CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-7-1-3p
Description	Homo sapiens miR-7-1 stem-loop
Comment	This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Experiment	cloned [2]
Sequence	CAACAAAUCACAGUCUGCCAUA

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr15:57229281\|57229435	hsa-miR-7-1-3p	1	1	0
chr10:84511588\|84511797	hsa-miR-7-1-3p	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr20:45421565\|45424304	hsa-miR-7-1-3p	1	0
chr19:39385542\|39385661	hsa-miR-7-1-3p	0	1
chr1:19356635\|19356751	hsa-miR-7-1-3p	0	1
chr14:91869686\|91869811	hsa-miR-7-1-3p	0	1
chr2:156584851\|156584975	hsa-miR-7-1-3p	0	1
chr3:57912566\|57912662	hsa-miR-7-1-3p	0	1
chr14:101994673\|101994818	hsa-miR-7-1-3p	0	1
chr15:63630466\|63630612	hsa-miR-7-1-3p	0	1
chr3:49725294\|49725415	hsa-miR-7-1-3p	0	1
chr22:32498471\|32498726	hsa-miR-7-1-3p	1	0
chr12:124012999\|124013210	hsa-miR-7-1-3p	0	1
chr17:57274669\|57274803	hsa-miR-7-1-3p	0	1
chr5:42718843\|42718996	hsa-miR-7-1-3p	0	1
chr20:56514455\|56514562	hsa-miR-7-1-3p	0	1
chr2:171725943\|171726081	hsa-miR-7-1-3p	0	1
chr17:41691428\|41691559	hsa-miR-7-1-3p	0	1
chr17:8478338\|8480126	hsa-miR-7-1-3p	0	1
chr19:35065901\|35066281	hsa-miR-7-1-3p	0	1
chr1:12509895\|12510115	hsa-miR-7-1-3p	0	1
chr11:95128626\|95128780	hsa-miR-7-1-3p	0	1
chr1:154963244\|154963450	hsa-miR-7-1-3p	0	1
chr10:50265530\|50265682	hsa-miR-7-1-3p	0	1
chr9:75061432\|75061567	hsa-miR-7-1-3p	0	1
chr6:81746614\|81746851	hsa-miR-7-1-3p	0	1
chr2:177217653\|177217747	hsa-miR-7-1-3p	0	1
chr2:156584841\|156584975	hsa-miR-7-1-3p	0	1
chr17:67340327\|67340484	hsa-miR-7-1-3p	0	1
chr5:42718792~42718942	hsa-miR-7-1-3p	0	1
chr17:8478338~8480126	hsa-miR-7-1-3p	0	1
chr17:8478338~8480138	hsa-miR-7-1-3p	0	1
chr10:50265468~50265682	hsa-miR-7-1-3p	0	1
chr17:8478338~8478435	hsa-miR-7-1-3p	0	1
chr15:90472981~90473798	hsa-miR-7-1-3p	0	1
chr22:31403048~31403140	hsa-miR-7-1-3p	0	1
chr7:93134060~93134174	hsa-miR-7-1-3p	0	1
chr9:134045293~134045419	hsa-miR-7-1-3p	0	1
chr1:206733056~206733168	hsa-miR-7-1-3p	0	1
chr2:98623253~98623367	hsa-miR-7-1-3p	0	1
chr1:32042122\|32042324	hsa-miR-7-1-3p	0	1
chr7:139847760\|139847952	hsa-miR-7-1-3p	0	1
chr6:159032511\|159032637	hsa-miR-7-1-3p	0	1
chr1:247201943\|247202121	hsa-miR-7-1-3p	0	1
chr1:247201952\|247202121	hsa-miR-7-1-3p	0	1
chr14:102909094\|102909353	hsa-miR-7-1-3p	0	1
chr4:142704221\|142704363	hsa-miR-7-1-3p	0	1
chr9:90895685\|90895841	hsa-miR-7-1-3p	0	1
chr16:89390489\|89390634	hsa-miR-7-1-3p	0	1
chr19:58212736\|58212914	hsa-miR-7-1-3p	0	1
chr1:206732995\|206733200	hsa-miR-7-1-3p	0	1
chr17:8578468\|8578685	hsa-miR-7-1-3p	0	1
chr10:80155678\|80155912	hsa-miR-7-1-3p	0	1
chr3:52398577\|52398718	hsa-miR-7-1-3p	0	1
chr14:39154211\|39158402	hsa-miR-7-1-3p	0	1
chr10:128013767\|128013912	hsa-miR-7-1-3p	0	1
chrX:108126817\|108127028	hsa-miR-7-1-3p	0	1
chr12:124013024\|124013194	hsa-miR-7-1-3p	0	1
chr17:42125839\|42125970	hsa-miR-7-1-3p	0	1
chr6:3304762\|3304924	hsa-miR-7-1-3p	0	1
chr20:56368384\|56368546	hsa-miR-7-1-3p	0	1
chr15:90472981\|90473798	hsa-miR-7-1-3p	0	1
chr6:33290216\|33290404	hsa-miR-7-1-3p	0	1
chr2:156584791\|156584975	hsa-miR-7-1-3p	0	1
chr22:31403048\|31403140	hsa-miR-7-1-3p	0	1
chr9:75061461\|75061567	hsa-miR-7-1-3p	0	1
chr2:32491425\|32493667	hsa-miR-7-1-3p	0	1
chr17:41691462\|41691548	hsa-miR-7-1-3p	0	1
chr17:8478338\|8478435	hsa-miR-7-1-3p	0	1
chr12:20369995\|20370156	hsa-miR-7-1-3p	0	1
chr9:12821403\|12821546	hsa-miR-7-1-3p	0	1
chr5:661436\|661647	hsa-miR-7-1-3p	0	1
chr12:30630057\|30630278	hsa-miR-7-1-3p	0	1
chr19:35065920\|35066281	hsa-miR-7-1-3p	0	1
chr21:39297564\|39297704	hsa-miR-7-1-3p	0	1
chr15:78266318\|78266496	hsa-miR-7-1-3p	0	1
chr15:63630466\|63630614	hsa-miR-7-1-3p	0	1
chr6:122724389\|122724599	hsa-miR-7-1-3p	0	1
chr1:153658805\|153659184	hsa-miR-7-1-3p	-12	1
chr12:74541048\|74541199	hsa-miR-7-1-3p	1	0
chr12:74541020\|74541199	hsa-miR-7-1-3p	1	0
chr10:50265482\|50265682	hsa-miR-7-1-3p	0	1
chr7:117964972\|117965157	hsa-miR-7-1-3p	0	1
chr5:177092685\|177092945	hsa-miR-7-1-3p	0	1
chr10:50265486\|50265682	hsa-miR-7-1-3p	0	1
chr1:206733000\|206733168	hsa-miR-7-1-3p	0	1
chrX:54011161\|54011284	hsa-miR-7-1-3p	0	1
chr12:56765828\|56766144	hsa-miR-7-1-3p	0	1
chr1:151165665\|151165789	hsa-miR-7-1-3p	0	1
chr8:74237564\|74237735	hsa-miR-7-1-3p	0	1
chr9:134045320\|134045419	hsa-miR-7-1-3p	0	1
chr4:121127239\|121127384	hsa-miR-7-1-3p	1	0
chr2:190501094\|190501219	hsa-miR-7-1-3p	1	0
chr22:32498487\|32498647	hsa-miR-7-1-3p	1	0
chr1:214350289\|214350395	hsa-miR-7-1-3p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-7-1-3p	TBC1D1	TBC1 domain family member 1	HGNC:11578	details
hsa-miR-7-1-3p	CDC5L	cell division cycle 5 like	HGNC:1743	details
hsa-miR-7-1-3p	CTC1	CST telomere replication complex component 1	HGNC:26169	details
hsa-miR-7-1-3p				details
hsa-miR-7-1-3p	ZNF792	zinc finger protein 792	HGNC:24751	details
hsa-miR-7-1-3p	HUWE1	HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1	HGNC:30892	details
hsa-miR-7-1-3p	SMS	spermine synthase	HGNC:11123	details
hsa-miR-7-1-3p	PAPOLA	poly(A) polymerase alpha	HGNC:14981	details
hsa-miR-7-1-3p	CDH6	cadherin 6	HGNC:1765	details
hsa-miR-7-1-3p	FZD5	frizzled class receptor 5	HGNC:4043	details
hsa-miR-7-1-3p	TMEM167A	transmembrane protein 167A	HGNC:28330	details
hsa-miR-7-1-3p	SAMD8	sterile alpha motif domain containing 8	HGNC:26320	details
hsa-miR-7-1-3p	ZNF354C	zinc finger protein 354C	HGNC:16736	details
hsa-miR-7-1-3p	OTUD7A	OTU deubiquitinase 7A	HGNC:20718	details
hsa-miR-7-1-3p	RAB31	RAB31, member RAS oncogene family	HGNC:9771	details
hsa-miR-7-1-3p	TMEM68	transmembrane protein 68	HGNC:26510	details
hsa-miR-7-1-3p	EIF5AL1	eukaryotic translation initiation factor 5A like 1	HGNC:17419	details
hsa-miR-7-1-3p	HMGN1	high mobility group nucleosome binding domain 1	HGNC:4984	details
hsa-miR-7-1-3p	LYPLAL1	lysophospholipase like 1	HGNC:20440	details
hsa-miR-7-1-3p	RIF1	replication timing regulatory factor 1	HGNC:23207	details
hsa-miR-7-1-3p	VEGFA	vascular endothelial growth factor A	HGNC:12680	details
hsa-miR-7-1-3p	TMEM50B	transmembrane protein 50B	HGNC:1280	details
hsa-miR-7-1-3p	SPATA13	spermatogenesis associated 13	HGNC:23222	details
hsa-miR-7-1-3p	SDC2	syndecan 2	HGNC:10659	details
hsa-miR-7-1-3p	RHOB	ras homolog family member B	HGNC:668	details
hsa-miR-7-1-3p	NCBP2	nuclear cap binding protein subunit 2	HGNC:7659	details
hsa-miR-7-1-3p	MDM4	MDM4 regulator of p53	HGNC:6974	details
hsa-miR-7-1-3p	KPNA2	karyopherin subunit alpha 2	HGNC:6395	details
hsa-miR-7-1-3p	KLF6	Kruppel like factor 6	HGNC:2235	details
hsa-miR-7-1-3p	H6PD	hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase	HGNC:4795	details
hsa-miR-7-1-3p	FGF2	fibroblast growth factor 2	HGNC:3676	details
hsa-miR-7-1-3p	DNAJB4	DnaJ heat shock protein family (Hsp40) member B4	HGNC:14886	details
hsa-miR-7-1-3p	COIL	coilin	HGNC:2184	details
hsa-miR-7-1-3p	C5orf24	chromosome 5 open reading frame 24	HGNC:26746	details
hsa-miR-7-1-3p	B4GALT1	beta-1,4-galactosyltransferase 1	HGNC:924	details
hsa-miR-7-1-3p	ANKRD40	ankyrin repeat domain 40	HGNC:28233	details
hsa-miR-7-1-3p	AKIRIN1	akirin 1	HGNC:25744	details
hsa-miR-7-1-3p	TGIF1	TGFB induced factor homeobox 1	HGNC:11776	details
hsa-miR-7-1-3p	COL4A1	collagen type IV alpha 1 chain	HGNC:2202	details
hsa-miR-7-1-3p	PTMA	prothymosin alpha	HGNC:9623	details
hsa-miR-7-1-3p	CBWD1	COBW domain containing 1	HGNC:17134	details
hsa-miR-7-1-3p	CBWD5	COBW domain containing 5	HGNC:24584	details
hsa-miR-7-1-3p	ZNF460	zinc finger protein 460	HGNC:21628	details
hsa-miR-7-1-3p	TRIM37	tripartite motif containing 37	HGNC:7523	details
hsa-miR-7-1-3p	TP53INP1	tumor protein p53 inducible nuclear protein 1	HGNC:18022	details
hsa-miR-7-1-3p	THBS1	thrombospondin 1	HGNC:11785	details
hsa-miR-7-1-3p				details
hsa-miR-7-1-3p	NPM3	nucleophosmin/nucleoplasmin 3	HGNC:7931	details
hsa-miR-7-1-3p	COPS8	COP9 signalosome subunit 8	HGNC:24335	details
hsa-miR-7-1-3p	PRNP	prion protein	HGNC:9449	details
hsa-miR-7-1-3p	HSP90AA1	heat shock protein 90 alpha family class A member 1	HGNC:5253	details
hsa-miR-7-1-3p	HMGN2	high mobility group nucleosomal binding domain 2	HGNC:4986	details
hsa-miR-7-1-3p	CASP16P	caspase 16, pseudogene	HGNC:27290	details
hsa-miR-7-1-3p	SSU72	SSU72 homolog, RNA polymerase II CTD phosphatase	HGNC:25016	details
hsa-miR-7-1-3p	ZBTB47	zinc finger and BTB domain containing 47	HGNC:26955	details
hsa-miR-7-1-3p	SPRED1	sprouty related EVH1 domain containing 1	HGNC:20249	details
hsa-miR-7-1-3p	PNISR	PNN interacting serine and arginine rich protein	HGNC:21222	details
hsa-miR-7-1-3p	EVI5	ecotropic viral integration site 5	HGNC:3501	details
hsa-miR-7-1-3p	CRLF3	cytokine receptor like factor 3	HGNC:17177	details
hsa-miR-7-1-3p	BRIX1	biogenesis of ribosomes BRX1	HGNC:24170	details
hsa-miR-7-1-3p	TUBGCP4	tubulin gamma complex associated protein 4	HGNC:16691	details
hsa-miR-7-1-3p	FSIP2	fibrous sheath interacting protein 2	HGNC:21675	details
hsa-miR-7-1-3p	MTRNR2L7	MT-RNR2 like 7	HGNC:37164	details
hsa-miR-7-1-3p	MTRNR2L3	MT-RNR2 like 3	HGNC:37157	details
hsa-miR-7-1-3p	ABCC4	ATP binding cassette subfamily C member 4	HGNC:55	details
hsa-miR-7-1-3p	DNAJC21	DnaJ heat shock protein family (Hsp40) member C21	HGNC:27030	details
hsa-miR-7-1-3p	ACBD7	acyl-CoA binding domain containing 7	HGNC:17715	details
hsa-miR-7-1-3p				details
hsa-miR-7-1-3p	GALNT8	polypeptide N-acetylgalactosaminyltransferase 8	HGNC:4130	details
hsa-miR-7-1-3p	QSER1	glutamine and serine rich 1	HGNC:26154	details
hsa-miR-7-1-3p	PHLPP1	PH domain and leucine rich repeat protein phosphatase 1	HGNC:20610	details
hsa-miR-7-1-3p	NLGN4X	neuroligin 4 X-linked	HGNC:14287	details
hsa-miR-7-1-3p	MTRNR2L11	MT-RNR2 like 11	HGNC:37168	details
hsa-miR-7-1-3p	MTRNR2L10	MT-RNR2 like 10	HGNC:37167	details
hsa-miR-7-1-3p	LIFR	LIF receptor subunit alpha	HGNC:6597	details
hsa-miR-7-1-3p	HMBOX1	homeobox containing 1	HGNC:26137	details
hsa-miR-7-1-3p	CPEB2	cytoplasmic polyadenylation element binding protein 2	HGNC:21745	details
hsa-miR-7-1-3p	CABLES1	Cdk5 and Abl enzyme substrate 1	HGNC:25097	details
hsa-miR-7-1-3p	AREL1	apoptosis resistant E3 ubiquitin protein ligase 1	HGNC:20363	details
hsa-miR-7-1-3p	AGO2	argonaute RISC catalytic component 2	HGNC:3263	details
hsa-miR-7-1-3p	CBX4	chromobox 4	HGNC:1554	details
hsa-miR-7-1-3p	SLC25A46	solute carrier family 25 member 46	HGNC:25198	details
hsa-miR-7-1-3p	HSPA1B	heat shock protein family A (Hsp70) member 1B	HGNC:5233	details
hsa-miR-7-1-3p	ACTB	actin beta	HGNC:132	details
hsa-miR-7-1-3p	SKA2	spindle and kinetochore associated complex subunit 2	HGNC:28006	details
hsa-miR-7-1-3p	TAB2	TGF-beta activated kinase 1 (MAP3K7) binding protein 2	HGNC:17075	details
hsa-miR-7-1-3p	ADAMTS9	ADAM metallopeptidase with thrombospondin type 1 motif 9	HGNC:13202	details
hsa-miR-7-1-3p	SC5D	sterol-C5-desaturase	HGNC:10547	details
hsa-miR-7-1-3p	RAB1A	RAB1A, member RAS oncogene family	HGNC:9758	details
hsa-miR-7-1-3p	RAB10	RAB10, member RAS oncogene family	HGNC:9759	details
hsa-miR-7-1-3p	NUFIP2	nuclear FMR1 interacting protein 2	HGNC:17634	details
hsa-miR-7-1-3p	MFAP3	microfibril associated protein 3	HGNC:7034	details
hsa-miR-7-1-3p	DSN1	DSN1 component of MIS12 kinetochore complex	HGNC:16165	details
hsa-miR-7-1-3p	PVR	PVR cell adhesion molecule	HGNC:9705	details
hsa-miR-7-1-3p	EPB41L4B	erythrocyte membrane protein band 4.1 like 4B	HGNC:19818	details
hsa-miR-7-1-3p	ACTA1	actin alpha 1, skeletal muscle	HGNC:129	details
hsa-miR-7-1-3p	EMB	embigin	HGNC:30465	details
hsa-miR-7-1-3p	VMA21	vacuolar ATPase assembly factor VMA21	HGNC:22082	details
hsa-miR-7-1-3p	PCMT1	protein-L-isoaspartate (D-aspartate) O-methyltransferase	HGNC:8728	details
hsa-miR-7-1-3p	LDLR	low density lipoprotein receptor	HGNC:6547	details
hsa-miR-7-1-3p	ARPP19	cAMP regulated phosphoprotein 19	HGNC:16967	details
hsa-miR-7-1-3p	SF1	splicing factor 1	HGNC:12950	details
hsa-miR-7-1-3p	ARL8A	ADP ribosylation factor like GTPase 8A	HGNC:25192	details
hsa-miR-7-1-3p	MOCS2	molybdenum cofactor synthesis 2	HGNC:7193	details
hsa-miR-7-1-3p	PFDN2	prefoldin subunit 2	HGNC:8867	details
hsa-miR-7-1-3p	ALYREF	Aly/REF export factor	HGNC:19071	details
hsa-miR-7-1-3p	ZNF703	zinc finger protein 703	HGNC:25883	details
hsa-miR-7-1-3p	TMEM170B	transmembrane protein 170B	HGNC:34244	details
hsa-miR-7-1-3p	PHF13	PHD finger protein 13	HGNC:22983	details
hsa-miR-7-1-3p	MLLT10	MLLT10 histone lysine methyltransferase DOT1L cofactor	HGNC:16063	details
hsa-miR-7-1-3p	LBR	lamin B receptor	HGNC:6518	details
hsa-miR-7-1-3p	KLHL15	kelch like family member 15	HGNC:29347	details
hsa-miR-7-1-3p	CHSY1	chondroitin sulfate synthase 1	HGNC:17198	details
hsa-miR-7-1-3p	PPM1B	protein phosphatase, Mg2+/Mn2+ dependent 1B	HGNC:9276	details
hsa-miR-7-1-3p	KIAA1549L	KIAA1549 like	HGNC:24836	details
hsa-miR-7-1-3p	ZNF724	zinc finger protein 724	HGNC:32460	details
hsa-miR-7-1-3p	TWIST1	twist family bHLH transcription factor 1	HGNC:12428	details
hsa-miR-7-1-3p	TNPO1	transportin 1	HGNC:6401	details
hsa-miR-7-1-3p	KCNB1	potassium voltage-gated channel subfamily B member 1	HGNC:6231	details
hsa-miR-7-1-3p	ITGA1	integrin subunit alpha 1	HGNC:6134	details
hsa-miR-7-1-3p	ADAMTS5	ADAM metallopeptidase with thrombospondin type 1 motif 5	HGNC:221	details
hsa-miR-7-1-3p	ACTR1A	actin related protein 1A	HGNC:167	details
hsa-miR-7-1-3p	TNPO2	transportin 2	HGNC:19998	details
hsa-miR-7-1-3p	PCNT	pericentrin	HGNC:16068	details
hsa-miR-7-1-3p	MTSS1	MTSS I-BAR domain containing 1	HGNC:20443	details
hsa-miR-7-1-3p	CRLS1	cardiolipin synthase 1	HGNC:16148	details
hsa-miR-7-1-3p	HOXD12	homeobox D12	HGNC:5135	details
hsa-miR-7-1-3p	SIX3	SIX homeobox 3	HGNC:10889	details
hsa-miR-7-1-3p	FFAR4	free fatty acid receptor 4	HGNC:19061	details
hsa-miR-7-1-3p	DERL2	derlin 2	HGNC:17943	details
hsa-miR-7-1-3p	SNX24	sorting nexin 24	HGNC:21533	details
hsa-miR-7-1-3p	ZNF736	zinc finger protein 736	HGNC:32467	details
hsa-miR-7-1-3p	HIPK1	homeodomain interacting protein kinase 1	HGNC:19006	details
hsa-miR-7-1-3p	ATP7A	ATPase copper transporting alpha	HGNC:869	details
hsa-miR-7-1-3p	ZNF740	zinc finger protein 740	HGNC:27465	details
hsa-miR-7-1-3p	PAK3	p21 (RAC1) activated kinase 3	HGNC:8592	details
hsa-miR-7-1-3p	ZNF644	zinc finger protein 644	HGNC:29222	details
hsa-miR-7-1-3p	LIMD1	LIM domain containing 1	HGNC:6612	details
hsa-miR-7-1-3p	LMAN1	lectin, mannose binding 1	HGNC:6631	details
hsa-miR-7-1-3p	ZBTB37	zinc finger and BTB domain containing 37	HGNC:28365	details
hsa-miR-7-1-3p	TOP2A	DNA topoisomerase II alpha	HGNC:11989	details
hsa-miR-7-1-3p	HS2ST1	heparan sulfate 2-O-sulfotransferase 1	HGNC:5193	details
hsa-miR-7-1-3p	WNK1	WNK lysine deficient protein kinase 1	HGNC:14540	details
hsa-miR-7-1-3p	WASL	WASP like actin nucleation promoting factor	HGNC:12735	details
hsa-miR-7-1-3p	TOR1AIP1	torsin 1A interacting protein 1	HGNC:29456	details
hsa-miR-7-1-3p				details
hsa-miR-7-1-3p	OCRL	OCRL inositol polyphosphate-5-phosphatase	HGNC:8108	details
hsa-miR-7-1-3p	HEXIM1	HEXIM P-TEFb complex subunit 1	HGNC:24953	details
hsa-miR-7-1-3p	SELENOI	selenoprotein I	HGNC:29361	details
hsa-miR-7-1-3p	CNBP	CCHC-type zinc finger nucleic acid binding protein	HGNC:13164	details
hsa-miR-7-1-3p	BAHD1	bromo adjacent homology domain containing 1	HGNC:29153	details
hsa-miR-7-1-3p	TTYH3	tweety family member 3	HGNC:22222	details
hsa-miR-7-1-3p	KIAA1107	KIAA1107	HGNC:29192	details
hsa-miR-7-1-3p				details
hsa-miR-7-1-3p	XRCC2	X-ray repair cross complementing 2	HGNC:12829	details
hsa-miR-7-1-3p	ZBTB8B	zinc finger and BTB domain containing 8B	HGNC:37057	details
hsa-miR-7-1-3p	DGKI	diacylglycerol kinase iota	HGNC:2855	details
hsa-miR-7-1-3p	MATN1	matrilin 1	HGNC:6907	details
hsa-miR-7-1-3p	VGLL4	vestigial like family member 4	HGNC:28966	details
hsa-miR-7-1-3p	MYEF2	myelin expression factor 2	HGNC:17940	details
hsa-miR-7-1-3p	PCLO	piccolo presynaptic cytomatrix protein	HGNC:13406	details
hsa-miR-7-1-3p	NGDN	neuroguidin	HGNC:20271	details
hsa-miR-7-1-3p	SREBF1	sterol regulatory element binding transcription factor 1	HGNC:11289	details
hsa-miR-7-1-3p	PABPC1	poly(A) binding protein cytoplasmic 1	HGNC:8554	details
hsa-miR-7-1-3p	IL15	interleukin 15	HGNC:5977	details
hsa-miR-7-1-3p	EGFR	epidermal growth factor receptor	HGNC:3236	details
hsa-miR-7-1-3p	IGF1R	insulin like growth factor 1 receptor	HGNC:5465	details
hsa-miR-7-1-3p	RAF1	Raf-1 proto-oncogene, serine/threonine kinase	HGNC:9829	details
hsa-miR-7-1-3p	KCNJ2	potassium inwardly rectifying channel subfamily J member 2	HGNC:6263	details
hsa-miR-7-1-3p	C4orf46	chromosome 4 open reading frame 46	HGNC:27320	details
hsa-miR-7-1-3p	ELL	elongation factor for RNA polymerase II	HGNC:23114	details
hsa-miR-7-1-3p	TIMM50	translocase of inner mitochondrial membrane 50	HGNC:23656	details
hsa-miR-7-1-3p	ARL10	ADP ribosylation factor like GTPase 10	HGNC:22042	details
hsa-miR-7-1-3p	CCDC141	coiled-coil domain containing 141	HGNC:26821	details
hsa-miR-7-1-3p	CRK	CRK proto-oncogene, adaptor protein	HGNC:2362	details
hsa-miR-7-1-3p	DGKB	diacylglycerol kinase beta	HGNC:2850	details
hsa-miR-7-1-3p	EEF2K	eukaryotic elongation factor 2 kinase	HGNC:24615	details
hsa-miR-7-1-3p	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-miR-7-1-3p	HNRNPA3	heterogeneous nuclear ribonucleoprotein A3	HGNC:24941	details
hsa-miR-7-1-3p	HNRNPC	heterogeneous nuclear ribonucleoprotein C	HGNC:5035	details
hsa-miR-7-1-3p	MAMLD1	mastermind like domain containing 1	HGNC:2568	details
hsa-miR-7-1-3p	ACTC1	actin alpha cardiac muscle 1	HGNC:143	details
hsa-miR-7-1-3p	MTMR9	myotubularin related protein 9	HGNC:14596	details
hsa-miR-7-1-3p	COPS7B	COP9 signalosome subunit 7B	HGNC:16760	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)