miRNA Card

miRNA General Information
miRNA ID hsa-miR-5697
Description Homo sapiens miR-5697 stem-loop
Comment None
Experiment Illumina [1]
Sequence UCAAGUAGUUUCAUGAUAAAGG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:208344921|208345018 hsa-miR-5697 0 1 0
chr7:127707627|127721400 hsa-miR-5697 0 1 0
chr15:98963921|98964053 hsa-miR-5697 0 1 0
chr12:79596564|79613587 hsa-miR-5697 0 1 0
chr11:67049868|67049983 hsa-miR-5697 0 1 0
chr3:115026419|115026577 hsa-miR-5697 0 1 0
chr2:28337811|28337933 hsa-miR-5697 0 1 0
chr14:94619218|94622392 hsa-miR-5697 0 1 0
chr1:207794719|207794868 hsa-miR-5697 0 1 0
chr17:80386261|80386377 hsa-miR-5697 0 1 0
chr3:129277445|129277600 hsa-miR-5697 0 1 0
chr7:55208913|55209082 hsa-miR-5697 0 1 0
chr1:227733017|227733249 hsa-miR-5697 0 1 0
chr22:29769705|29769813 hsa-miR-5697 0 1 0
chr2:197470081|197470158 hsa-miR-5697 0 1 0
chr8:103375769|103375959 hsa-miR-5697 0 1 0
chr1:235181748|235181898 hsa-miR-5697 0 1 0
chr19:49490253|49490535 hsa-miR-5697 0 1 0
chr15:98963923|98964056 hsa-miR-5697 0 1 0
chr14:94619218|94619373 hsa-miR-5697 0 1 0
chrX:65740793|65741120 hsa-miR-5697 0 1 0
chr17:73207433|73207599 hsa-miR-5697 0 1 0
chr2:24768079|24768302 hsa-miR-5697 0 1 0
chr15:99130719|99130824 hsa-miR-5697 0 1 0
chr17:49289669|49289753 hsa-miR-5697 0 1 0
chr8:103375832|103378048 hsa-miR-5697 0 1 0
chr7:119165378|119165493 hsa-miR-5697 0 1 0
chr14:94619218|94619325 hsa-miR-5697 0 1 0
chr20:44727621|44727718 hsa-miR-5697 0 1 0
chr8:100303284|100303461 hsa-miR-5697 0 1 0
chr1:235181748|235181909 hsa-miR-5697 0 1 0
chr7:45724781~45724921 hsa-miR-5697 0 1 0
chr12:79596564~79613587 hsa-miR-5697 0 1 0
chr6:149378578~149378705 hsa-miR-5697 0 1 0
chr19:49490253~49490535 hsa-miR-5697 0 1 0
chr20:13299357~13299474 hsa-miR-5697 0 1 0
chr14:94619218~94619373 hsa-miR-5697 0 1 0
chr11:67049868~67049983 hsa-miR-5697 0 1 0
chr11:67049871~67049983 hsa-miR-5697 0 1 0
chr2:170361656~170361777 hsa-miR-5697 0 1 0
chr19:2071208~2071309 hsa-miR-5697 0 1 0
chr1:207794719~207794868 hsa-miR-5697 0 1 0
chr2:170361656~170361765 hsa-miR-5697 0 1 0
chr7:127707627~127721400 hsa-miR-5697 0 1 0
chr1:28987651~28987771 hsa-miR-5697 0 1 0
chr7:30598796~30598897 hsa-miR-5697 0 1 0
chr19:2071096~2071343 hsa-miR-5697 0 1 0
chr15:48878638~48878797 hsa-miR-5697 0 1 0
chr1:203486768~203486839 hsa-miR-5697 0 1 0
chr22:36369286|36369477 hsa-miR-5697 0 1 0
chr5:119180017|119180237 hsa-miR-5697 0 1 0
chr1:153858829|153859043 hsa-miR-5697 0 1 0
chrX:65740850|65741044 hsa-miR-5697 0 1 0
chr14:52717800|52718017 hsa-miR-5697 0 1 0
chr10:75522350|75522430 hsa-miR-5697 0 1 0
chr6:47527568|47527787 hsa-miR-5697 0 1 0
chr12:121330925|121331093 hsa-miR-5697 0 1 0
chr12:14640332|14640455 hsa-miR-5697 0 1 0
chr15:44487359|44487516 hsa-miR-5697 0 1 0
chr1:76115246|76115361 hsa-miR-5697 0 1 0
chr5:137752690|137752785 hsa-miR-5697 0 1 0
chr15:72573894|72574034 hsa-miR-5697 0 1 0
chr17:59680434|59680540 hsa-miR-5697 0 1 0
chr11:67049808|67049983 hsa-miR-5697 0 1 0
chr1:1373774|1374110 hsa-miR-5697 0 1 0
chr1:46633643|46633755 hsa-miR-5697 0 1 0
chrX:153798086|153798483 hsa-miR-5697 0 1 0
chr14:94619218|94619346 hsa-miR-5697 0 1 0
chr6:10722946|10723124 hsa-miR-5697 0 1 0
chrX:153798092|153798483 hsa-miR-5697 0 1 0
chrX:23783658|23783883 hsa-miR-5697 0 1 0
chr3:133588982|133589126 hsa-miR-5697 0 1 0
chr1:46633541|46633755 hsa-miR-5697 0 1 0
chr17:1519360|1519634 hsa-miR-5697 0 1 0
chr7:65844794|65845087 hsa-miR-5697 0 1 0
chr17:76390812|76391018 hsa-miR-5697 0 1 0
chr3:129277352|129277600 hsa-miR-5697 0 1 0
chr19:19640139|19640501 hsa-miR-5697 0 1 0
chr19:10805510|10805691 hsa-miR-5697 0 1 0
chr2:227006898|227007038 hsa-miR-5697 0 1 0
chrX:23783686|23783883 hsa-miR-5697 0 1 0
chr1:1373885|1374048 hsa-miR-5697 0 1 0
chr3:191394667|191394863 hsa-miR-5697 0 1 0
chr16:70250828|70250925 hsa-miR-5697 0 1 0
chr16:67480992|67481150 hsa-miR-5697 0 1 0
chr11:116760434|116760578 hsa-miR-5697 0 1 0
chr1:39528380|39528547 hsa-miR-5697 0 1 0
chr6:116627707|116627865 hsa-miR-5697 0 1 0
chr20:1377701|1377855 hsa-miR-5697 0 1 0
chr19:17724768|17724857 hsa-miR-5697 0 1 0
chr1:1373816|1374194 hsa-miR-5697 0 1 0
chr19:10681458|10681599 hsa-miR-5697 0 1 0
chr12:48826443|48826806 hsa-miR-5697 0 1 0
chr3:33497506|33497675 hsa-miR-5697 0 1 0
chr1:11286133|11286237 hsa-miR-5697 0 1 0
chrX:153798086|153798449 hsa-miR-5697 0 1 0
chr20:57648690|57648804 hsa-miR-5697 0 1 0
chr10:29421366|29421578 hsa-miR-5697 0 1 0
chr11:67049841|67049977 hsa-miR-5697 0 1 0
chr17:7852153|7852270 hsa-miR-5697 0 1 0
chr8:43025128|43025320 hsa-miR-5697 -9 1 0
chr2:46364918|46365084 hsa-miR-5697 -7 1 0
chr21:44525190|44525316 hsa-miR-5697 1 0 0
chr12:48826450|48826806 hsa-miR-5697 0 1 0
chr1:1373885|1374077 hsa-miR-5697 0 1 0
chr1:28742440|28742610 hsa-miR-5697 0 1 0
chr15:63062246|63062645 hsa-miR-5697 0 1 0
chr7:151134726|151134972 hsa-miR-5697 0 1 0
chr3:133588946|133589126 hsa-miR-5697 0 1 0
chr17:76390812|76390951 hsa-miR-5697 0 1 0
chr11:62880412|62880553 hsa-miR-5697 0 1 0
chr6:33693571|33693718 hsa-miR-5697 0 1 0
chr1:28742440|28742563 hsa-miR-5697 0 1 0
chr1:235181748|235181993 hsa-miR-5697 0 1 0
chr17:50381708|50381885 hsa-miR-5697 0 1 0
chr16:23399368|23399523 hsa-miR-5697 0 1 0
chr15:99130719|99130845 hsa-miR-5697 0 1 0
chr12:19253624|19253792 hsa-miR-5697 0 1 0
chr10:70883897|70884048 hsa-miR-5697 0 1 0
chr17:57106239|57106361 hsa-miR-5697 0 1 0
chr19:32711752|32711915 hsa-miR-5697 0 1 0
chr17:58356435|58356580 hsa-miR-5697 0 1 0
chr10:70883897|70884005 hsa-miR-5697 0 1 0
chr22:26670941|26671212 hsa-miR-5697 0 1 0
chr4:139665952|139666068 hsa-miR-5697 0 1 0
chr19:7863526|7863690 hsa-miR-5697 0 1 0
chr7:96045709|96045816 hsa-miR-5697 0 1 0
chr5:134750757|134750934 hsa-miR-5697 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-5697 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like HGNC:22423 details
hsa-miR-5697 AVPR1A arginine vasopressin receptor 1A HGNC:895 details
hsa-miR-5697 ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-5697 details
hsa-miR-5697 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-5697 LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-5697 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI HGNC:30862 details
hsa-miR-5697 ZBTB45 zinc finger and BTB domain containing 45 HGNC:23715 details
hsa-miR-5697 CES2 carboxylesterase 2 HGNC:1864 details
hsa-miR-5697 CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-5697 SLC26A2 solute carrier family 26 member 2 HGNC:10994 details
hsa-miR-5697 ZNF426 zinc finger protein 426 HGNC:20725 details
hsa-miR-5697 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-5697 TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-5697 SACS sacsin molecular chaperone HGNC:10519 details
hsa-miR-5697 PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-5697 KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-5697 GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-5697 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 HGNC:16787 details
hsa-miR-5697 CTNS cystinosin, lysosomal cystine transporter HGNC:2518 details
hsa-miR-5697 CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-5697 CKS2 CDC28 protein kinase regulatory subunit 2 HGNC:2000 details
hsa-miR-5697 CARD10 caspase recruitment domain family member 10 HGNC:16422 details
hsa-miR-5697 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 HGNC:20984 details
hsa-miR-5697 ADM adrenomedullin HGNC:259 details
hsa-miR-5697 LOXL2 lysyl oxidase like 2 HGNC:6666 details
hsa-miR-5697 TET3 tet methylcytosine dioxygenase 3 HGNC:28313 details
hsa-miR-5697 RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-5697 MTDH metadherin HGNC:29608 details
hsa-miR-5697 MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-5697 FRAT2 FRAT regulator of WNT signaling pathway 2 HGNC:16048 details
hsa-miR-5697 CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-5697 CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-5697 ADAM17 ADAM metallopeptidase domain 17 HGNC:195 details
hsa-miR-5697 ATG12 autophagy related 12 HGNC:588 details
hsa-miR-5697 details
hsa-miR-5697 ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-5697 TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-5697 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-5697 FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-5697 E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-5697 DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-5697 NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-5697 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 HGNC:5229 details
hsa-miR-5697 RPL4 ribosomal protein L4 HGNC:10353 details
hsa-miR-5697 TCF23 transcription factor 23 HGNC:18602 details
hsa-miR-5697 CCND2 cyclin D2 HGNC:1583 details
hsa-miR-5697 B3GALT5 beta-1,3-galactosyltransferase 5 HGNC:920 details
hsa-miR-5697 WDR97 WD repeat domain 97 HGNC:26959 details
hsa-miR-5697 HAUS3 HAUS augmin like complex subunit 3 HGNC:28719 details
hsa-miR-5697 ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-5697 TOB1 transducer of ERBB2, 1 HGNC:11979 details
hsa-miR-5697 SLC9A7 solute carrier family 9 member A7 HGNC:17123 details
hsa-miR-5697 SLC5A3 solute carrier family 5 member 3 HGNC:11038 details
hsa-miR-5697 MAP1B microtubule associated protein 1B HGNC:6836 details
hsa-miR-5697 KIAA0408 KIAA0408 HGNC:21636 details
hsa-miR-5697 SOGA3 SOGA family member 3 HGNC:21494 details
hsa-miR-5697 SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-5697 VANGL2 VANGL planar cell polarity protein 2 HGNC:15511 details
hsa-miR-5697 ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-5697 SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-5697 RHOQ ras homolog family member Q HGNC:17736 details
hsa-miR-5697 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-5697 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 HGNC:28680 details
hsa-miR-5697 details
hsa-miR-5697 EPB41L3 erythrocyte membrane protein band 4.1 like 3 HGNC:3380 details
hsa-miR-5697 RPL9 ribosomal protein L9 HGNC:10369 details
hsa-miR-5697 ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-5697 UBR3 ubiquitin protein ligase E3 component n-recognin 3 HGNC:30467 details
hsa-miR-5697 TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-5697 SFPQ splicing factor proline and glutamine rich HGNC:10774 details
hsa-miR-5697 SESN2 sestrin 2 HGNC:20746 details
hsa-miR-5697 PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-5697 MAN2A1 mannosidase alpha class 2A member 1 HGNC:6824 details
hsa-miR-5697 GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-5697 EPC2 enhancer of polycomb homolog 2 HGNC:24543 details
hsa-miR-5697 CYP26B1 cytochrome P450 family 26 subfamily B member 1 HGNC:20581 details
hsa-miR-5697 HRH2 histamine receptor H2 HGNC:5183 details
hsa-miR-5697 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-5697 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 HGNC:814 details
hsa-miR-5697 ZDHHC18 zinc finger DHHC-type palmitoyltransferase 18 HGNC:20712 details
hsa-miR-5697 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 HGNC:18984 details
hsa-miR-5697 TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-5697 NSA2 NSA2 ribosome biogenesis factor HGNC:30728 details
hsa-miR-5697 SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-5697 CCNT1 cyclin T1 HGNC:1599 details
hsa-miR-5697 WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-5697 details
hsa-miR-5697 STRADB STE20 related adaptor beta HGNC:13205 details
hsa-miR-5697 BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-5697 RPL37 ribosomal protein L37 HGNC:10347 details
hsa-miR-5697 HAUS8 HAUS augmin like complex subunit 8 HGNC:30532 details
hsa-miR-5697 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-5697 FAXC failed axon connections homolog, metaxin like GST domain containing HGNC:20742 details
hsa-miR-5697 PGBD4 piggyBac transposable element derived 4 HGNC:19401 details
hsa-miR-5697 CAMK1D calcium/calmodulin dependent protein kinase ID HGNC:19341 details
hsa-miR-5697 GLTP glycolipid transfer protein HGNC:24867 details
hsa-miR-5697 SIGLEC9 sialic acid binding Ig like lectin 9 HGNC:10878 details
hsa-miR-5697 ANGEL1 angel homolog 1 HGNC:19961 details
hsa-miR-5697 LATS1 large tumor suppressor kinase 1 HGNC:6514 details
hsa-miR-5697 NKX2-1 NK2 homeobox 1 HGNC:11825 details
hsa-miR-5697 details
hsa-miR-5697 CYB5A cytochrome b5 type A HGNC:2570 details
hsa-miR-5697 TUBGCP5 tubulin gamma complex associated protein 5 HGNC:18600 details
hsa-miR-5697 SLC35B3 solute carrier family 35 member B3 HGNC:21601 details
hsa-miR-5697 PTAFR platelet activating factor receptor HGNC:9582 details
hsa-miR-5697 INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-5697 DSTYK dual serine/threonine and tyrosine protein kinase HGNC:29043 details
hsa-miR-5697 RBM48 RNA binding motif protein 48 HGNC:21785 details
hsa-miR-5697 C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-5697 RGS17 regulator of G protein signaling 17 HGNC:14088 details
hsa-miR-5697 HPSE heparanase HGNC:5164 details
hsa-miR-5697 details
hsa-miR-5697 GTF2H2C GTF2H2 family member C HGNC:31394 details
hsa-miR-5697 LRRC27 leucine rich repeat containing 27 HGNC:29346 details
hsa-miR-5697 ICA1L islet cell autoantigen 1 like HGNC:14442 details
hsa-miR-5697 GTF2H2 general transcription factor IIH subunit 2 HGNC:4656 details
hsa-miR-5697 SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-5697 SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-5697 PLPP3 phospholipid phosphatase 3 HGNC:9229 details
hsa-miR-5697 PDE4C phosphodiesterase 4C HGNC:8782 details
hsa-miR-5697 ARHGEF39 Rho guanine nucleotide exchange factor 39 HGNC:25909 details
hsa-miR-5697 PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-5697 PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-5697 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 HGNC:17877 details
hsa-miR-5697 THAP1 THAP domain containing 1 HGNC:20856 details
hsa-miR-5697 ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-5697 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-5697 ISG20L2 interferon stimulated exonuclease gene 20 like 2 HGNC:25745 details
hsa-miR-5697 GPN2 GPN-loop GTPase 2 HGNC:25513 details
hsa-miR-5697 UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-5697 details
hsa-miR-5697 MTMR12 myotubularin related protein 12 HGNC:18191 details
hsa-miR-5697 FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-5697 ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-5697 DIP2A disco interacting protein 2 homolog A HGNC:17217 details
hsa-miR-5697 EXO5 exonuclease 5 HGNC:26115 details
hsa-miR-5697 CCDC152 coiled-coil domain containing 152 HGNC:34438 details
hsa-miR-5697 XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-5697 WWC1 WW and C2 domain containing 1 HGNC:29435 details
hsa-miR-5697 ADGRG7 adhesion G protein-coupled receptor G7 HGNC:19241 details
hsa-miR-5697 C22orf39 chromosome 22 open reading frame 39 HGNC:27012 details
hsa-miR-5697 FBRS fibrosin HGNC:20442 details
hsa-miR-5697 HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-5697 KCTD20 potassium channel tetramerization domain containing 20 HGNC:21052 details
hsa-miR-5697 NCEH1 neutral cholesterol ester hydrolase 1 HGNC:29260 details
hsa-miR-5697 NEMP2 nuclear envelope integral membrane protein 2 HGNC:33700 details
hsa-miR-5697 NIP7 nucleolar pre-rRNA processing protein NIP7 HGNC:24328 details
hsa-miR-5697 NOS1AP nitric oxide synthase 1 adaptor protein HGNC:16859 details
hsa-miR-5697 C11orf98 chromosome 11 open reading frame 98 HGNC:51238 details
hsa-miR-5697 C3 complement C3 HGNC:1318 details
hsa-miR-5697 CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-5697 ECHDC3 enoyl-CoA hydratase domain containing 3 HGNC:23489 details
hsa-miR-5697 GJC1 gap junction protein gamma 1 HGNC:4280 details
hsa-miR-5697 GMEB1 glucocorticoid modulatory element binding protein 1 HGNC:4370 details
hsa-miR-5697 KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-5697 MARVELD3 MARVEL domain containing 3 HGNC:30525 details
hsa-miR-5697 METTL2B methyltransferase 2B, methylcytidine HGNC:18272 details
hsa-miR-5697 MSRB2 methionine sulfoxide reductase B2 HGNC:17061 details
hsa-miR-5697 PROSER2 proline and serine rich 2 HGNC:23728 details
hsa-miR-5697 RABL3 RAB, member of RAS oncogene family like 3 HGNC:18072 details
hsa-miR-5697 SLC43A2 solute carrier family 43 member 2 HGNC:23087 details
hsa-miR-5697 SPIB Spi-B transcription factor HGNC:11242 details
hsa-miR-5697 THAP6 THAP domain containing 6 HGNC:23189 details
hsa-miR-5697 TLR10 toll like receptor 10 HGNC:15634 details
hsa-miR-5697 TNFAIP8L1 TNF alpha induced protein 8 like 1 HGNC:28279 details
hsa-miR-5697 TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-5697 TPMT thiopurine S-methyltransferase HGNC:12014 details
hsa-miR-5697 TXNL4A thioredoxin like 4A HGNC:30551 details
hsa-miR-5697 ZNF669 zinc finger protein 669 HGNC:25736 details
hsa-miR-5697 TNFSF10 TNF superfamily member 10 HGNC:11925 details
hsa-miR-5697 PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-5697 SEC14L6 SEC14 like lipid binding 6 HGNC:40047 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab