miRNA Card

miRNA General Information
miRNA ID hsa-miR-6831-3p
Description Homo sapiens miR-6831 stem-loop
Comment None
Experiment meta-analysis [1]
Sequence UGACUAACUCCCACUCUACAG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr5:151662623|151662872 hsa-miR-6831-3p 1 0 0
chr1:154206945|154207067 hsa-miR-6831-3p 1 0 0
chr22:41433685|41433894 hsa-miR-6831-3p 0 1 0
chr17:81701713|81701914 hsa-miR-6831-3p 0 1 0
chr6:43019109|43019347 hsa-miR-6831-3p 1 0 0
chr17:45023371|45023549 hsa-miR-6831-3p 1 0 0
chr15:41279395|41279503 hsa-miR-6831-3p 1 0 0
chr11:119335083|119335184 hsa-miR-6831-3p 0 1 0
chr3:100364230|100364341 hsa-miR-6831-3p 0 1 0
chr1:24843189|24843446 hsa-miR-6831-3p 0 1 0
chr3:197783108|197783366 hsa-miR-6831-3p 0 1 0
chr2:42350791~42350915 hsa-miR-6831-3p 0 1 0
chr5:98780849|98780965 hsa-miR-6831-3p 0 1 0
chr14:73712435~73712539 hsa-miR-6831-3p 0 1 0
chr11:72014598~72014799 hsa-miR-6831-3p 0 1 0
chr15:89667767~89669648 hsa-miR-6831-3p 0 1 0
chr3:197087827|197087972 hsa-miR-6831-3p 1 0 0
chr20:18527920|18528103 hsa-miR-6831-3p 0 1 0
chr3:185630799|185630912 hsa-miR-6831-3p 0 1 0
chr15:80089631|80089849 hsa-miR-6831-3p 1 0 0
chr12:92081008|92081193 hsa-miR-6831-3p 0 1 0
chr12:57498420|57498536 hsa-miR-6831-3p 0 1 0
chr2:215414837|215419385 hsa-miR-6831-3p 1 0 0
chr19:34377535|34377856 hsa-miR-6831-3p 1 0 0
chr1:205715732|205715886 hsa-miR-6831-3p 0 1 0
chr12:132676702|132676831 hsa-miR-6831-3p 0 1 0
chr11:67257333|67257478 hsa-miR-6831-3p 0 1 0
chr13:45988787|45988983 hsa-miR-6831-3p 0 1 0
chr11:72697624|72698007 hsa-miR-6831-3p 0 1 0
chr16:1698951|1699114 hsa-miR-6831-3p 0 1 0
chr15:40537509|40537640 hsa-miR-6831-3p -15 1 0
chr14:90407186|90407272 hsa-miR-6831-3p 0 1 0
chr17:39989851|39990179 hsa-miR-6831-3p 0 1 0
chr11:67257333|67257466 hsa-miR-6831-3p 0 1 0
chr2:96809454|96809680 hsa-miR-6831-3p 0 1 0
chr4:76158923|76159081 hsa-miR-6831-3p 0 1 0
chr3:52524143|52524463 hsa-miR-6831-3p 0 1 0
chr11:119335010|119335184 hsa-miR-6831-3p 0 1 0
chr11:65021889|65022045 hsa-miR-6831-3p 1 0 0
chr6:52498935|52499127 hsa-miR-6831-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-6831-3p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-6831-3p CPPED1 calcineurin like phosphoesterase domain containing 1 HGNC:25632 details
hsa-miR-6831-3p RCBTB1 RCC1 and BTB domain containing protein 1 HGNC:18243 details
hsa-miR-6831-3p PCNX1 pecanex 1 HGNC:19740 details
hsa-miR-6831-3p DCUN1D5 defective in cullin neddylation 1 domain containing 5 HGNC:28409 details
hsa-miR-6831-3p C9orf78 chromosome 9 open reading frame 78 HGNC:24932 details
hsa-miR-6831-3p YBX1 Y-box binding protein 1 HGNC:8014 details
hsa-miR-6831-3p TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-6831-3p NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-6831-3p METTL21A methyltransferase 21A, HSPA lysine HGNC:30476 details
hsa-miR-6831-3p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-6831-3p details
hsa-miR-6831-3p PGPEP1 pyroglutamyl-peptidase I HGNC:13568 details
hsa-miR-6831-3p details
hsa-miR-6831-3p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-6831-3p SRSF10 serine and arginine rich splicing factor 10 HGNC:16713 details
hsa-miR-6831-3p MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-6831-3p LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-6831-3p PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 HGNC:30043 details
hsa-miR-6831-3p SERP1 stress associated endoplasmic reticulum protein 1 HGNC:10759 details
hsa-miR-6831-3p DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-6831-3p PRICKLE1 prickle planar cell polarity protein 1 HGNC:17019 details
hsa-miR-6831-3p SDCBP syndecan binding protein HGNC:10662 details
hsa-miR-6831-3p NLGN4X neuroligin 4 X-linked HGNC:14287 details
hsa-miR-6831-3p KAT6B lysine acetyltransferase 6B HGNC:17582 details
hsa-miR-6831-3p SLC35G1 solute carrier family 35 member G1 HGNC:26607 details
hsa-miR-6831-3p MMAB metabolism of cobalamin associated B HGNC:19331 details
hsa-miR-6831-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-6831-3p TAS2R30 taste 2 receptor member 30 HGNC:19112 details
hsa-miR-6831-3p TPM1 tropomyosin 1 HGNC:12010 details
hsa-miR-6831-3p THOC2 THO complex 2 HGNC:19073 details
hsa-miR-6831-3p EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-6831-3p MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-6831-3p GPI glucose-6-phosphate isomerase HGNC:4458 details
hsa-miR-6831-3p PCF11 PCF11 cleavage and polyadenylation factor subunit HGNC:30097 details
hsa-miR-6831-3p THAP1 THAP domain containing 1 HGNC:20856 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab