miRNA Card

miRNA General Information
miRNA ID hsa-miR-6844
Description Homo sapiens miR-6844 stem-loop
Comment None
Experiment meta-analysis [1]
Sequence UUCUUUGUUUUUAAUUCACAG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr13:36335290|36335409 hsa-miR-6844 1 1 0
chr22:24634692|24634820 hsa-miR-6844 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr14:67677837|67678002 hsa-miR-6844 0 1 0
chr20:34290332|34290630 hsa-miR-6844 0 1 0
chr1:235689968|235690059 hsa-miR-6844 0 1 0
chr8:41262693|41262810 hsa-miR-6844 0 1 0
chr20:33648087|33648228 hsa-miR-6844 0 1 0
chr3:39096341|39096439 hsa-miR-6844 1 0 0
chr12:6864836|6865248 hsa-miR-6844 0 1 0
chr1:161037714|161037938 hsa-miR-6844 0 1 0
chr6:157273528|157273690 hsa-miR-6844 0 1 0
chr5:34951391|34951471 hsa-miR-6844 0 1 0
chr3:10126600|10126729 hsa-miR-6844 0 1 0
chr6:145886978|145887075 hsa-miR-6844 0 1 0
chr16:30070009|30070336 hsa-miR-6844 0 1 0
chr3:150542191|150542398 hsa-miR-6844 0 1 0
chr22:41436570|41436658 hsa-miR-6844 0 1 0
chr3:10126581|10126729 hsa-miR-6844 0 1 0
chr6:30619493|30619768 hsa-miR-6844 0 1 0
chr8:41262693|41262866 hsa-miR-6844 0 1 0
chr16:30069985|30070218 hsa-miR-6844 0 1 0
chr2:64998897|64999017 hsa-miR-6844 0 1 0
chr11:6477822~6478131 hsa-miR-6844 0 1 0
chr3:39096341~39096439 hsa-miR-6844 0 1 0
chr11:95128626|95128780 hsa-miR-6844 0 1 0
chr8:41262693~41262819 hsa-miR-6844 0 1 0
chr11:6477822~6478134 hsa-miR-6844 0 1 0
chr16:30070179~30070340 hsa-miR-6844 0 1 0
chr20:63933431~63933597 hsa-miR-6844 0 1 0
chr11:66275294|66275464 hsa-miR-6844 0 1 0
chr3:149377500~149377628 hsa-miR-6844 0 1 0
chr19:49103197~49103272 hsa-miR-6844 0 1 0
chr16:70158067~70158185 hsa-miR-6844 0 1 0
chr8:41262693~41262772 hsa-miR-6844 0 1 0
chr19:49335436|49338029 hsa-miR-6844 0 1 0
chr2:43268067|43268247 hsa-miR-6844 0 1 0
chrX:73999469|73999551 hsa-miR-6844 0 1 0
chr4:112644425|112644768 hsa-miR-6844 0 1 0
chr19:19442165|19442365 hsa-miR-6844 0 1 0
chr2:84428751|84428894 hsa-miR-6844 0 1 0
chr16:30069868|30070218 hsa-miR-6844 0 1 0
chr22:21958934|21959131 hsa-miR-6844 0 1 0
chr19:6718094|6718276 hsa-miR-6844 0 1 0
chr17:41974398|41974539 hsa-miR-6844 0 1 0
chr19:41715781|41715904 hsa-miR-6844 0 1 0
chr10:119830842|119831100 hsa-miR-6844 0 1 0
chr16:30070009|30070340 hsa-miR-6844 0 1 0
chr9:21865599|21865817 hsa-miR-6844 0 1 0
chr19:41718179|41718340 hsa-miR-6844 0 1 0
chr11:134375544|134375657 hsa-miR-6844 0 1 0
chr11:6477822|6478134 hsa-miR-6844 0 1 0
chr16:30069997|30070218 hsa-miR-6844 0 1 0
chr1:161037714|161037968 hsa-miR-6844 0 1 0
chr20:34290332|34290638 hsa-miR-6844 0 1 0
chr18:23257486|23257700 hsa-miR-6844 0 1 0
chr12:116716438|116716605 hsa-miR-6844 0 1 0
chr5:32126382|32126588 hsa-miR-6844 0 1 0
chr19:45079907|45080029 hsa-miR-6844 0 1 0
chr17:44594749|44594900 hsa-miR-6844 0 1 0
chr19:41715650|41717733 hsa-miR-6844 0 1 0
chr3:149377500|149377628 hsa-miR-6844 0 1 0
chrX:66032714|66033559 hsa-miR-6844 0 1 0
chr10:73837289|73837555 hsa-miR-6844 0 1 0
chr7:150692520|150692681 hsa-miR-6844 0 1 0
chr16:30069982|30070218 hsa-miR-6844 0 1 0
chr22:41359293|41359456 hsa-miR-6844 0 1 0
chr7:50401759|50401940 hsa-miR-6844 0 1 0
chr16:30070009|30070218 hsa-miR-6844 0 1 0
chr5:180549931|180553471 hsa-miR-6844 0 1 0
chr16:30070012|30070218 hsa-miR-6844 0 1 0
chr1:23751288|23751393 hsa-miR-6844 0 1 0
chr12:3286166|3286420 hsa-miR-6844 0 1 0
chr5:154417292|154417510 hsa-miR-6844 0 1 0
chr14:67677851|67678019 hsa-miR-6844 0 1 0
chr12:131789965|131790135 hsa-miR-6844 0 1 0
chr16:30070009|30070343 hsa-miR-6844 0 1 0
chr19:40807518|40807870 hsa-miR-6844 0 1 0
chr4:76003129|76003526 hsa-miR-6844 0 1 0
chr3:10126574|10126788 hsa-miR-6844 0 1 0
chr18:9536163|9536379 hsa-miR-6844 0 1 0
chr1:23751270|23751393 hsa-miR-6844 -5 1 0
chrX:129805722|129805962 hsa-miR-6844 -9 1 0
chr21:34101461|34101702 hsa-miR-6844 -9 1 0
chr10:5457874|5458087 hsa-miR-6844 -10 1 0
chr6:26413866|26414075 hsa-miR-6844 0 1 0
chr6:30619493|30619726 hsa-miR-6844 0 1 0
chr19:41718192|41718340 hsa-miR-6844 0 1 0
chr6:30617927|30619726 hsa-miR-6844 0 1 0
chr11:134375528|134375707 hsa-miR-6844 0 1 0
chr14:67677833|67678008 hsa-miR-6844 0 1 0
chr16:30070183|30070343 hsa-miR-6844 0 1 0
chr14:67677837|67677999 hsa-miR-6844 0 1 0
chr22:31341713|31341911 hsa-miR-6844 0 1 0
chr9:614039|614176 hsa-miR-6844 0 1 0
chr19:41718209|41718340 hsa-miR-6844 0 1 0
chr3:50258403|50258505 hsa-miR-6844 0 1 0
chr14:69052952|69053104 hsa-miR-6844 0 1 0
chr16:30070006|30070333 hsa-miR-6844 0 1 0
chr12:6865164|6866008 hsa-miR-6844 0 1 0
chr20:62905524|62905692 hsa-miR-6844 0 1 0
chr2:127764633|127764834 hsa-miR-6844 0 1 0
chr1:59874420|59874548 hsa-miR-6844 0 1 0
chr19:41718259|41718340 hsa-miR-6844 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-6844 FLT1 fms related receptor tyrosine kinase 1 HGNC:3763 details
hsa-miR-6844 GALNTL6 polypeptide N-acetylgalactosaminyltransferase like 6 HGNC:33844 details
hsa-miR-6844 CYP4V2 cytochrome P450 family 4 subfamily V member 2 HGNC:23198 details
hsa-miR-6844 TMEM50A transmembrane protein 50A HGNC:30590 details
hsa-miR-6844 NPY4R neuropeptide Y receptor Y4 HGNC:9329 details
hsa-miR-6844 SYNJ2BP synaptojanin 2 binding protein HGNC:18955 details
hsa-miR-6844 XPO7 exportin 7 HGNC:14108 details
hsa-miR-6844 DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-6844 ATL3 atlastin GTPase 3 HGNC:24526 details
hsa-miR-6844 NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-6844 ARNTL aryl hydrocarbon receptor nuclear translocator like HGNC:701 details
hsa-miR-6844 NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-6844 SLC46A1 solute carrier family 46 member 1 HGNC:30521 details
hsa-miR-6844 PDPK1 3-phosphoinositide dependent protein kinase 1 HGNC:8816 details
hsa-miR-6844 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A HGNC:3091 details
hsa-miR-6844 ZNF83 zinc finger protein 83 HGNC:13158 details
hsa-miR-6844 DCK deoxycytidine kinase HGNC:2704 details
hsa-miR-6844 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-6844 CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-6844 ZNF781 zinc finger protein 781 HGNC:26745 details
hsa-miR-6844 ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-6844 PRRX1 paired related homeobox 1 HGNC:9142 details
hsa-miR-6844 NAA15 N-alpha-acetyltransferase 15, NatA auxiliary subunit HGNC:30782 details
hsa-miR-6844 NDNF neuron derived neurotrophic factor HGNC:26256 details
hsa-miR-6844 VCAM1 vascular cell adhesion molecule 1 HGNC:12663 details
hsa-miR-6844 TMEM119 transmembrane protein 119 HGNC:27884 details
hsa-miR-6844 PLCL1 phospholipase C like 1 (inactive) HGNC:9063 details
hsa-miR-6844 PKIA cAMP-dependent protein kinase inhibitor alpha HGNC:9017 details
hsa-miR-6844 ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-6844 ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-6844 details
hsa-miR-6844 ROBO2 roundabout guidance receptor 2 HGNC:10250 details
hsa-miR-6844 PLP1 proteolipid protein 1 HGNC:9086 details
hsa-miR-6844 ZNF805 zinc finger protein 805 HGNC:23272 details
hsa-miR-6844 ZFP91 ZFP91 zinc finger protein, atypical E3 ubiquitin ligase HGNC:14983 details
hsa-miR-6844 ITGA8 integrin subunit alpha 8 HGNC:6144 details
hsa-miR-6844 E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-6844 RPS3 ribosomal protein S3 HGNC:10420 details
hsa-miR-6844 ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-6844 YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-6844 UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-6844 TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-6844 SYAP1 synapse associated protein 1 HGNC:16273 details
hsa-miR-6844 POC1B-GALNT4 POC1B-GALNT4 readthrough HGNC:42957 details
hsa-miR-6844 MYORG myogenesis regulating glycosidase (putative) HGNC:19918 details
hsa-miR-6844 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 HGNC:4126 details
hsa-miR-6844 DUSP8 dual specificity phosphatase 8 HGNC:3074 details
hsa-miR-6844 CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-6844 ZNF286A zinc finger protein 286A HGNC:13501 details
hsa-miR-6844 IWS1 interacts with SUPT6H, CTD assembly factor 1 HGNC:25467 details
hsa-miR-6844 ZNF286B zinc finger protein 286B (pseudogene) HGNC:33241 details
hsa-miR-6844 SLC3A2 solute carrier family 3 member 2 HGNC:11026 details
hsa-miR-6844 QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-6844 details
hsa-miR-6844 SPRY4 sprouty RTK signaling antagonist 4 HGNC:15533 details
hsa-miR-6844 SLC35B4 solute carrier family 35 member B4 HGNC:20584 details
hsa-miR-6844 OSTF1 osteoclast stimulating factor 1 HGNC:8510 details
hsa-miR-6844 HBS1L HBS1 like translational GTPase HGNC:4834 details
hsa-miR-6844 ACAA2 acetyl-CoA acyltransferase 2 HGNC:83 details
hsa-miR-6844 TG thyroglobulin HGNC:11764 details
hsa-miR-6844 ACSM2A acyl-CoA synthetase medium chain family member 2A HGNC:32017 details
hsa-miR-6844 CACNA1B calcium voltage-gated channel subunit alpha1 B HGNC:1389 details
hsa-miR-6844 PDHB pyruvate dehydrogenase E1 subunit beta HGNC:8808 details
hsa-miR-6844 IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-6844 NFKBID NFKB inhibitor delta HGNC:15671 details
hsa-miR-6844 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 HGNC:15606 details
hsa-miR-6844 TRAPPC13 trafficking protein particle complex subunit 13 HGNC:25828 details
hsa-miR-6844 ZNF747 zinc finger protein 747 HGNC:28350 details
hsa-miR-6844 WDR70 WD repeat domain 70 HGNC:25495 details
hsa-miR-6844 WDR26 WD repeat domain 26 HGNC:21208 details
hsa-miR-6844 LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-6844 TNRC6C trinucleotide repeat containing adaptor 6C HGNC:29318 details
hsa-miR-6844 SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-6844 RNF150 ring finger protein 150 HGNC:23138 details
hsa-miR-6844 PI4K2A phosphatidylinositol 4-kinase type 2 alpha HGNC:30031 details
hsa-miR-6844 PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-6844 LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-6844 LNPEP leucyl and cystinyl aminopeptidase HGNC:6656 details
hsa-miR-6844 GAN gigaxonin HGNC:4137 details
hsa-miR-6844 CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-6844 WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-6844 IP6K1 inositol hexakisphosphate kinase 1 HGNC:18360 details
hsa-miR-6844 HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-6844 A1CF APOBEC1 complementation factor HGNC:24086 details
hsa-miR-6844 CPA4 carboxypeptidase A4 HGNC:15740 details
hsa-miR-6844 TACR3 tachykinin receptor 3 HGNC:11528 details
hsa-miR-6844 EBNA1BP2 EBNA1 binding protein 2 HGNC:15531 details
hsa-miR-6844 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1 like 2 HGNC:27067 details
hsa-miR-6844 YAP1 Yes1 associated transcriptional regulator HGNC:16262 details
hsa-miR-6844 NUP210 nucleoporin 210 HGNC:30052 details
hsa-miR-6844 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-6844 CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-6844 BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-6844 ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-6844 RNF146 ring finger protein 146 HGNC:21336 details
hsa-miR-6844 SPOPL speckle type BTB/POZ protein like HGNC:27934 details
hsa-miR-6844 THBS2 thrombospondin 2 HGNC:11786 details
hsa-miR-6844 CCDC18 coiled-coil domain containing 18 HGNC:30370 details
hsa-miR-6844 details
hsa-miR-6844 PECR peroxisomal trans-2-enoyl-CoA reductase HGNC:18281 details
hsa-miR-6844 ZNF585B zinc finger protein 585B HGNC:30948 details
hsa-miR-6844 TAF2 TATA-box binding protein associated factor 2 HGNC:11536 details
hsa-miR-6844 PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-6844 SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-6844 TAL2 TAL bHLH transcription factor 2 HGNC:11557 details
hsa-miR-6844 OAF out at first homolog HGNC:28752 details
hsa-miR-6844 LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-6844 EREG epiregulin HGNC:3443 details
hsa-miR-6844 DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-6844 MEAF6 MYST/Esa1 associated factor 6 HGNC:25674 details
hsa-miR-6844 EHD3 EH domain containing 3 HGNC:3244 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab