miRNA Card

miRNA General Information
miRNA ID hsa-miR-6504-3p
Description Homo sapiens miR-6504 stem-loop
Comment None
Experiment Illumina [1]
Sequence CAUUACAGCACAGCCAUUCU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr4:101080532|101109078 hsa-miR-6504-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:139357843|139357951 hsa-miR-6504-3p 0 1 0
chrX:24078169|24078356 hsa-miR-6504-3p 0 1 0
chr6:31534005|31534171 hsa-miR-6504-3p 0 1 0
chr7:66156810|66157049 hsa-miR-6504-3p 0 1 0
chrX:40627165|40627426 hsa-miR-6504-3p 0 1 0
chr1:109094433|109094564 hsa-miR-6504-3p 0 1 0
chr10:5908994|5909276 hsa-miR-6504-3p 0 1 0
chr21:15762891|15766141 hsa-miR-6504-3p 1 0 0
chr9:122890326|122890462 hsa-miR-6504-3p 0 1 0
chr5:10279636|10279901 hsa-miR-6504-3p 0 1 0
chr17:75242336|75242455 hsa-miR-6504-3p 0 1 0
chr5:102974295|102974436 hsa-miR-6504-3p 0 1 0
chr6:30650037|30650292 hsa-miR-6504-3p 0 1 0
chr1:161120117|161120232 hsa-miR-6504-3p 0 1 0
chr4:996056|996314 hsa-miR-6504-3p 0 1 0
chr3:129190067|129190218 hsa-miR-6504-3p 0 1 0
chr19:39388947|39389160 hsa-miR-6504-3p 0 1 0
chr9:14617821|14617906 hsa-miR-6504-3p 0 1 0
chr2:144164135|144164280 hsa-miR-6504-3p 0 1 0
chr11:1011767|1011980 hsa-miR-6504-3p 0 1 0
chr5:10279636~10279901 hsa-miR-6504-3p 0 1 0
chr3:57562752~57562954 hsa-miR-6504-3p 0 1 0
chr15:40857557~40857704 hsa-miR-6504-3p 0 1 0
chr19:52226020~52226311 hsa-miR-6504-3p 0 1 0
chr18:57664362~57664538 hsa-miR-6504-3p 0 1 0
chr9:133342799~133342994 hsa-miR-6504-3p 0 1 0
chr16:23455552~23455634 hsa-miR-6504-3p 0 1 0
chr22:29698128~29698333 hsa-miR-6504-3p 0 1 0
chr22:29698218~29698393 hsa-miR-6504-3p 0 1 0
chr19:39388965~39389179 hsa-miR-6504-3p 0 1 0
chr12:55821603~55821743 hsa-miR-6504-3p 0 1 0
chr5:150053414~150053561 hsa-miR-6504-3p 0 1 0
chr6:42012329|42012523 hsa-miR-6504-3p 0 1 0
chr1:31055146|31055303 hsa-miR-6504-3p 0 1 0
chr4:73234981|73235235 hsa-miR-6504-3p 0 1 0
chr6:31463966|31464085 hsa-miR-6504-3p 0 1 0
chr5:160110066|160110225 hsa-miR-6504-3p 0 1 0
chr12:70246384|70246570 hsa-miR-6504-3p 0 1 0
chr1:213274264|213274387 hsa-miR-6504-3p 0 1 0
chr15:85075555|85075720 hsa-miR-6504-3p 0 1 0
chr1:153993736|153993892 hsa-miR-6504-3p 0 1 0
chr5:138411946|138412064 hsa-miR-6504-3p 0 1 0
chr10:74007493|74007667 hsa-miR-6504-3p 0 1 0
chr11:3758346|3758436 hsa-miR-6504-3p 0 1 0
chr19:831922|832012 hsa-miR-6504-3p 0 1 0
chr17:63673693|63673832 hsa-miR-6504-3p 0 1 0
chr12:109969992|109970134 hsa-miR-6504-3p 0 1 0
chr22:41898209|41898309 hsa-miR-6504-3p 0 1 0
chr1:52661814|52661979 hsa-miR-6504-3p 0 1 0
chr6:42931769|42931886 hsa-miR-6504-3p 0 1 0
chr3:52211218|52211376 hsa-miR-6504-3p 0 1 0
chr3:195866383|195866551 hsa-miR-6504-3p 0 1 0
chrX:12815879|12815961 hsa-miR-6504-3p 0 1 0
chr22:41137378|41137472 hsa-miR-6504-3p 0 1 0
chr1:161120107|161120232 hsa-miR-6504-3p 0 1 0
chr5:102974287|102974436 hsa-miR-6504-3p 0 1 0
chr9:100450943|100451054 hsa-miR-6504-3p 0 1 0
chr21:45513621|45513722 hsa-miR-6504-3p 0 1 0
chr7:23692485|23692648 hsa-miR-6504-3p 0 1 0
chr1:15397659|15397886 hsa-miR-6504-3p 0 1 0
chr11:1011841|1011980 hsa-miR-6504-3p 0 1 0
chr3:66003562|66003661 hsa-miR-6504-3p 0 1 0
chr5:102974253|102974436 hsa-miR-6504-3p 0 1 0
chr21:45513621|45513744 hsa-miR-6504-3p 0 1 0
chr9:35310465|35310729 hsa-miR-6504-3p 0 1 0
chr14:90405478|90405659 hsa-miR-6504-3p 0 1 0
chr5:102974318|102974436 hsa-miR-6504-3p 0 1 0
chr14:49862681|49862850 hsa-miR-6504-3p 0 1 0
chr15:40857464|40857655 hsa-miR-6504-3p 0 1 0
chr6:124971356|124971550 hsa-miR-6504-3p 0 1 0
chr12:6217064|6217237 hsa-miR-6504-3p 0 1 0
chr12:111645977|111646185 hsa-miR-6504-3p 0 1 0
chr14:90405419|90405615 hsa-miR-6504-3p 0 1 0
chr3:53070862|53071084 hsa-miR-6504-3p 0 1 0
chr7:22854935|22855089 hsa-miR-6504-3p 0 1 0
chr5:102974320|102974436 hsa-miR-6504-3p 0 1 0
chr11:1011708|1012019 hsa-miR-6504-3p 0 1 0
chr3:119204703|119204832 hsa-miR-6504-3p 0 1 0
chr3:188987245|188987391 hsa-miR-6504-3p 0 1 0
chr14:105860577|105860757 hsa-miR-6504-3p 0 1 0
chr12:98734912|98734999 hsa-miR-6504-3p 0 1 0
chr19:52226020|52226311 hsa-miR-6504-3p 0 1 0
chr17:75242336|75242452 hsa-miR-6504-3p -4 1 0
chr11:47751143|47751249 hsa-miR-6504-3p 0 1 0
chr7:73832341|73832427 hsa-miR-6504-3p 1 0 0
chr17:1344818|1345000 hsa-miR-6504-3p 0 1 0
chr19:52226161|52226290 hsa-miR-6504-3p 0 1 0
chr14:60283087|60283271 hsa-miR-6504-3p 0 1 0
chr5:150053414|150053561 hsa-miR-6504-3p 0 1 0
chr1:1786837|1786956 hsa-miR-6504-3p 0 1 0
chr9:14617821|14617967 hsa-miR-6504-3p 0 1 0
chr8:143297451|143297548 hsa-miR-6504-3p 0 1 0
chr3:133600450|133600654 hsa-miR-6504-3p 0 1 0
chr20:36612091|36612159 hsa-miR-6504-3p 0 1 0
chr11:108147396|108147595 hsa-miR-6504-3p 0 1 0
chr1:161120168|161120530 hsa-miR-6504-3p 0 1 0
chr11:1011822|1011980 hsa-miR-6504-3p 0 1 0
chr2:202211892|202212049 hsa-miR-6504-3p 0 1 0
chr16:14264058|14264181 hsa-miR-6504-3p 0 1 0
chrX:139768260|139768362 hsa-miR-6504-3p 0 1 0
chr19:53875286|53875530 hsa-miR-6504-3p 0 1 0
chr15:90271409|90271597 hsa-miR-6504-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-6504-3p ANKRD17 ankyrin repeat domain 17 HGNC:23575 details
hsa-miR-6504-3p DCAF15 DDB1 and CUL4 associated factor 15 HGNC:25095 details
hsa-miR-6504-3p ZC3H11A zinc finger CCCH-type containing 11A HGNC:29093 details
hsa-miR-6504-3p VCL vinculin HGNC:12665 details
hsa-miR-6504-3p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-6504-3p USP53 ubiquitin specific peptidase 53 HGNC:29255 details
hsa-miR-6504-3p TNFAIP1 TNF alpha induced protein 1 HGNC:11894 details
hsa-miR-6504-3p SYNJ2BP synaptojanin 2 binding protein HGNC:18955 details
hsa-miR-6504-3p STYX serine/threonine/tyrosine interacting protein HGNC:11447 details
hsa-miR-6504-3p SREBF2 sterol regulatory element binding transcription factor 2 HGNC:11290 details
hsa-miR-6504-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-6504-3p RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-6504-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-6504-3p PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-6504-3p GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-6504-3p CD81 CD81 molecule HGNC:1701 details
hsa-miR-6504-3p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-6504-3p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-6504-3p BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-6504-3p ADORA2B adenosine A2b receptor HGNC:264 details
hsa-miR-6504-3p FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-6504-3p CEP162 centrosomal protein 162 HGNC:21107 details
hsa-miR-6504-3p COL23A1 collagen type XXIII alpha 1 chain HGNC:22990 details
hsa-miR-6504-3p TUBA1B tubulin alpha 1b HGNC:18809 details
hsa-miR-6504-3p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-6504-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-6504-3p CCNE2 cyclin E2 HGNC:1590 details
hsa-miR-6504-3p TLK2 tousled like kinase 2 HGNC:11842 details
hsa-miR-6504-3p PRPF4 pre-mRNA processing factor 4 HGNC:17349 details
hsa-miR-6504-3p MS4A4A membrane spanning 4-domains A4A HGNC:13371 details
hsa-miR-6504-3p FOS Fos proto-oncogene, AP-1 transcription factor subunit HGNC:3796 details
hsa-miR-6504-3p KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 HGNC:6285 details
hsa-miR-6504-3p CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 HGNC:25248 details
hsa-miR-6504-3p DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 HGNC:5229 details
hsa-miR-6504-3p SFTPB surfactant protein B HGNC:10801 details
hsa-miR-6504-3p ZNF730 zinc finger protein 730 HGNC:32470 details
hsa-miR-6504-3p GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 HGNC:4128 details
hsa-miR-6504-3p RBM4B RNA binding motif protein 4B HGNC:28842 details
hsa-miR-6504-3p MRNIP MRN complex interacting protein HGNC:30817 details
hsa-miR-6504-3p THOC5 THO complex 5 HGNC:19074 details
hsa-miR-6504-3p RAB3IP RAB3A interacting protein HGNC:16508 details
hsa-miR-6504-3p RPL23 ribosomal protein L23 HGNC:10316 details
hsa-miR-6504-3p SIGLEC11 sialic acid binding Ig like lectin 11 HGNC:15622 details
hsa-miR-6504-3p CEP78 centrosomal protein 78 HGNC:25740 details
hsa-miR-6504-3p AHI1 Abelson helper integration site 1 HGNC:21575 details
hsa-miR-6504-3p MRPL52 mitochondrial ribosomal protein L52 HGNC:16655 details
hsa-miR-6504-3p QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-6504-3p LRRC27 leucine rich repeat containing 27 HGNC:29346 details
hsa-miR-6504-3p details
hsa-miR-6504-3p NINJ1 ninjurin 1 HGNC:7824 details
hsa-miR-6504-3p COMTD1 catechol-O-methyltransferase domain containing 1 HGNC:26309 details
hsa-miR-6504-3p BCAS4 breast carcinoma amplified sequence 4 HGNC:14367 details
hsa-miR-6504-3p FAM89A family with sequence similarity 89 member A HGNC:25057 details
hsa-miR-6504-3p DARS2 aspartyl-tRNA synthetase 2, mitochondrial HGNC:25538 details
hsa-miR-6504-3p details
hsa-miR-6504-3p ZNF44 zinc finger protein 44 HGNC:13110 details
hsa-miR-6504-3p CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-6504-3p SLC35F6 solute carrier family 35 member F6 HGNC:26055 details
hsa-miR-6504-3p details
hsa-miR-6504-3p NT5C2 5'-nucleotidase, cytosolic II HGNC:8022 details
hsa-miR-6504-3p KCTD21 potassium channel tetramerization domain containing 21 HGNC:27452 details
hsa-miR-6504-3p CHST6 carbohydrate sulfotransferase 6 HGNC:6938 details
hsa-miR-6504-3p RAB11FIP4 RAB11 family interacting protein 4 HGNC:30267 details
hsa-miR-6504-3p SAV1 salvador family WW domain containing protein 1 HGNC:17795 details
hsa-miR-6504-3p EFCAB11 EF-hand calcium binding domain 11 HGNC:20357 details
hsa-miR-6504-3p CLK4 CDC like kinase 4 HGNC:13659 details
hsa-miR-6504-3p ANKRD62 ankyrin repeat domain 62 HGNC:35241 details
hsa-miR-6504-3p IMPA1 inositol monophosphatase 1 HGNC:6050 details
hsa-miR-6504-3p SLC16A13 solute carrier family 16 member 13 HGNC:31037 details
hsa-miR-6504-3p ABHD15 abhydrolase domain containing 15 HGNC:26971 details
hsa-miR-6504-3p COG7 component of oligomeric golgi complex 7 HGNC:18622 details
hsa-miR-6504-3p LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated HGNC:17874 details
hsa-miR-6504-3p CEP89 centrosomal protein 89 HGNC:25907 details
hsa-miR-6504-3p C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-6504-3p SMIM14 small integral membrane protein 14 HGNC:27321 details
hsa-miR-6504-3p details
hsa-miR-6504-3p ZNF563 zinc finger protein 563 HGNC:30498 details
hsa-miR-6504-3p CCL5 C-C motif chemokine ligand 5 HGNC:10632 details
hsa-miR-6504-3p STAR steroidogenic acute regulatory protein HGNC:11359 details
hsa-miR-6504-3p ZFP14 ZFP14 zinc finger protein HGNC:29312 details
hsa-miR-6504-3p AKAP8 A-kinase anchoring protein 8 HGNC:378 details
hsa-miR-6504-3p NEK8 NIMA related kinase 8 HGNC:13387 details
hsa-miR-6504-3p NKD1 NKD inhibitor of WNT signaling pathway 1 HGNC:17045 details
hsa-miR-6504-3p ABCB11 ATP binding cassette subfamily B member 11 HGNC:42 details
hsa-miR-6504-3p KCNK6 potassium two pore domain channel subfamily K member 6 HGNC:6281 details
hsa-miR-6504-3p CEP76 centrosomal protein 76 HGNC:25727 details
hsa-miR-6504-3p IVD isovaleryl-CoA dehydrogenase HGNC:6186 details
hsa-miR-6504-3p C3 complement C3 HGNC:1318 details
hsa-miR-6504-3p FIG4 FIG4 phosphoinositide 5-phosphatase HGNC:16873 details
hsa-miR-6504-3p ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-6504-3p TMCO1 transmembrane and coiled-coil domains 1 HGNC:18188 details
hsa-miR-6504-3p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-6504-3p SLC16A10 solute carrier family 16 member 10 HGNC:17027 details
hsa-miR-6504-3p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-6504-3p PLPBP pyridoxal phosphate binding protein HGNC:9457 details
hsa-miR-6504-3p NPFFR1 neuropeptide FF receptor 1 HGNC:17425 details
hsa-miR-6504-3p NKAP NFKB activating protein HGNC:29873 details
hsa-miR-6504-3p MOB4 MOB family member 4, phocein HGNC:17261 details
hsa-miR-6504-3p KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-6504-3p details
hsa-miR-6504-3p KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-6504-3p IPO9 importin 9 HGNC:19425 details
hsa-miR-6504-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-6504-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-6504-3p ICMT isoprenylcysteine carboxyl methyltransferase HGNC:5350 details
hsa-miR-6504-3p HSPE1-MOB4 HSPE1-MOB4 readthrough HGNC:49184 details
hsa-miR-6504-3p HSPA4L heat shock protein family A (Hsp70) member 4 like HGNC:17041 details
hsa-miR-6504-3p FAM83D family with sequence similarity 83 member D HGNC:16122 details
hsa-miR-6504-3p MINDY2 MINDY lysine 48 deubiquitinase 2 HGNC:26954 details
hsa-miR-6504-3p MINDY1 MINDY lysine 48 deubiquitinase 1 HGNC:25648 details
hsa-miR-6504-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-6504-3p EIF4E eukaryotic translation initiation factor 4E HGNC:3287 details
hsa-miR-6504-3p DSTYK dual serine/threonine and tyrosine protein kinase HGNC:29043 details
hsa-miR-6504-3p DIP2A disco interacting protein 2 homolog A HGNC:17217 details
hsa-miR-6504-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-6504-3p CACYBP calcyclin binding protein HGNC:30423 details
hsa-miR-6504-3p C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-6504-3p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-6504-3p TMC7 transmembrane channel like 7 HGNC:23000 details
hsa-miR-6504-3p ALAD aminolevulinate dehydratase HGNC:395 details
hsa-miR-6504-3p ZNF135 zinc finger protein 135 HGNC:12919 details
hsa-miR-6504-3p ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-6504-3p CCDC174 coiled-coil domain containing 174 HGNC:28033 details
hsa-miR-6504-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-6504-3p SURF6 surfeit 6 HGNC:11478 details
hsa-miR-6504-3p CENPA centromere protein A HGNC:1851 details
hsa-miR-6504-3p WDR97 WD repeat domain 97 HGNC:26959 details
hsa-miR-6504-3p TXK TXK tyrosine kinase HGNC:12434 details
hsa-miR-6504-3p FHDC1 FH2 domain containing 1 HGNC:29363 details
hsa-miR-6504-3p TM7SF3 transmembrane 7 superfamily member 3 HGNC:23049 details
hsa-miR-6504-3p PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha HGNC:9388 details
hsa-miR-6504-3p PIGV phosphatidylinositol glycan anchor biosynthesis class V HGNC:26031 details
hsa-miR-6504-3p NLGN4X neuroligin 4 X-linked HGNC:14287 details
hsa-miR-6504-3p MYCN MYCN proto-oncogene, bHLH transcription factor HGNC:7559 details
hsa-miR-6504-3p GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 HGNC:4125 details
hsa-miR-6504-3p ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-6504-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-6504-3p DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-6504-3p ZNF865 zinc finger protein 865 HGNC:38705 details
hsa-miR-6504-3p MASTL microtubule associated serine/threonine kinase like HGNC:19042 details
hsa-miR-6504-3p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-6504-3p JCAD junctional cadherin 5 associated HGNC:29283 details
hsa-miR-6504-3p KRBOX4 KRAB box domain containing 4 HGNC:26007 details
hsa-miR-6504-3p SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-6504-3p NEDD4L NEDD4 like E3 ubiquitin protein ligase HGNC:7728 details
hsa-miR-6504-3p TMCC1 transmembrane and coiled-coil domain family 1 HGNC:29116 details
hsa-miR-6504-3p SLC17A5 solute carrier family 17 member 5 HGNC:10933 details
hsa-miR-6504-3p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-6504-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-6504-3p PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-6504-3p LRRC31 leucine rich repeat containing 31 HGNC:26261 details
hsa-miR-6504-3p F2RL3 F2R like thrombin or trypsin receptor 3 HGNC:3540 details
hsa-miR-6504-3p ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-6504-3p ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-6504-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-6504-3p UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-6504-3p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-6504-3p UBE2B ubiquitin conjugating enzyme E2 B HGNC:12473 details
hsa-miR-6504-3p SFXN5 sideroflexin 5 HGNC:16073 details
hsa-miR-6504-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-6504-3p NT5C3A 5'-nucleotidase, cytosolic IIIA HGNC:17820 details
hsa-miR-6504-3p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-6504-3p INO80D INO80 complex subunit D HGNC:25997 details
hsa-miR-6504-3p GPR180 G protein-coupled receptor 180 HGNC:28899 details
hsa-miR-6504-3p GLRX5 glutaredoxin 5 HGNC:20134 details
hsa-miR-6504-3p EIF4G2 eukaryotic translation initiation factor 4 gamma 2 HGNC:3297 details
hsa-miR-6504-3p DIDO1 death inducer-obliterator 1 HGNC:2680 details
hsa-miR-6504-3p AOC3 amine oxidase copper containing 3 HGNC:550 details
hsa-miR-6504-3p FMN1 formin 1 HGNC:3768 details
hsa-miR-6504-3p TTC37 tetratricopeptide repeat domain 37 HGNC:23639 details
hsa-miR-6504-3p details
hsa-miR-6504-3p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-6504-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-6504-3p PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-6504-3p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-6504-3p NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-6504-3p LBR lamin B receptor HGNC:6518 details
hsa-miR-6504-3p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-6504-3p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-6504-3p YRDC yrdC N6-threonylcarbamoyltransferase domain containing HGNC:28905 details
hsa-miR-6504-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-6504-3p PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-6504-3p HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-6504-3p ZNF350 zinc finger protein 350 HGNC:16656 details
hsa-miR-6504-3p OIP5 Opa interacting protein 5 HGNC:20300 details
hsa-miR-6504-3p RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-6504-3p FAM120C family with sequence similarity 120C HGNC:16949 details
hsa-miR-6504-3p details
hsa-miR-6504-3p TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-6504-3p WDR53 WD repeat domain 53 HGNC:28786 details
hsa-miR-6504-3p PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A HGNC:27989 details
hsa-miR-6504-3p TPST2 tyrosylprotein sulfotransferase 2 HGNC:12021 details
hsa-miR-6504-3p NME6 NME/NM23 nucleoside diphosphate kinase 6 HGNC:20567 details
hsa-miR-6504-3p NFATC2 nuclear factor of activated T cells 2 HGNC:7776 details
hsa-miR-6504-3p details
hsa-miR-6504-3p ZNF48 zinc finger protein 48 HGNC:13114 details
hsa-miR-6504-3p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-6504-3p PLEKHA2 pleckstrin homology domain containing A2 HGNC:14336 details
hsa-miR-6504-3p PCLAF PCNA clamp associated factor HGNC:28961 details
hsa-miR-6504-3p POLR3F RNA polymerase III subunit F HGNC:15763 details
hsa-miR-6504-3p TRIM27 tripartite motif containing 27 HGNC:9975 details
hsa-miR-6504-3p BRS3 bombesin receptor subtype 3 HGNC:1113 details
hsa-miR-6504-3p CYP27C1 cytochrome P450 family 27 subfamily C member 1 HGNC:33480 details
hsa-miR-6504-3p TNFAIP8L1 TNF alpha induced protein 8 like 1 HGNC:28279 details
hsa-miR-6504-3p LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-6504-3p YIPF4 Yip1 domain family member 4 HGNC:28145 details
hsa-miR-6504-3p KLHL14 kelch like family member 14 HGNC:29266 details
hsa-miR-6504-3p KLF13 Kruppel like factor 13 HGNC:13672 details
hsa-miR-6504-3p SPIB Spi-B transcription factor HGNC:11242 details
hsa-miR-6504-3p PKHD1 PKHD1 ciliary IPT domain containing fibrocystin/polyductin HGNC:9016 details
hsa-miR-6504-3p FBXO47 F-box protein 47 HGNC:31969 details
hsa-miR-6504-3p TLCD2 TLC domain containing 2 HGNC:33522 details
hsa-miR-6504-3p SLC25A37 solute carrier family 25 member 37 HGNC:29786 details
hsa-miR-6504-3p CSNK1E casein kinase 1 epsilon HGNC:2453 details
hsa-miR-6504-3p ICA1L islet cell autoantigen 1 like HGNC:14442 details
hsa-miR-6504-3p NSMCE2 NSE2 (MMS21) homolog, SMC5-SMC6 complex SUMO ligase HGNC:26513 details
hsa-miR-6504-3p PRKX protein kinase X-linked HGNC:9441 details
hsa-miR-6504-3p PRPF38A pre-mRNA processing factor 38A HGNC:25930 details
hsa-miR-6504-3p GRM6 glutamate metabotropic receptor 6 HGNC:4598 details
hsa-miR-6504-3p SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-6504-3p RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-6504-3p METTL21A methyltransferase 21A, HSPA lysine HGNC:30476 details
hsa-miR-6504-3p BHMT2 betaine--homocysteine S-methyltransferase 2 HGNC:1048 details
hsa-miR-6504-3p ZDHHC15 zinc finger DHHC-type palmitoyltransferase 15 HGNC:20342 details
hsa-miR-6504-3p GOLGA2 golgin A2 HGNC:4425 details
hsa-miR-6504-3p POC1A POC1 centriolar protein A HGNC:24488 details
hsa-miR-6504-3p GATAD1 GATA zinc finger domain containing 1 HGNC:29941 details
hsa-miR-6504-3p ZNF785 zinc finger protein 785 HGNC:26496 details
hsa-miR-6504-3p WDR73 WD repeat domain 73 HGNC:25928 details
hsa-miR-6504-3p RMND1 required for meiotic nuclear division 1 homolog HGNC:21176 details
hsa-miR-6504-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-6504-3p N4BP2L2 NEDD4 binding protein 2 like 2 HGNC:26916 details
hsa-miR-6504-3p RAB42 RAB42, member RAS oncogene family HGNC:28702 details
hsa-miR-6504-3p FAM227A family with sequence similarity 227 member A HGNC:44197 details
hsa-miR-6504-3p ZNF852 zinc finger protein 852 HGNC:27713 details
hsa-miR-6504-3p LETMD1 LETM1 domain containing 1 HGNC:24241 details
hsa-miR-6504-3p MUC20 mucin 20, cell surface associated HGNC:23282 details
hsa-miR-6504-3p ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-6504-3p RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-6504-3p ERVV-1 endogenous retrovirus group V member 1, envelope HGNC:26501 details
hsa-miR-6504-3p WFDC6 WAP four-disulfide core domain 6 HGNC:16164 details
hsa-miR-6504-3p FAAP24 FA core complex associated protein 24 HGNC:28467 details
hsa-miR-6504-3p FANCA FA complementation group A HGNC:3582 details
hsa-miR-6504-3p ESR2 estrogen receptor 2 HGNC:3468 details
hsa-miR-6504-3p ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-6504-3p CCS copper chaperone for superoxide dismutase HGNC:1613 details
hsa-miR-6504-3p PCP4L1 Purkinje cell protein 4 like 1 HGNC:20448 details
hsa-miR-6504-3p MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-6504-3p OCIAD1 OCIA domain containing 1 HGNC:16074 details
hsa-miR-6504-3p MYLK3 myosin light chain kinase 3 HGNC:29826 details
hsa-miR-6504-3p CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-6504-3p IFIT3 interferon induced protein with tetratricopeptide repeats 3 HGNC:5411 details
hsa-miR-6504-3p ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-6504-3p GTF2IRD2B GTF2I repeat domain containing 2B HGNC:33125 details
hsa-miR-6504-3p SLC2A11 solute carrier family 2 member 11 HGNC:14239 details
hsa-miR-6504-3p LRRD1 leucine rich repeats and death domain containing 1 HGNC:34300 details
hsa-miR-6504-3p MYO1F myosin IF HGNC:7600 details
hsa-miR-6504-3p ARGFX arginine-fifty homeobox HGNC:30146 details
hsa-miR-6504-3p MRI1 methylthioribose-1-phosphate isomerase 1 HGNC:28469 details
hsa-miR-6504-3p ASB16 ankyrin repeat and SOCS box containing 16 HGNC:19768 details
hsa-miR-6504-3p CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 HGNC:13628 details
hsa-miR-6504-3p details
hsa-miR-6504-3p details
hsa-miR-6504-3p ZNF426 zinc finger protein 426 HGNC:20725 details
hsa-miR-6504-3p RTN2 reticulon 2 HGNC:10468 details
hsa-miR-6504-3p TNFSF14 TNF superfamily member 14 HGNC:11930 details
hsa-miR-6504-3p PTGIS prostaglandin I2 synthase HGNC:9603 details
hsa-miR-6504-3p PNPLA3 patatin like phospholipase domain containing 3 HGNC:18590 details
hsa-miR-6504-3p HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 HGNC:5194 details
hsa-miR-6504-3p UACA uveal autoantigen with coiled-coil domains and ankyrin repeats HGNC:15947 details
hsa-miR-6504-3p LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-6504-3p TRAF3IP2 TRAF3 interacting protein 2 HGNC:1343 details
hsa-miR-6504-3p RABGAP1L RAB GTPase activating protein 1 like HGNC:24663 details
hsa-miR-6504-3p NSUN4 NOP2/Sun RNA methyltransferase 4 HGNC:31802 details
hsa-miR-6504-3p LRIF1 ligand dependent nuclear receptor interacting factor 1 HGNC:30299 details
hsa-miR-6504-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-6504-3p GTF2IRD2 GTF2I repeat domain containing 2 HGNC:30775 details
hsa-miR-6504-3p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-6504-3p GABPB1 GA binding protein transcription factor subunit beta 1 HGNC:4074 details
hsa-miR-6504-3p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-6504-3p details
hsa-miR-6504-3p SELENOI selenoprotein I HGNC:29361 details
hsa-miR-6504-3p DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-6504-3p DDI2 DNA damage inducible 1 homolog 2 HGNC:24578 details
hsa-miR-6504-3p CAPZA2 capping actin protein of muscle Z-line subunit alpha 2 HGNC:1490 details
hsa-miR-6504-3p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-6504-3p ZNF665 zinc finger protein 665 HGNC:25885 details
hsa-miR-6504-3p GTF2H3 general transcription factor IIH subunit 3 HGNC:4657 details
hsa-miR-6504-3p MBD1 methyl-CpG binding domain protein 1 HGNC:6916 details
hsa-miR-6504-3p FOXRED2 FAD dependent oxidoreductase domain containing 2 HGNC:26264 details
hsa-miR-6504-3p ACOT9 acyl-CoA thioesterase 9 HGNC:17152 details
hsa-miR-6504-3p CXorf38 chromosome X open reading frame 38 HGNC:28589 details
hsa-miR-6504-3p NOL9 nucleolar protein 9 HGNC:26265 details
hsa-miR-6504-3p APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 HGNC:17889 details
hsa-miR-6504-3p PARD3 par-3 family cell polarity regulator HGNC:16051 details
hsa-miR-6504-3p RBM41 RNA binding motif protein 41 HGNC:25617 details
hsa-miR-6504-3p TRIM58 tripartite motif containing 58 HGNC:24150 details
hsa-miR-6504-3p RNF34 ring finger protein 34 HGNC:17297 details
hsa-miR-6504-3p ZNF446 zinc finger protein 446 HGNC:21036 details
hsa-miR-6504-3p POLM DNA polymerase mu HGNC:9185 details
hsa-miR-6504-3p ZNF347 zinc finger protein 347 HGNC:16447 details
hsa-miR-6504-3p RRP7A ribosomal RNA processing 7 homolog A HGNC:24286 details
hsa-miR-6504-3p ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B HGNC:26795 details
hsa-miR-6504-3p ABCG8 ATP binding cassette subfamily G member 8 HGNC:13887 details
hsa-miR-6504-3p CCDC198 coiled-coil domain containing 198 HGNC:20189 details
hsa-miR-6504-3p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-6504-3p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-6504-3p SPTY2D1 SPT2 chromatin protein domain containing 1 HGNC:26818 details
hsa-miR-6504-3p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-6504-3p SLC6A4 solute carrier family 6 member 4 HGNC:11050 details
hsa-miR-6504-3p SH3BP5 SH3 domain binding protein 5 HGNC:10827 details
hsa-miR-6504-3p PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-6504-3p PLAA phospholipase A2 activating protein HGNC:9043 details
hsa-miR-6504-3p PGM2L1 phosphoglucomutase 2 like 1 HGNC:20898 details
hsa-miR-6504-3p details
hsa-miR-6504-3p NAA40 N-alpha-acetyltransferase 40, NatD catalytic subunit HGNC:25845 details
hsa-miR-6504-3p MOGAT1 monoacylglycerol O-acyltransferase 1 HGNC:18210 details
hsa-miR-6504-3p KIAA1549 KIAA1549 HGNC:22219 details
hsa-miR-6504-3p KCND3 potassium voltage-gated channel subfamily D member 3 HGNC:6239 details
hsa-miR-6504-3p GNG12 G protein subunit gamma 12 HGNC:19663 details
hsa-miR-6504-3p LDHD lactate dehydrogenase D HGNC:19708 details
hsa-miR-6504-3p CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit X HGNC:2088 details
hsa-miR-6504-3p ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-6504-3p PCNX2 pecanex 2 HGNC:8736 details
hsa-miR-6504-3p CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase HGNC:1769 details
hsa-miR-6504-3p DDX47 DEAD-box helicase 47 HGNC:18682 details
hsa-miR-6504-3p LIN9 lin-9 DREAM MuvB core complex component HGNC:30830 details
hsa-miR-6504-3p LETM2 leucine zipper and EF-hand containing transmembrane protein 2 HGNC:14648 details
hsa-miR-6504-3p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-6504-3p ATG12 autophagy related 12 HGNC:588 details
hsa-miR-6504-3p BCL9L BCL9 like HGNC:23688 details
hsa-miR-6504-3p EREG epiregulin HGNC:3443 details
hsa-miR-6504-3p ERO1A endoplasmic reticulum oxidoreductase 1 alpha HGNC:13280 details
hsa-miR-6504-3p VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-6504-3p AGO4 argonaute RISC component 4 HGNC:18424 details
hsa-miR-6504-3p ALDH6A1 aldehyde dehydrogenase 6 family member A1 HGNC:7179 details
hsa-miR-6504-3p ARHGEF39 Rho guanine nucleotide exchange factor 39 HGNC:25909 details
hsa-miR-6504-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-6504-3p C11orf98 chromosome 11 open reading frame 98 HGNC:51238 details
hsa-miR-6504-3p DPP9 dipeptidyl peptidase 9 HGNC:18648 details
hsa-miR-6504-3p DSC1 desmocollin 1 HGNC:3035 details
hsa-miR-6504-3p DUSP18 dual specificity phosphatase 18 HGNC:18484 details
hsa-miR-6504-3p ECHDC3 enoyl-CoA hydratase domain containing 3 HGNC:23489 details
hsa-miR-6504-3p GMEB1 glucocorticoid modulatory element binding protein 1 HGNC:4370 details
hsa-miR-6504-3p HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-6504-3p IMP4 IMP U3 small nucleolar ribonucleoprotein 4 HGNC:30856 details
hsa-miR-6504-3p KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-6504-3p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-6504-3p METTL2B methyltransferase 2B, methylcytidine HGNC:18272 details
hsa-miR-6504-3p MIEF2 mitochondrial elongation factor 2 HGNC:17920 details
hsa-miR-6504-3p RHNO1 RAD9-HUS1-RAD1 interacting nuclear orphan 1 HGNC:28206 details
hsa-miR-6504-3p SLC12A6 solute carrier family 12 member 6 HGNC:10914 details
hsa-miR-6504-3p STRIP2 striatin interacting protein 2 HGNC:22209 details
hsa-miR-6504-3p TBXA2R thromboxane A2 receptor HGNC:11608 details
hsa-miR-6504-3p TPMT thiopurine S-methyltransferase HGNC:12014 details
hsa-miR-6504-3p TXNL4A thioredoxin like 4A HGNC:30551 details
hsa-miR-6504-3p ZKSCAN7 zinc finger with KRAB and SCAN domains 7 HGNC:12955 details
hsa-miR-6504-3p ZNF70 zinc finger protein 70 HGNC:13140 details
hsa-miR-6504-3p ARMT1 acidic residue methyltransferase 1 HGNC:17872 details
hsa-miR-6504-3p C17orf75 chromosome 17 open reading frame 75 HGNC:30173 details
hsa-miR-6504-3p CYB5R4 cytochrome b5 reductase 4 HGNC:20147 details
hsa-miR-6504-3p GADL1 glutamate decarboxylase like 1 HGNC:27949 details
hsa-miR-6504-3p LDB1 LIM domain binding 1 HGNC:6532 details
hsa-miR-6504-3p MPPE1 metallophosphoesterase 1 HGNC:15988 details
hsa-miR-6504-3p MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-6504-3p PDK1 pyruvate dehydrogenase kinase 1 HGNC:8809 details
hsa-miR-6504-3p SP2 Sp2 transcription factor HGNC:11207 details
hsa-miR-6504-3p TSPAN31 tetraspanin 31 HGNC:10539 details
hsa-miR-6504-3p ZNF257 zinc finger protein 257 HGNC:13498 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab