF-beta activated kinase 1 (MAP3K7) binding protein 2 HGNC:17075 details
hsa-miR-5688 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-5688 SC5D sterol-C5-desaturase HGNC:10547 details
hsa-miR-5688 RAB10 RAB10, member RAS oncogene family HGNC:9759 details
hsa-miR-5688 HOXC8 homeobox C8 HGNC:5129 details
hsa-miR-5688 MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-5688 ACTA1 actin alpha 1, skeletal muscle HGNC:129 details
hsa-miR-5688 EMB embigin HGNC:30465 details
hsa-miR-5688 TIMM10 translocase of inner mitochondrial membrane 10 HGNC:11814 details
hsa-miR-5688 RNF138 ring finger protein 138 HGNC:17765 details
hsa-miR-5688 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase HGNC:8728 details
hsa-miR-5688 MPRIP myosin phosphatase Rho interacting protein HGNC:30321 details
hsa-miR-5688 LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-5688 FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-5688 FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-5688 CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-5688 details
hsa-miR-5688 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-5688 SF1 splicing factor 1 HGNC:12950 details
hsa-miR-5688 ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-5688 MIEF1 mitochondrial elongation factor 1 HGNC:25979 details
hsa-miR-5688 MOCS2 molybdenum cofactor synthesis 2 HGNC:7193 details
hsa-miR-5688 PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-5688 ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-5688 TXNIP thioredoxin interacting protein HGNC:16952 details
hsa-miR-5688 TMEM170B transmembrane protein 170B HGNC:34244 details
hsa-miR-5688 PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-5688 MRPL35 mitochondrial ribosomal protein L35 HGNC:14489 details
hsa-miR-5688 MLLT10 MLLT10 histone lysine methyltransferase DOT1L cofactor HGNC:16063 details
hsa-miR-5688 MLEC malectin HGNC:28973 details
hsa-miR-5688 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-5688 HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-5688 FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-5688 BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-5688 ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-5688 MTRNR2L1 MT-RNR2 like 1 HGNC:37155 details
hsa-miR-5688 CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-5688 CEP19 centrosomal protein 19 HGNC:28209 details
hsa-miR-5688 KIAA1549L KIAA1549 like HGNC:24836 details
hsa-miR-5688 ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-5688 TNPO1 transportin 1 HGNC:6401 details
hsa-miR-5688 TNPO2 transportin 2 HGNC:19998 details
hsa-miR-5688 details
hsa-miR-5688 CRLS1 cardiolipin synthase 1 HGNC:16148 details
hsa-miR-5688 ZNF324B zinc finger protein 324B HGNC:33107 details
hsa-miR-5688 HOXD12 homeobox D12 HGNC:5135 details
hsa-miR-5688 SIX3 SIX homeobox 3 HGNC:10889 details
hsa-miR-5688 RNF141 ring finger protein 141 HGNC:21159 details
hsa-miR-5688 LYPLA1 lysophospholipase 1 HGNC:6737 details
hsa-miR-5688 STX4 syntaxin 4 HGNC:11439 details
hsa-miR-5688 MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-5688 SNX24 sorting nexin 24 HGNC:21533 details
hsa-miR-5688 SPNS1 sphingolipid transporter 1 (putative) HGNC:30621 details
hsa-miR-5688 ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-5688 CDCA2 cell division cycle associated 2 HGNC:14623 details
hsa-miR-5688 ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-5688 ZNF740 zinc finger protein 740 HGNC:27465 details
hsa-miR-5688 WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-5688 MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-5688 LRRC4 leucine rich repeat containing 4 HGNC:15586 details
hsa-miR-5688 EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-5688 CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-5688 LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-5688 ZZZ3 zinc finger ZZ-type containing 3 HGNC:24523 details
hsa-miR-5688 ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-5688 PCNX1 pecanex 1 HGNC:19740 details
hsa-miR-5688 CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-5688 MARCKS myristoylated alanine rich protein kinase C substrate HGNC:6759 details
hsa-miR-5688 SCIMP SLP adaptor and CSK interacting membrane protein HGNC:33504 details
hsa-miR-5688 TOP2A DNA topoisomerase II alpha HGNC:11989 details
hsa-miR-5688 WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-5688 UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-5688 TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-5688 details
hsa-miR-5688 OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-5688 HEXIM1 HEXIM P-TEFb complex subunit 1 HGNC:24953 details
hsa-miR-5688 CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-5688 CDC73 cell division cycle 73 HGNC:16783 details
hsa-miR-5688 TTYH3 tweety family member 3 HGNC:22222 details
hsa-miR-5688 PER2 period circadian regulator 2 HGNC:8846 details
hsa-miR-5688 XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-5688 ZBTB8B zinc finger and BTB domain containing 8B HGNC:37057 details
hsa-miR-5688 TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-5688 VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-5688 MSANTD3-TMEFF1 MSANTD3-TMEFF1 readthrough HGNC:38838 details
hsa-miR-5688 NGDN neuroguidin HGNC:20271 details
hsa-miR-5688 SREBF1 sterol regulatory element binding transcription factor 1 HGNC:11289 details
hsa-miR-5688 TMEFF1 transmembrane protein with EGF like and two follistatin like domains 1 HGNC:11866 details
hsa-miR-5688 UTP4 UTP4 small subunit processome component HGNC:1983 details
hsa-miR-5688 IL15 interleukin 15 HGNC:5977 details
hsa-miR-5688 C4orf46 chromosome 4 open reading frame 46 HGNC:27320 details
hsa-miR-5688 MAK male germ cell associated kinase HGNC:6816 details
hsa-miR-5688 CCDC141 coiled-coil domain containing 141 HGNC:26821 details
hsa-miR-5688 CD9 CD9 molecule HGNC:1709 details
hsa-miR-5688 DGKB diacylglycerol kinase beta HGNC:2850 details
hsa-miR-5688 EEF2K eukaryotic elongation factor 2 kinase HGNC:24615 details
hsa-miR-5688 GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-5688 HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-5688 IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-5688 RFK riboflavin kinase HGNC:30324 details
hsa-miR-5688 ACTC1 actin alpha cardiac muscle 1 HGNC:143 details
hsa-miR-5688 MTMR9 myotubularin related protein 9 HGNC:14596 details
hsa-miR-5688 PRRT2 proline rich transmembrane protein 2 HGNC:30500 details
hsa-miR-5688 COPS7B COP9 signalosome subunit 7B HGNC:16760 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab