miRNA Card

miRNA General Information
miRNA ID hsa-miR-5692c
Description Homo sapiens miR-5692c-1 stem-loop
Comment None
Experiment Illumina [1]
Sequence AAUAAUAUCACAGUAGGUGUAC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr17:30421664|30421775 hsa-miR-5692c 1 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5692c ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) HGNC:74 details
hsa-miR-5692c ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-5692c TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-5692c TYRP1 tyrosinase related protein 1 HGNC:12450 details
hsa-miR-5692c ATAD5 ATPase family AAA domain containing 5 HGNC:25752 details
hsa-miR-5692c ENOX1 ecto-NOX disulfide-thiol exchanger 1 HGNC:25474 details
hsa-miR-5692c FXN frataxin HGNC:3951 details
hsa-miR-5692c NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-5692c TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-5692c SRSF1 serine and arginine rich splicing factor 1 HGNC:10780 details
hsa-miR-5692c SLC38A1 solute carrier family 38 member 1 HGNC:13447 details
hsa-miR-5692c NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-5692c MSANTD3 Myb/SANT DNA binding domain containing 3 HGNC:23370 details
hsa-miR-5692c MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-5692c BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-5692c BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-5692c details
hsa-miR-5692c NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-5692c SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-5692c AVPR1A arginine vasopressin receptor 1A HGNC:895 details
hsa-miR-5692c TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-5692c FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-5692c CCND1 cyclin D1 HGNC:1582 details
hsa-miR-5692c ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase HGNC:77 details
hsa-miR-5692c GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-5692c EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-5692c CAMSAP2 calmodulin regulated spectrin associated protein family member 2 HGNC:29188 details
hsa-miR-5692c ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-5692c SLC25A27 solute carrier family 25 member 27 HGNC:21065 details
hsa-miR-5692c CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-5692c TNFSF9 TNF superfamily member 9 HGNC:11939 details
hsa-miR-5692c DDX55 DEAD-box helicase 55 HGNC:20085 details
hsa-miR-5692c ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-5692c ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-5692c ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-5692c SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-5692c details
hsa-miR-5692c PRKCD protein kinase C delta HGNC:9399 details
hsa-miR-5692c MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-5692c FOCAD focadhesin HGNC:23377 details
hsa-miR-5692c RAB32 RAB32, member RAS oncogene family HGNC:9772 details
hsa-miR-5692c ABCF1 ATP binding cassette subfamily F member 1 HGNC:70 details
hsa-miR-5692c TRIM35 tripartite motif containing 35 HGNC:16285 details
hsa-miR-5692c ZER1 zyg-11 related cell cycle regulator HGNC:30960 details
hsa-miR-5692c VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-5692c TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-5692c NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-5692c SYP synaptophysin HGNC:11506 details
hsa-miR-5692c SCAF4 SR-related CTD associated factor 4 HGNC:19304 details
hsa-miR-5692c PITPNC1 phosphatidylinositol transfer protein cytoplasmic 1 HGNC:21045 details
hsa-miR-5692c PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-5692c PER1 period circadian regulator 1 HGNC:8845 details
hsa-miR-5692c KLHL9 kelch like family member 9 HGNC:18732 details
hsa-miR-5692c HOXA11 homeobox A11 HGNC:5101 details
hsa-miR-5692c GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-5692c FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-5692c SHISA9 shisa family member 9 HGNC:37231 details
hsa-miR-5692c ZFP42 ZFP42 zinc finger protein HGNC:30949 details
hsa-miR-5692c MAPK7 mitogen-activated protein kinase 7 HGNC:6880 details
hsa-miR-5692c SLC9A4 solute carrier family 9 member A4 HGNC:11077 details
hsa-miR-5692c TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-5692c ZNF148 zinc finger protein 148 HGNC:12933 details
hsa-miR-5692c ZFC3H1 zinc finger C3H1-type containing HGNC:28328 details
hsa-miR-5692c UST uronyl 2-sulfotransferase HGNC:17223 details
hsa-miR-5692c PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-5692c PAK2 p21 (RAC1) activated kinase 2 HGNC:8591 details
hsa-miR-5692c MLLT3 MLLT3 super elongation complex subunit HGNC:7136 details
hsa-miR-5692c GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-5692c FBXO22 F-box protein 22 HGNC:13593 details
hsa-miR-5692c ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-5692c ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-5692c YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-5692c HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-5692c ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-5692c SDHD succinate dehydrogenase complex subunit D HGNC:10683 details
hsa-miR-5692c PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-5692c ZNF516 zinc finger protein 516 HGNC:28990 details
hsa-miR-5692c XKR9 XK related 9 HGNC:20937 details
hsa-miR-5692c KLRC3 killer cell lectin like receptor C3 HGNC:6376 details
hsa-miR-5692c ANGPTL3 angiopoietin like 3 HGNC:491 details
hsa-miR-5692c KYAT3 kynurenine aminotransferase 3 HGNC:33238 details
hsa-miR-5692c ZNF383 zinc finger protein 383 HGNC:18609 details
hsa-miR-5692c C8orf33 chromosome 8 open reading frame 33 HGNC:26104 details
hsa-miR-5692c ACSM2B acyl-CoA synthetase medium chain family member 2B HGNC:30931 details
hsa-miR-5692c SPC25 SPC25 component of NDC80 kinetochore complex HGNC:24031 details
hsa-miR-5692c LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-5692c GIMAP4 GTPase, IMAP family member 4 HGNC:21872 details
hsa-miR-5692c ZCCHC9 zinc finger CCHC-type containing 9 HGNC:25424 details
hsa-miR-5692c ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-5692c ZBTB44 zinc finger and BTB domain containing 44 HGNC:25001 details
hsa-miR-5692c XKR4 XK related 4 HGNC:29394 details
hsa-miR-5692c UBE3A ubiquitin protein ligase E3A HGNC:12496 details
hsa-miR-5692c TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-5692c SYF2 SYF2 pre-mRNA splicing factor HGNC:19824 details
hsa-miR-5692c SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-5692c RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-5692c PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-5692c PIGW phosphatidylinositol glycan anchor biosynthesis class W HGNC:23213 details
hsa-miR-5692c PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-5692c OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-5692c LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-5692c LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-5692c HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-5692c FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-5692c CCND2 cyclin D2 HGNC:1583 details
hsa-miR-5692c BOLA3 bolA family member 3 HGNC:24415 details
hsa-miR-5692c LUZP2 leucine zipper protein 2 HGNC:23206 details
hsa-miR-5692c WWTR1 WW domain containing transcription regulator 1 HGNC:24042 details
hsa-miR-5692c DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-5692c GNL3 G protein nucleolar 3 HGNC:29931 details
hsa-miR-5692c ZNF681 zinc finger protein 681 HGNC:26457 details
hsa-miR-5692c details
hsa-miR-5692c TMEM241 transmembrane protein 241 HGNC:31723 details
hsa-miR-5692c ZFP37 ZFP37 zinc finger protein HGNC:12863 details
hsa-miR-5692c DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-5692c TTC8 tetratricopeptide repeat domain 8 HGNC:20087 details
hsa-miR-5692c ZNF267 zinc finger protein 267 HGNC:13060 details
hsa-miR-5692c SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-5692c VGLL2 vestigial like family member 2 HGNC:20232 details
hsa-miR-5692c UBR7 ubiquitin protein ligase E3 component n-recognin 7 HGNC:20344 details
hsa-miR-5692c TACC1 transforming acidic coiled-coil containing protein 1 HGNC:11522 details
hsa-miR-5692c RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-5692c RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-5692c RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-5692c PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-5692c PMEPA1 prostate transmembrane protein, androgen induced 1 HGNC:14107 details
hsa-miR-5692c PITX2 paired like homeodomain 2 HGNC:9005 details
hsa-miR-5692c MXD1 MAX dimerization protein 1 HGNC:6761 details
hsa-miR-5692c HSPA4L heat shock protein family A (Hsp70) member 4 like HGNC:17041 details
hsa-miR-5692c EPC2 enhancer of polycomb homolog 2 HGNC:24543 details
hsa-miR-5692c DUSP8 dual specificity phosphatase 8 HGNC:3074 details
hsa-miR-5692c DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-5692c CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-5692c BTN3A3 butyrophilin subfamily 3 member A3 HGNC:1140 details
hsa-miR-5692c TRMT112 tRNA methyltransferase activator subunit 11-2 HGNC:26940 details
hsa-miR-5692c ADD3 adducin 3 HGNC:245 details
hsa-miR-5692c ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-5692c CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-5692c YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-5692c TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-5692c NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-5692c PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-5692c NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-5692c MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-5692c LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-5692c KCNC4 potassium voltage-gated channel subfamily C member 4 HGNC:6236 details
hsa-miR-5692c FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-5692c EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-5692c CRKL CRK like proto-oncogene, adaptor protein HGNC:2363 details
hsa-miR-5692c LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-5692c details
hsa-miR-5692c ARHGAP6 Rho GTPase activating protein 6 HGNC:676 details
hsa-miR-5692c RAPGEFL1 Rap guanine nucleotide exchange factor like 1 HGNC:17428 details
hsa-miR-5692c STX16 syntaxin 16 HGNC:11431 details
hsa-miR-5692c RBMXL1 RBMX like 1 HGNC:25073 details
hsa-miR-5692c EPDR1 ependymin related 1 HGNC:17572 details
hsa-miR-5692c SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-5692c LAMP3 lysosomal associated membrane protein 3 HGNC:14582 details
hsa-miR-5692c NCK2 NCK adaptor protein 2 HGNC:7665 details
hsa-miR-5692c CNTNAP5 contactin associated protein family member 5 HGNC:18748 details
hsa-miR-5692c SIK3 SIK family kinase 3 HGNC:29165 details
hsa-miR-5692c MFAP5 microfibril associated protein 5 HGNC:29673 details
hsa-miR-5692c SVIP small VCP interacting protein HGNC:25238 details
hsa-miR-5692c HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-5692c CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-5692c BACH2 BTB domain and CNC homolog 2 HGNC:14078 details
hsa-miR-5692c ADD2 adducin 2 HGNC:244 details
hsa-miR-5692c AFF1 AF4/FMR2 family member 1 HGNC:7135 details
hsa-miR-5692c MLX MAX dimerization protein MLX HGNC:11645 details
hsa-miR-5692c NPLOC4 NPL4 homolog, ubiquitin recognition factor HGNC:18261 details
hsa-miR-5692c ULBP2 UL16 binding protein 2 HGNC:14894 details
hsa-miR-5692c TPR translocated promoter region, nuclear basket protein HGNC:12017 details
hsa-miR-5692c B3GAT2 beta-1,3-glucuronyltransferase 2 HGNC:922 details
hsa-miR-5692c NRP2 neuropilin 2 HGNC:8005 details
hsa-miR-5692c ZNF587 zinc finger protein 587 HGNC:30955 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab