miRNA Card

miRNA General Information
miRNA ID hsa-miR-5692a
Description Homo sapiens miR-5692a-1 stem-loop
Comment None
Experiment Illumina [1]
Sequence CAAAUAAUACCACAGUGGGUGU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:157416867|157417041 hsa-miR-5692a 0 1 0
chr14:23025026|23025150 hsa-miR-5692a 0 1 0
chrX:3309563|3309651 hsa-miR-5692a 0 1 0
chr5:138506579|138506769 hsa-miR-5692a 0 1 0
chr13:24434841|24434981 hsa-miR-5692a 1 0 0
chr2:99368502|99368591 hsa-miR-5692a 1 0 0
chr13:24434858|24434966 hsa-miR-5692a 1 0 0
chr2:186680680|186680860 hsa-miR-5692a 1 0 0
chr13:24434745|24434981 hsa-miR-5692a 1 0 0
chr1:246666057|246666176 hsa-miR-5692a 0 1 0
chr9:35105050|35105186 hsa-miR-5692a 0 1 0
chr1:1054990|1055093 hsa-miR-5692a 0 1 0
chr1:1054948|1055093 hsa-miR-5692a 0 1 0
chr17:76006888|76007044 hsa-miR-5692a 0 1 0
chr12:53315551|53315729 hsa-miR-5692a 0 1 0
chr20:36046381|36046495 hsa-miR-5692a 0 1 0
chrX:73825454|73825569 hsa-miR-5692a 0 1 0
chr7:107630296|107630536 hsa-miR-5692a 0 1 0
chrX:71568097|71573721 hsa-miR-5692a 0 1 0
chr19:57303079|57303220 hsa-miR-5692a 0 1 0
chrX:103676267~103676385 hsa-miR-5692a 0 1 0
chr20:36046381~36046492 hsa-miR-5692a 0 1 0
chr1:246666057~246666176 hsa-miR-5692a 0 1 0
chr13:24434841~24434981 hsa-miR-5692a 0 1 0
chr2:99368502~99368591 hsa-miR-5692a 0 1 0
chr13:24434858~24434966 hsa-miR-5692a 0 1 0
chr12:111765201~111765333 hsa-miR-5692a 0 1 0
chr13:24434745~24434981 hsa-miR-5692a 0 1 0
chr7:37791153|37791286 hsa-miR-5692a 0 1 0
chr5:179340879|179341070 hsa-miR-5692a 0 1 0
chr4:151140562|151140675 hsa-miR-5692a 0 1 0
chr4:82834246|82834464 hsa-miR-5692a 1 0 0
chr7:106905519|106905691 hsa-miR-5692a 0 1 0
chr5:119399414|119399555 hsa-miR-5692a 0 1 0
chr10:69104452|69104569 hsa-miR-5692a 0 1 0
chr10:93509860|93509956 hsa-miR-5692a 0 1 0
chr20:51538150|51538300 hsa-miR-5692a 0 1 0
chr6:15387755|15387926 hsa-miR-5692a 0 1 0
chr20:36046381|36046492 hsa-miR-5692a 0 1 0
chr5:71573266|71573480 hsa-miR-5692a 0 1 0
chr12:56663763|56663945 hsa-miR-5692a 0 1 0
chr17:4682543|4682901 hsa-miR-5692a 0 1 0
chr3:49116291|49116507 hsa-miR-5692a 0 1 0
chr1:1054940|1055093 hsa-miR-5692a 0 1 0
chr10:74413839|74413968 hsa-miR-5692a 0 1 0
chr1:178476078|178476186 hsa-miR-5692a 0 1 0
chr1:1054928|1055080 hsa-miR-5692a -14 1 0
chr9:129818572|129818791 hsa-miR-5692a -12 1 0
chr9:129006790|129006918 hsa-miR-5692a 1 0 0
chr20:50192268|50192418 hsa-miR-5692a 0 1 0
chr17:50382318|50382431 hsa-miR-5692a 0 1 0
chr9:83973556|83973765 hsa-miR-5692a 0 1 0
chr7:100033549|100033815 hsa-miR-5692a 0 1 0
chr4:55370532|55370647 hsa-miR-5692a 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5692a ZNF559 zinc finger protein 559 HGNC:28197 details
hsa-miR-5692a SLC5A7 solute carrier family 5 member 7 HGNC:14025 details
hsa-miR-5692a KLHL20 kelch like family member 20 HGNC:25056 details
hsa-miR-5692a VAMP3 vesicle associated membrane protein 3 HGNC:12644 details
hsa-miR-5692a UBL3 ubiquitin like 3 HGNC:12504 details
hsa-miR-5692a TRDMT1 tRNA aspartic acid methyltransferase 1 HGNC:2977 details
hsa-miR-5692a ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-5692a NETO1 neuropilin and tolloid like 1 HGNC:13823 details
hsa-miR-5692a HLF HLF transcription factor, PAR bZIP family member HGNC:4977 details
hsa-miR-5692a SREBF2 sterol regulatory element binding transcription factor 2 HGNC:11290 details
hsa-miR-5692a NCOA4 nuclear receptor coactivator 4 HGNC:7671 details
hsa-miR-5692a CDC73 cell division cycle 73 HGNC:16783 details
hsa-miR-5692a NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-5692a ARID1B AT-rich interaction domain 1B HGNC:18040 details
hsa-miR-5692a MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-5692a WDR35 WD repeat domain 35 HGNC:29250 details
hsa-miR-5692a TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-5692a FAM117B family with sequence similarity 117 member B HGNC:14440 details
hsa-miR-5692a TRAF6 TNF receptor associated factor 6 HGNC:12036 details
hsa-miR-5692a ANTXR2 ANTXR cell adhesion molecule 2 HGNC:21732 details
hsa-miR-5692a GABRA3 gamma-aminobutyric acid type A receptor subunit alpha3 HGNC:4077 details
hsa-miR-5692a ZNF621 zinc finger protein 621 HGNC:24787 details
hsa-miR-5692a ZNF555 zinc finger protein 555 HGNC:28382 details
hsa-miR-5692a ENOX1 ecto-NOX disulfide-thiol exchanger 1 HGNC:25474 details
hsa-miR-5692a CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-5692a ZNF573 zinc finger protein 573 HGNC:26420 details
hsa-miR-5692a ATP6V0B ATPase H+ transporting V0 subunit b HGNC:861 details
hsa-miR-5692a TMEM68 transmembrane protein 68 HGNC:26510 details
hsa-miR-5692a details
hsa-miR-5692a ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-5692a ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-5692a UBE2S ubiquitin conjugating enzyme E2 S HGNC:17895 details
hsa-miR-5692a ZXDB zinc finger X-linked duplicated B HGNC:13199 details
hsa-miR-5692a ZNF148 zinc finger protein 148 HGNC:12933 details
hsa-miR-5692a VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-5692a TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-5692a TMEM50B transmembrane protein 50B HGNC:1280 details
hsa-miR-5692a SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-5692a PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-5692a NLK nemo like kinase HGNC:29858 details
hsa-miR-5692a HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-5692a GBA2 glucosylceramidase beta 2 HGNC:18986 details
hsa-miR-5692a SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-5692a DVL3 dishevelled segment polarity protein 3 HGNC:3087 details
hsa-miR-5692a CSNK1A1 casein kinase 1 alpha 1 HGNC:2451 details
hsa-miR-5692a CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-5692a AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-5692a SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-5692a CEP120 centrosomal protein 120 HGNC:26690 details
hsa-miR-5692a AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-5692a PLEKHO1 pleckstrin homology domain containing O1 HGNC:24310 details
hsa-miR-5692a PTMA prothymosin alpha HGNC:9623 details
hsa-miR-5692a RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-5692a DENND4C DENN domain containing 4C HGNC:26079 details
hsa-miR-5692a SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-5692a ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-5692a SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-5692a PLCG1 phospholipase C gamma 1 HGNC:9065 details
hsa-miR-5692a MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-5692a GNG12 G protein subunit gamma 12 HGNC:19663 details
hsa-miR-5692a ZNF780A zinc finger protein 780A HGNC:27603 details
hsa-miR-5692a NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-5692a RCC1 regulator of chromosome condensation 1 HGNC:1913 details
hsa-miR-5692a MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-5692a CD38 CD38 molecule HGNC:1667 details
hsa-miR-5692a TPD52 tumor protein D52 HGNC:12005 details
hsa-miR-5692a TMF1 TATA element modulatory factor 1 HGNC:11870 details
hsa-miR-5692a TMEM167A transmembrane protein 167A HGNC:28330 details
hsa-miR-5692a PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-5692a HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 HGNC:24941 details
hsa-miR-5692a details
hsa-miR-5692a FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-5692a FEM1B fem-1 homolog B HGNC:3649 details
hsa-miR-5692a DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-5692a ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-5692a ATP13A3 ATPase 13A3 HGNC:24113 details
hsa-miR-5692a DCK deoxycytidine kinase HGNC:2704 details
hsa-miR-5692a ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-5692a ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-5692a ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-5692a YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-5692a NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-5692a NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-5692a GAS1 growth arrest specific 1 HGNC:4165 details
hsa-miR-5692a STOML1 stomatin like 1 HGNC:14560 details
hsa-miR-5692a ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-5692a RPL7 ribosomal protein L7 HGNC:10363 details
hsa-miR-5692a FOCAD focadhesin HGNC:23377 details
hsa-miR-5692a LRP2BP LRP2 binding protein HGNC:25434 details
hsa-miR-5692a details
hsa-miR-5692a CLEC4E C-type lectin domain family 4 member E HGNC:14555 details
hsa-miR-5692a LSM8 LSM8 homolog, U6 small nuclear RNA associated HGNC:20471 details
hsa-miR-5692a TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-5692a ID2 inhibitor of DNA binding 2 HGNC:5361 details
hsa-miR-5692a EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-5692a DDIT3 DNA damage inducible transcript 3 HGNC:2726 details
hsa-miR-5692a ARL13B ADP ribosylation factor like GTPase 13B HGNC:25419 details
hsa-miR-5692a PARP2 poly(ADP-ribose) polymerase 2 HGNC:272 details
hsa-miR-5692a FAM71F2 family with sequence similarity 71 member F2 HGNC:27998 details
hsa-miR-5692a C4orf36 chromosome 4 open reading frame 36 HGNC:28386 details
hsa-miR-5692a POU5F1B POU class 5 homeobox 1B HGNC:9223 details
hsa-miR-5692a NUP58 nucleoporin 58 HGNC:20261 details
hsa-miR-5692a CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 HGNC:104 details
hsa-miR-5692a MEAF6 MYST/Esa1 associated factor 6 HGNC:25674 details
hsa-miR-5692a AVPI1 arginine vasopressin induced 1 HGNC:30898 details
hsa-miR-5692a ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 HGNC:29286 details
hsa-miR-5692a GSDMB gasdermin B HGNC:23690 details
hsa-miR-5692a KRBOX4 KRAB box domain containing 4 HGNC:26007 details
hsa-miR-5692a PDE5A phosphodiesterase 5A HGNC:8784 details
hsa-miR-5692a SKP1 S-phase kinase associated protein 1 HGNC:10899 details
hsa-miR-5692a CENPA centromere protein A HGNC:1851 details
hsa-miR-5692a PSMG1 proteasome assembly chaperone 1 HGNC:3043 details
hsa-miR-5692a FUT1 fucosyltransferase 1 (H blood group) HGNC:4012 details
hsa-miR-5692a TIPARP TCDD inducible poly(ADP-ribose) polymerase HGNC:23696 details
hsa-miR-5692a POLR3K RNA polymerase III subunit K HGNC:14121 details
hsa-miR-5692a TXNDC16 thioredoxin domain containing 16 HGNC:19965 details
hsa-miR-5692a TFCP2L1 transcription factor CP2 like 1 HGNC:17925 details
hsa-miR-5692a GLP2R glucagon like peptide 2 receptor HGNC:4325 details
hsa-miR-5692a details
hsa-miR-5692a ZNF764 zinc finger protein 764 HGNC:28200 details
hsa-miR-5692a ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-5692a ZKSCAN8 zinc finger with KRAB and SCAN domains 8 HGNC:12983 details
hsa-miR-5692a UST uronyl 2-sulfotransferase HGNC:17223 details
hsa-miR-5692a UBE2W ubiquitin conjugating enzyme E2 W HGNC:25616 details
hsa-miR-5692a TMED7 transmembrane p24 trafficking protein 7 HGNC:24253 details
hsa-miR-5692a STC2 stanniocalcin 2 HGNC:11374 details
hsa-miR-5692a SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-5692a PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-5692a PIGA phosphatidylinositol glycan anchor biosynthesis class A HGNC:8957 details
hsa-miR-5692a PER1 period circadian regulator 1 HGNC:8845 details
hsa-miR-5692a PAK2 p21 (RAC1) activated kinase 2 HGNC:8591 details
hsa-miR-5692a MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-5692a LMOD2 leiomodin 2 HGNC:6648 details
hsa-miR-5692a KMT2B lysine methyltransferase 2B HGNC:15840 details
hsa-miR-5692a HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-5692a HIF1A hypoxia inducible factor 1 subunit alpha HGNC:4910 details
hsa-miR-5692a HECW1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 HGNC:22195 details
hsa-miR-5692a GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-5692a GPR137C G protein-coupled receptor 137C HGNC:25445 details
hsa-miR-5692a GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-5692a GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 HGNC:4125 details
hsa-miR-5692a ESRP2 epithelial splicing regulatory protein 2 HGNC:26152 details
hsa-miR-5692a DCDC2 doublecortin domain containing 2 HGNC:18141 details
hsa-miR-5692a CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-5692a C16orf87 chromosome 16 open reading frame 87 HGNC:33754 details
hsa-miR-5692a IRGQ immunity related GTPase Q HGNC:24868 details
hsa-miR-5692a ACTR6 actin related protein 6 HGNC:24025 details
hsa-miR-5692a ZNF611 zinc finger protein 611 HGNC:28766 details
hsa-miR-5692a ZNF585B zinc finger protein 585B HGNC:30948 details
hsa-miR-5692a MAT2B methionine adenosyltransferase 2B HGNC:6905 details
hsa-miR-5692a FAM53C family with sequence similarity 53 member C HGNC:1336 details
hsa-miR-5692a details
hsa-miR-5692a EXOSC6 exosome component 6 HGNC:19055 details
hsa-miR-5692a NPR1 natriuretic peptide receptor 1 HGNC:7943 details
hsa-miR-5692a EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-5692a details
hsa-miR-5692a ATXN2L ataxin 2 like HGNC:31326 details
hsa-miR-5692a details
hsa-miR-5692a BTBD9 BTB domain containing 9 HGNC:21228 details
hsa-miR-5692a UBE2E1 ubiquitin conjugating enzyme E2 E1 HGNC:12477 details
hsa-miR-5692a TRIM66 tripartite motif containing 66 HGNC:29005 details
hsa-miR-5692a RSL24D1 ribosomal L24 domain containing 1 HGNC:18479 details
hsa-miR-5692a TERF2 telomeric repeat binding factor 2 HGNC:11729 details
hsa-miR-5692a FYTTD1 forty-two-three domain containing 1 HGNC:25407 details
hsa-miR-5692a DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-5692a ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-5692a ZBTB44 zinc finger and BTB domain containing 44 HGNC:25001 details
hsa-miR-5692a UBE3A ubiquitin protein ligase E3A HGNC:12496 details
hsa-miR-5692a TSPAN12 tetraspanin 12 HGNC:21641 details
hsa-miR-5692a SYF2 SYF2 pre-mRNA splicing factor HGNC:19824 details
hsa-miR-5692a SPRED3 sprouty related EVH1 domain containing 3 HGNC:31041 details
hsa-miR-5692a SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-5692a RNF115 ring finger protein 115 HGNC:18154 details
hsa-miR-5692a RBBP6 RB binding protein 6, ubiquitin ligase HGNC:9889 details
hsa-miR-5692a PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-5692a PLEKHB2 pleckstrin homology domain containing B2 HGNC:19236 details
hsa-miR-5692a KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-5692a HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-5692a DCTN6 dynactin subunit 6 HGNC:16964 details
hsa-miR-5692a CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 HGNC:28680 details
hsa-miR-5692a CCND2 cyclin D2 HGNC:1583 details
hsa-miR-5692a CCDC6 coiled-coil domain containing 6 HGNC:18782 details
hsa-miR-5692a ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-5692a PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-5692a ABRACL ABRA C-terminal like HGNC:21230 details
hsa-miR-5692a ZNF254 zinc finger protein 254 HGNC:13047 details
hsa-miR-5692a MARVELD2 MARVEL domain containing 2 HGNC:26401 details
hsa-miR-5692a ZNF267 zinc finger protein 267 HGNC:13060 details
hsa-miR-5692a KIAA1143 KIAA1143 HGNC:29198 details
hsa-miR-5692a FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-5692a MRPL34 mitochondrial ribosomal protein L34 HGNC:14488 details
hsa-miR-5692a ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-miR-5692a TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-5692a SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-5692a SIAH2 siah E3 ubiquitin protein ligase 2 HGNC:10858 details
hsa-miR-5692a RRN3 RRN3 homolog, RNA polymerase I transcription factor HGNC:30346 details
hsa-miR-5692a PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-5692a PKN2 protein kinase N2 HGNC:9406 details
hsa-miR-5692a OCLN occludin HGNC:8104 details
hsa-miR-5692a MED17 mediator complex subunit 17 HGNC:2375 details
hsa-miR-5692a MB21D2 Mab-21 domain containing 2 HGNC:30438 details
hsa-miR-5692a MAFK MAF bZIP transcription factor K HGNC:6782 details
hsa-miR-5692a LNPEP leucyl and cystinyl aminopeptidase HGNC:6656 details
hsa-miR-5692a details
hsa-miR-5692a GNB1 G protein subunit beta 1 HGNC:4396 details
hsa-miR-5692a EPC2 enhancer of polycomb homolog 2 HGNC:24543 details
hsa-miR-5692a EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-5692a EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 HGNC:18967 details
hsa-miR-5692a DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-5692a CBFB core-binding factor subunit beta HGNC:1539 details
hsa-miR-5692a details
hsa-miR-5692a BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-5692a SRFBP1 serum response factor binding protein 1 HGNC:26333 details
hsa-miR-5692a RPS17 ribosomal protein S17 HGNC:10397 details
hsa-miR-5692a ZBTB43 zinc finger and BTB domain containing 43 HGNC:17908 details
hsa-miR-5692a PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-5692a KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-5692a ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-5692a PVR PVR cell adhesion molecule HGNC:9705 details
hsa-miR-5692a PSME3 proteasome activator subunit 3 HGNC:9570 details
hsa-miR-5692a PDXP pyridoxal phosphatase HGNC:30259 details
hsa-miR-5692a ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-5692a STK35 serine/threonine kinase 35 HGNC:16254 details
hsa-miR-5692a RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-5692a RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-5692a PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-5692a POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-5692a LRP12 LDL receptor related protein 12 HGNC:31708 details
hsa-miR-5692a FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-5692a EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-5692a CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-5692a ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-5692a AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-5692a ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-5692a PPP3R1 protein phosphatase 3 regulatory subunit B, alpha HGNC:9317 details
hsa-miR-5692a details
hsa-miR-5692a HS6ST1 heparan sulfate 6-O-sulfotransferase 1 HGNC:5201 details
hsa-miR-5692a PRC1 protein regulator of cytokinesis 1 HGNC:9341 details
hsa-miR-5692a TMOD2 tropomodulin 2 HGNC:11872 details
hsa-miR-5692a RAPGEF1 Rap guanine nucleotide exchange factor 1 HGNC:4568 details
hsa-miR-5692a SH3KBP1 SH3 domain containing kinase binding protein 1 HGNC:13867 details
hsa-miR-5692a TMEM156 transmembrane protein 156 HGNC:26260 details
hsa-miR-5692a HLA-DRB5 major histocompatibility complex, class II, DR beta 5 HGNC:4953 details
hsa-miR-5692a SH3PXD2A SH3 and PX domains 2A HGNC:23664 details
hsa-miR-5692a XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-5692a PPARA peroxisome proliferator activated receptor alpha HGNC:9232 details
hsa-miR-5692a SCOC short coiled-coil protein HGNC:20335 details
hsa-miR-5692a DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A HGNC:3091 details
hsa-miR-5692a HLA-DRB1 major histocompatibility complex, class II, DR beta 1 HGNC:4948 details
hsa-miR-5692a TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-5692a RNF152 ring finger protein 152 HGNC:26811 details
hsa-miR-5692a ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-5692a TRIM33 tripartite motif containing 33 HGNC:16290 details
hsa-miR-5692a PIP4P2 phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 HGNC:25452 details
hsa-miR-5692a LRRC15 leucine rich repeat containing 15 HGNC:20818 details
hsa-miR-5692a BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-5692a JAK2 Janus kinase 2 HGNC:6192 details
hsa-miR-5692a C5AR2 complement C5a receptor 2 HGNC:4527 details
hsa-miR-5692a SLC43A3 solute carrier family 43 member 3 HGNC:17466 details
hsa-miR-5692a STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-5692a PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-5692a LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-5692a EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 HGNC:16787 details
hsa-miR-5692a BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-5692a MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-5692a GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-5692a CYYR1 cysteine and tyrosine rich 1 HGNC:16274 details
hsa-miR-5692a PROSER2 proline and serine rich 2 HGNC:23728 details
hsa-miR-5692a PCTP phosphatidylcholine transfer protein HGNC:8752 details
hsa-miR-5692a LRP1B LDL receptor related protein 1B HGNC:6693 details
hsa-miR-5692a WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-5692a LIPC lipase C, hepatic type HGNC:6619 details
hsa-miR-5692a GEM GTP binding protein overexpressed in skeletal muscle HGNC:4234 details
hsa-miR-5692a ART4 ADP-ribosyltransferase 4 (inactive) (Dombrock blood group) HGNC:726 details
hsa-miR-5692a CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-5692a ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-5692a CHDH choline dehydrogenase HGNC:24288 details
hsa-miR-5692a DOT1L DOT1 like histone lysine methyltransferase HGNC:24948 details
hsa-miR-5692a RTN3 reticulon 3 HGNC:10469 details
hsa-miR-5692a ABHD12 abhydrolase domain containing 12, lysophospholipase HGNC:15868 details
hsa-miR-5692a BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-5692a CCDC141 coiled-coil domain containing 141 HGNC:26821 details
hsa-miR-5692a SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-5692a ZNF487 zinc finger protein 487 HGNC:23488 details
hsa-miR-5692a ANO8 anoctamin 8 HGNC:29329 details
hsa-miR-5692a details
hsa-miR-5692a HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 HGNC:18646 details
hsa-miR-5692a SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-5692a SRRM4 serine/arginine repetitive matrix 4 HGNC:29389 details
hsa-miR-5692a TESPA1 thymocyte expressed, positive selection associated 1 HGNC:29109 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab