miRNA Card

miRNA General Information
miRNA ID hsa-miR-5696
Description Homo sapiens miR-5696 stem-loop
Comment None
Experiment Illumina [1]
Sequence CUCAUUUAAGUAGUCUGAUGCC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:98533464|98533657 hsa-miR-5696 1 0 0
chr4:73575694|73575796 hsa-miR-5696 0 1 0
chr16:89296077|89296221 hsa-miR-5696 0 1 0
chr1:58575708|58575942 hsa-miR-5696 0 1 0
chr10:71816877|71817017 hsa-miR-5696 0 1 0
chr19:6750535|6750633 hsa-miR-5696 0 1 0
chr5:71566494|71566701 hsa-miR-5696 0 1 0
chr9:129893125|129893221 hsa-miR-5696 0 1 0
chr14:37578720|37578826 hsa-miR-5696 0 1 0
chr1:161122180|161122383 hsa-miR-5696 0 1 0
chr18:62576815|62576917 hsa-miR-5696 0 1 0
chrX:48578950|48579077 hsa-miR-5696 0 1 0
chr13:98401017|98401146 hsa-miR-5696 0 1 0
chr6:109367602|109367858 hsa-miR-5696 0 1 0
chr6:7585805|7585891 hsa-miR-5696 0 1 0
chr10:13444125|13444438 hsa-miR-5696 0 1 0
chrX:48578950|48579075 hsa-miR-5696 0 1 0
chr8:94986792|94986941 hsa-miR-5696 0 1 0
chr15:84622119|84622320 hsa-miR-5696 0 1 0
chrX:111727559|111727658 hsa-miR-5696 0 1 0
chr15:40393725|40393814 hsa-miR-5696 0 1 0
chr9:135810390|135810592 hsa-miR-5696 0 1 0
chr22:31205182|31205411 hsa-miR-5696 0 1 0
chr19:40807836|40807942 hsa-miR-5696 0 1 0
chr20:62841316|62841445 hsa-miR-5696 0 1 0
chrX:48578917|48579081 hsa-miR-5696 0 1 0
chr1:58575742|58575846 hsa-miR-5696 0 1 0
chr2:58252181|58252381 hsa-miR-5696 0 1 0
chrX:72464850|72464971 hsa-miR-5696 0 1 0
chr12:56113095|56113234 hsa-miR-5696 0 1 0
chr13:98401031|98401146 hsa-miR-5696 0 1 0
chr2:88172566~88172757 hsa-miR-5696 0 1 0
chr17:39633909~39634083 hsa-miR-5696 0 1 0
chr8:41510350~41510509 hsa-miR-5696 0 1 0
chr18:63329052~63329204 hsa-miR-5696 0 1 0
chr19:15056722~15056874 hsa-miR-5696 0 1 0
chr9:133362877~133363165 hsa-miR-5696 0 1 0
chr19:15056722~15056983 hsa-miR-5696 0 1 0
chr1:99921700~99921932 hsa-miR-5696 0 1 0
chr15:84622121~84622320 hsa-miR-5696 0 1 0
chr7:47275773~47275987 hsa-miR-5696 0 1 0
chr10:71816773~71817063 hsa-miR-5696 0 1 0
chr15:59015650|59015813 hsa-miR-5696 1 0 0
chr1:12202910|12203036 hsa-miR-5696 0 1 0
chr9:98206828|98207049 hsa-miR-5696 0 1 0
chr8:66922329|66922515 hsa-miR-5696 0 1 0
chr12:69578113|69578380 hsa-miR-5696 0 1 0
chr11:65505279|65505530 hsa-miR-5696 0 1 0
chrX:1307704|1307784 hsa-miR-5696 0 1 0
chr2:16550573|16550670 hsa-miR-5696 0 1 0
chr14:23475340|23475468 hsa-miR-5696 0 1 0
chr14:100832560|100832776 hsa-miR-5696 0 1 0
chr9:134909828|134912555 hsa-miR-5696 0 1 0
chr2:128291478|128291634 hsa-miR-5696 0 1 0
chr3:185359752|185359913 hsa-miR-5696 0 1 0
chr17:10090271|10090394 hsa-miR-5696 0 1 0
chr10:75678413|75678562 hsa-miR-5696 0 1 0
chr3:32883641|32883797 hsa-miR-5696 0 1 0
chr3:15433356|15433498 hsa-miR-5696 0 1 0
chr1:99921700|99921932 hsa-miR-5696 0 1 0
chr11:124636911|124637037 hsa-miR-5696 0 1 0
chr7:47275874|47276061 hsa-miR-5696 0 1 0
chr7:143307214|143307335 hsa-miR-5696 0 1 0
chrX:48578950|48579083 hsa-miR-5696 0 1 0
chr12:95021962|95022173 hsa-miR-5696 0 1 0
chr10:71816832|71816972 hsa-miR-5696 0 1 0
chr2:172558708|172565073 hsa-miR-5696 0 1 0
chr10:13127745|13136897 hsa-miR-5696 0 1 0
chr5:132892164|132893118 hsa-miR-5696 0 1 0
chr1:234606019|234606198 hsa-miR-5696 0 1 0
chr10:71816730|71817017 hsa-miR-5696 0 1 0
chr1:87168701|87168882 hsa-miR-5696 0 1 0
chr17:57120786|57120947 hsa-miR-5696 0 1 0
chr3:46374526|46374689 hsa-miR-5696 0 1 0
chr14:32157136|32157257 hsa-miR-5696 0 1 0
chr8:26612690|26612828 hsa-miR-5696 0 1 0
chr22:31205195|31205418 hsa-miR-5696 0 1 0
chr1:109401938|109402086 hsa-miR-5696 0 1 0
chr5:32126368|32126538 hsa-miR-5696 0 1 0
chr19:6750539|6750633 hsa-miR-5696 0 1 0
chr9:100450832|100450976 hsa-miR-5696 0 1 0
chr7:47275874|47276038 hsa-miR-5696 0 1 0
chr11:6613402|6613588 hsa-miR-5696 0 1 0
chr1:35184560|35184670 hsa-miR-5696 0 1 0
chr13:77897177|77897286 hsa-miR-5696 0 1 0
chr2:24820911|24821079 hsa-miR-5696 -9 1 0
chr3:187075732|187075896 hsa-miR-5696 0 1 0
chr20:10630015|10630199 hsa-miR-5696 0 1 0
chr19:39951649|39951774 hsa-miR-5696 0 1 0
chr3:48765052|48765349 hsa-miR-5696 0 1 0
chr14:24192791|24192922 hsa-miR-5696 0 1 0
chr1:234605953|234606198 hsa-miR-5696 0 1 0
chr7:47275773|47275952 hsa-miR-5696 0 1 0
chr9:91410745|91410897 hsa-miR-5696 0 1 0
chrX:154487458|154487676 hsa-miR-5696 0 1 0
chr7:47275874|47276065 hsa-miR-5696 0 1 0
chrX:48578855|48579079 hsa-miR-5696 0 1 0
chr6:109367687|109367858 hsa-miR-5696 0 1 0
chrX:154487458|154487599 hsa-miR-5696 0 1 0
chr10:44377875|44378115 hsa-miR-5696 0 1 0
chr1:226875469|226875550 hsa-miR-5696 0 1 0
chrX:48578917|48579077 hsa-miR-5696 0 1 0
chr3:98533464|98533628 hsa-miR-5696 1 0 0
chr3:98533464|98533680 hsa-miR-5696 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5696 DEK DEK proto-oncogene HGNC:2768 details
hsa-miR-5696 BTD biotinidase HGNC:1122 details
hsa-miR-5696 LBR lamin B receptor HGNC:6518 details
hsa-miR-5696 ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-5696 details
hsa-miR-5696 details
hsa-miR-5696 details
hsa-miR-5696 SMIM10 small integral membrane protein 10 HGNC:41913 details
hsa-miR-5696 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 HGNC:9377 details
hsa-miR-5696 OLIG3 oligodendrocyte transcription factor 3 HGNC:18003 details
hsa-miR-5696 TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-5696 SPNS1 sphingolipid transporter 1 (putative) HGNC:30621 details
hsa-miR-5696 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-5696 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-5696 CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-5696 SMIM12 small integral membrane protein 12 HGNC:25154 details
hsa-miR-5696 RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-5696 XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-5696 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 HGNC:24048 details
hsa-miR-5696 IPO7 importin 7 HGNC:9852 details
hsa-miR-5696 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-5696 TLK1 tousled like kinase 1 HGNC:11841 details
hsa-miR-5696 RPL9 ribosomal protein L9 HGNC:10369 details
hsa-miR-5696 RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-5696 KCTD15 potassium channel tetramerization domain containing 15 HGNC:23297 details
hsa-miR-5696 details
hsa-miR-5696 AKAP8 A-kinase anchoring protein 8 HGNC:378 details
hsa-miR-5696 ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-5696 SYNM synemin HGNC:24466 details
hsa-miR-5696 MAGEL2 MAGE family member L2 HGNC:6814 details
hsa-miR-5696 SSC5D scavenger receptor cysteine rich family member with 5 domains HGNC:26641 details
hsa-miR-5696 OLAH oleoyl-ACP hydrolase HGNC:25625 details
hsa-miR-5696 SENP6 SUMO specific peptidase 6 HGNC:20944 details
hsa-miR-5696 CCDC25 coiled-coil domain containing 25 HGNC:25591 details
hsa-miR-5696 TMEM220 transmembrane protein 220 HGNC:33757 details
hsa-miR-5696 TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-5696 PPIL3 peptidylprolyl isomerase like 3 HGNC:9262 details
hsa-miR-5696 MPZL3 myelin protein zero like 3 HGNC:27279 details
hsa-miR-5696 ZNF331 zinc finger protein 331 HGNC:15489 details
hsa-miR-5696 PLEK pleckstrin HGNC:9070 details
hsa-miR-5696 TPR translocated promoter region, nuclear basket protein HGNC:12017 details
hsa-miR-5696 MTFR1L mitochondrial fission regulator 1 like HGNC:28836 details
hsa-miR-5696 ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-5696 RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-5696 DCTPP1 dCTP pyrophosphatase 1 HGNC:28777 details
hsa-miR-5696 RAG1 recombination activating 1 HGNC:9831 details
hsa-miR-5696 CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-5696 RSRC1 arginine and serine rich coiled-coil 1 HGNC:24152 details
hsa-miR-5696 MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-5696 TMEM241 transmembrane protein 241 HGNC:31723 details
hsa-miR-5696 ZFP37 ZFP37 zinc finger protein HGNC:12863 details
hsa-miR-5696 TMEM167A transmembrane protein 167A HGNC:28330 details
hsa-miR-5696 TM7SF3 transmembrane 7 superfamily member 3 HGNC:23049 details
hsa-miR-5696 SLC30A7 solute carrier family 30 member 7 HGNC:19306 details
hsa-miR-5696 RPS6KA3 ribosomal protein S6 kinase A3 HGNC:10432 details
hsa-miR-5696 PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-5696 MED17 mediator complex subunit 17 HGNC:2375 details
hsa-miR-5696 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-5696 CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-5696 BRAP BRCA1 associated protein HGNC:1099 details
hsa-miR-5696 GLO1 glyoxalase I HGNC:4323 details
hsa-miR-5696 details
hsa-miR-5696 RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-5696 MSL2 MSL complex subunit 2 HGNC:25544 details
hsa-miR-5696 MAP3K21 mitogen-activated protein kinase kinase kinase 21 HGNC:29798 details
hsa-miR-5696 HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-5696 FANCF FA complementation group F HGNC:3587 details
hsa-miR-5696 DDAH1 dimethylarginine dimethylaminohydrolase 1 HGNC:2715 details
hsa-miR-5696 ALG10B ALG10 alpha-1,2-glucosyltransferase B HGNC:31088 details
hsa-miR-5696 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 HGNC:9385 details
hsa-miR-5696 AZI2 5-azacytidine induced 2 HGNC:24002 details
hsa-miR-5696 EID1 EP300 interacting inhibitor of differentiation 1 HGNC:1191 details
hsa-miR-5696 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 HGNC:19835 details
hsa-miR-5696 MAP3K7 mitogen-activated protein kinase kinase kinase 7 HGNC:6859 details
hsa-miR-5696 PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-5696 EPHB1 EPH receptor B1 HGNC:3392 details
hsa-miR-5696 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 HGNC:24035 details
hsa-miR-5696 MDC1 mediator of DNA damage checkpoint 1 HGNC:21163 details
hsa-miR-5696 NLK nemo like kinase HGNC:29858 details
hsa-miR-5696 CHD4 chromodomain helicase DNA binding protein 4 HGNC:1919 details
hsa-miR-5696 ALKBH4 alkB homolog 4, lysine demethylase HGNC:21900 details
hsa-miR-5696 ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-5696 LIMS3 LIM zinc finger domain containing 3 HGNC:30047 details
hsa-miR-5696 LIMS4 LIM zinc finger domain containing 4 HGNC:39941 details
hsa-miR-5696 details
hsa-miR-5696 CDK13 cyclin dependent kinase 13 HGNC:1733 details
hsa-miR-5696 ARFGEF2 ADP ribosylation factor guanine nucleotide exchange factor 2 HGNC:15853 details
hsa-miR-5696 PROK2 prokineticin 2 HGNC:18455 details
hsa-miR-5696 ZBTB33 zinc finger and BTB domain containing 33 HGNC:16682 details
hsa-miR-5696 RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-5696 MAP3K2 mitogen-activated protein kinase kinase kinase 2 HGNC:6854 details
hsa-miR-5696 FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-5696 details
hsa-miR-5696 FAAP24 FA core complex associated protein 24 HGNC:28467 details
hsa-miR-5696 PCLAF PCNA clamp associated factor HGNC:28961 details
hsa-miR-5696 TRAPPC13 trafficking protein particle complex subunit 13 HGNC:25828 details
hsa-miR-5696 HLA-DRB1 major histocompatibility complex, class II, DR beta 1 HGNC:4948 details
hsa-miR-5696 details
hsa-miR-5696 AKIP1 A-kinase interacting protein 1 HGNC:1170 details
hsa-miR-5696 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 HGNC:224 details
hsa-miR-5696 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 HGNC:5217 details
hsa-miR-5696 TNFSF8 TNF superfamily member 8 HGNC:11938 details
hsa-miR-5696 ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-5696 TMEM236 transmembrane protein 236 HGNC:23473 details
hsa-miR-5696 TIGD2 tigger transposable element derived 2 HGNC:18333 details
hsa-miR-5696 TGFBRAP1 transforming growth factor beta receptor associated protein 1 HGNC:16836 details
hsa-miR-5696 SLC41A1 solute carrier family 41 member 1 HGNC:19429 details
hsa-miR-5696 RBBP4 RB binding protein 4, chromatin remodeling factor HGNC:9887 details
hsa-miR-5696 PSPH phosphoserine phosphatase HGNC:9577 details
hsa-miR-5696 PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-5696 PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-5696 LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-5696 GPR26 G protein-coupled receptor 26 HGNC:4481 details
hsa-miR-5696 CDKN2AIP CDKN2A interacting protein HGNC:24325 details
hsa-miR-5696 APP amyloid beta precursor protein HGNC:620 details
hsa-miR-5696 TBCA tubulin folding cofactor A HGNC:11579 details
hsa-miR-5696 CD44 CD44 molecule (Indian blood group) HGNC:1681 details
hsa-miR-5696 ZNF514 zinc finger protein 514 HGNC:25894 details
hsa-miR-5696 ZNF362 zinc finger protein 362 HGNC:18079 details
hsa-miR-5696 SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-5696 NAV2 neuron navigator 2 HGNC:15997 details
hsa-miR-5696 DPH3 diphthamide biosynthesis 3 HGNC:27717 details
hsa-miR-5696 DCP2 decapping mRNA 2 HGNC:24452 details
hsa-miR-5696 CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-5696 ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-5696 GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-5696 MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-5696 MRPS30 mitochondrial ribosomal protein S30 HGNC:8769 details
hsa-miR-5696 TSPAN6 tetraspanin 6 HGNC:11858 details
hsa-miR-5696 TADA2A transcriptional adaptor 2A HGNC:11531 details
hsa-miR-5696 RBM41 RNA binding motif protein 41 HGNC:25617 details
hsa-miR-5696 SMIM14 small integral membrane protein 14 HGNC:27321 details
hsa-miR-5696 details
hsa-miR-5696 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta HGNC:12853 details
hsa-miR-5696 ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-5696 VPS53 VPS53 subunit of GARP complex HGNC:25608 details
hsa-miR-5696 TENM1 teneurin transmembrane protein 1 HGNC:8117 details
hsa-miR-5696 UFL1 UFM1 specific ligase 1 HGNC:23039 details
hsa-miR-5696 TXNDC17 thioredoxin domain containing 17 HGNC:28218 details
hsa-miR-5696 TMEM72 transmembrane protein 72 HGNC:31658 details
hsa-miR-5696 FCMR Fc fragment of IgM receptor HGNC:14315 details
hsa-miR-5696 SEC24A SEC24 homolog A, COPII coat complex component HGNC:10703 details
hsa-miR-5696 SLC5A12 solute carrier family 5 member 12 HGNC:28750 details
hsa-miR-5696 NCAPG non-SMC condensin I complex subunit G HGNC:24304 details
hsa-miR-5696 FUT9 fucosyltransferase 9 HGNC:4020 details
hsa-miR-5696 EN2 engrailed homeobox 2 HGNC:3343 details
hsa-miR-5696 EIF1AD eukaryotic translation initiation factor 1A domain containing HGNC:28147 details
hsa-miR-5696 RNASEL ribonuclease L HGNC:10050 details
hsa-miR-5696 CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-5696 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma HGNC:3267 details
hsa-miR-5696 YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-5696 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-5696 ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-5696 BASP1 brain abundant membrane attached signal protein 1 HGNC:957 details
hsa-miR-5696 CYFIP2 cytoplasmic FMR1 interacting protein 2 HGNC:13760 details
hsa-miR-5696 DMXL1 Dmx like 1 HGNC:2937 details
hsa-miR-5696 FZD2 frizzled class receptor 2 HGNC:4040 details
hsa-miR-5696 GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-5696 KCNK2 potassium two pore domain channel subfamily K member 2 HGNC:6277 details
hsa-miR-5696 REEP5 receptor accessory protein 5 HGNC:30077 details
hsa-miR-5696 SEMA3E semaphorin 3E HGNC:10727 details
hsa-miR-5696 TMEM233 transmembrane protein 233 HGNC:37219 details
hsa-miR-5696 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 HGNC:12587 details
hsa-miR-5696 MAML3 mastermind like transcriptional coactivator 3 HGNC:16272 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab