miRNA Card

miRNA General Information
miRNA ID hsa-miR-7-2-3p
Description Homo sapiens miR-7-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Experiment cloned [2]
Sequence CAACAAAUCCCAGUCUACCUAA
miRNA Expression in different cancers

    by mir_boxplot.py


circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:31163415|31163564 hsa-miR-7-2-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:45523681|45524142 hsa-miR-7-2-3p 0 1 0
chr1:43317331|43317610 hsa-miR-7-2-3p 0 1 0
chr14:101994673|101994818 hsa-miR-7-2-3p 0 1 0
chr12:56319323|56319487 hsa-miR-7-2-3p 0 1 0
chr15:63630466|63630612 hsa-miR-7-2-3p 0 1 0
chr12:50222209|50222321 hsa-miR-7-2-3p 0 1 0
chr12:50222209|50222304 hsa-miR-7-2-3p 0 1 0
chr1:12509895|12510115 hsa-miR-7-2-3p 0 1 0
chr12:50222259|50222452 hsa-miR-7-2-3p 0 1 0
chr16:57472188|57472466 hsa-miR-7-2-3p 0 1 0
chr16:634516|634644 hsa-miR-7-2-3p 0 1 0
chr9:75061432|75061567 hsa-miR-7-2-3p 0 1 0
chr2:240455172|240455362 hsa-miR-7-2-3p 0 1 0
chr11:60900582|60900691 hsa-miR-7-2-3p 0 1 0
chr12:50222209~50222304 hsa-miR-7-2-3p 0 1 0
chr15:90472981~90473798 hsa-miR-7-2-3p 0 1 0
chr19:45523681~45524142 hsa-miR-7-2-3p 0 1 0
chr16:634516~634644 hsa-miR-7-2-3p 0 1 0
chr12:50222209~50222321 hsa-miR-7-2-3p 0 1 0
chr22:42209701~42209805 hsa-miR-7-2-3p 0 1 0
chr11:65237149|65237323 hsa-miR-7-2-3p 0 1 0
chr4:17625160|17625360 hsa-miR-7-2-3p 0 1 0
chr1:33009553|33009802 hsa-miR-7-2-3p 0 1 0
chr19:9730928|9731028 hsa-miR-7-2-3p 0 1 0
chr22:38699067|38699188 hsa-miR-7-2-3p 0 1 0
chr17:75795595|75795706 hsa-miR-7-2-3p 1 0 0
chrX:65704621|65704770 hsa-miR-7-2-3p 0 1 0
chr11:60900600|60900929 hsa-miR-7-2-3p 0 1 0
chr14:102909094|102909353 hsa-miR-7-2-3p 0 1 0
chr9:90895685|90895841 hsa-miR-7-2-3p 0 1 0
chr16:89390489|89390634 hsa-miR-7-2-3p 0 1 0
chr11:118748883|118749139 hsa-miR-7-2-3p 1 0 0
chr17:8578468|8578685 hsa-miR-7-2-3p 0 1 0
chr3:52398577|52398718 hsa-miR-7-2-3p 0 1 0
chr20:49114662|49114771 hsa-miR-7-2-3p 0 1 0
chr6:3304762|3304924 hsa-miR-7-2-3p 0 1 0
chr15:90472981|90473798 hsa-miR-7-2-3p 0 1 0
chr9:129632703|129632801 hsa-miR-7-2-3p 0 1 0
chr6:33290216|33290404 hsa-miR-7-2-3p 0 1 0
chr10:84511588|84511797 hsa-miR-7-2-3p 0 1 0
chr9:75061461|75061567 hsa-miR-7-2-3p 0 1 0
chr2:32491425|32493667 hsa-miR-7-2-3p 0 1 0
chr1:154957652|154957823 hsa-miR-7-2-3p 0 1 0
chrX:47571631|47571760 hsa-miR-7-2-3p 0 1 0
chr16:23466311|23466446 hsa-miR-7-2-3p 0 1 0
chr16:23466290|23466422 hsa-miR-7-2-3p 0 1 0
chr15:63630466|63630614 hsa-miR-7-2-3p 0 1 0
chr17:36743120|36743226 hsa-miR-7-2-3p 0 1 0
chr19:7908473|7908614 hsa-miR-7-2-3p 1 0 0
chr16:11549407|11549558 hsa-miR-7-2-3p 0 1 0
chr9:129632655|129632801 hsa-miR-7-2-3p 0 1 0
chr20:3870777|3870885 hsa-miR-7-2-3p 0 1 0
chr20:43585534|43585680 hsa-miR-7-2-3p 0 1 0
chr20:49114573|49114723 hsa-miR-7-2-3p 0 1 0
chr9:129632682|129632801 hsa-miR-7-2-3p 0 1 0
chr4:150582223|150582394 hsa-miR-7-2-3p 0 1 0
chr3:152838565|152838721 hsa-miR-7-2-3p 0 1 0
chr20:46684591|46684808 hsa-miR-7-2-3p 0 1 0
chr9:129632650|129632801 hsa-miR-7-2-3p 0 1 0
chr12:50222209|50222346 hsa-miR-7-2-3p 0 1 0
chrX:54011161|54011284 hsa-miR-7-2-3p 0 1 0
chr4:154569649|154569799 hsa-miR-7-2-3p 0 1 0
chr11:111913872|111914006 hsa-miR-7-2-3p 0 1 0
chr1:151165665|151165789 hsa-miR-7-2-3p 0 1 0
chr8:74237564|74237735 hsa-miR-7-2-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-7-2-3p PAPOLA poly(A) polymerase alpha HGNC:14981 details
hsa-miR-7-2-3p FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-7-2-3p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-7-2-3p ZNF354C zinc finger protein 354C HGNC:16736 details
hsa-miR-7-2-3p OTUD7A OTU deubiquitinase 7A HGNC:20718 details
hsa-miR-7-2-3p RAB31 RAB31, member RAS oncogene family HGNC:9771 details
hsa-miR-7-2-3p TMEM68 transmembrane protein 68 HGNC:26510 details
hsa-miR-7-2-3p EIF5AL1 eukaryotic translation initiation factor 5A like 1 HGNC:17419 details
hsa-miR-7-2-3p HMGN1 high mobility group nucleosome binding domain 1 HGNC:4984 details
hsa-miR-7-2-3p LYPLAL1 lysophospholipase like 1 HGNC:20440 details
hsa-miR-7-2-3p RIF1 replication timing regulatory factor 1 HGNC:23207 details
hsa-miR-7-2-3p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-7-2-3p TMEM50B transmembrane protein 50B HGNC:1280 details
hsa-miR-7-2-3p SPATA13 spermatogenesis associated 13 HGNC:23222 details
hsa-miR-7-2-3p SDC2 syndecan 2 HGNC:10659 details
hsa-miR-7-2-3p RHOB ras homolog family member B HGNC:668 details
hsa-miR-7-2-3p NCBP2 nuclear cap binding protein subunit 2 HGNC:7659 details
hsa-miR-7-2-3p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-7-2-3p KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-7-2-3p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-7-2-3p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-7-2-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-7-2-3p DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-7-2-3p COIL coilin HGNC:2184 details
hsa-miR-7-2-3p C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-7-2-3p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-7-2-3p ANKRD40 ankyrin repeat domain 40 HGNC:28233 details
hsa-miR-7-2-3p AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-7-2-3p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-7-2-3p COL4A1 collagen type IV alpha 1 chain HGNC:2202 details
hsa-miR-7-2-3p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-7-2-3p CBWD1 COBW domain containing 1 HGNC:17134 details
hsa-miR-7-2-3p CBWD5 COBW domain containing 5 HGNC:24584 details
hsa-miR-7-2-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-7-2-3p TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-7-2-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-7-2-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-7-2-3p details
hsa-miR-7-2-3p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-7-2-3p COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-7-2-3p PRNP prion protein HGNC:9449 details
hsa-miR-7-2-3p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-7-2-3p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-7-2-3p CASP16P caspase 16, pseudogene HGNC:27290 details
hsa-miR-7-2-3p SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-7-2-3p ZBTB47 zinc finger and BTB domain containing 47 HGNC:26955 details
hsa-miR-7-2-3p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-7-2-3p PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-7-2-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-7-2-3p CRLF3 cytokine receptor like factor 3 HGNC:17177 details
hsa-miR-7-2-3p BRIX1 biogenesis of ribosomes BRX1 HGNC:24170 details
hsa-miR-7-2-3p TUBGCP4 tubulin gamma complex associated protein 4 HGNC:16691 details
hsa-miR-7-2-3p FSIP2 fibrous sheath interacting protein 2 HGNC:21675 details
hsa-miR-7-2-3p MTRNR2L7 MT-RNR2 like 7 HGNC:37164 details
hsa-miR-7-2-3p MTRNR2L3 MT-RNR2 like 3 HGNC:37157 details
hsa-miR-7-2-3p ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-miR-7-2-3p DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 HGNC:27030 details
hsa-miR-7-2-3p ACBD7 acyl-CoA binding domain containing 7 HGNC:17715 details
hsa-miR-7-2-3p details
hsa-miR-7-2-3p GALNT8 polypeptide N-acetylgalactosaminyltransferase 8 HGNC:4130 details
hsa-miR-7-2-3p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-7-2-3p PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 HGNC:20610 details
hsa-miR-7-2-3p NLGN4X neuroligin 4 X-linked HGNC:14287 details
hsa-miR-7-2-3p MTRNR2L11 MT-RNR2 like 11 HGNC:37168 details
hsa-miR-7-2-3p MTRNR2L10 MT-RNR2 like 10 HGNC:37167 details
hsa-miR-7-2-3p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-7-2-3p HMBOX1 homeobox containing 1 HGNC:26137 details
hsa-miR-7-2-3p CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-7-2-3p CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-7-2-3p AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 HGNC:20363 details
hsa-miR-7-2-3p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-7-2-3p CBX4 chromobox 4 HGNC:1554 details
hsa-miR-7-2-3p SLC25A46 solute carrier family 25 member 46 HGNC:25198 details
hsa-miR-7-2-3p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-7-2-3p ACTB actin beta HGNC:132 details
hsa-miR-7-2-3p SKA2 spindle and kinetochore associated complex subunit 2 HGNC:28006 details
hsa-miR-7-2-3p TAB2 TGF-beta activated kinase 1 (MAP3K7) binding protein 2 HGNC:17075 details
hsa-miR-7-2-3p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-7-2-3p SC5D sterol-C5-desaturase HGNC:10547 details
hsa-miR-7-2-3p RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-7-2-3p RAB10 RAB10, member RAS oncogene family HGNC:9759 details
hsa-miR-7-2-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-7-2-3p MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-7-2-3p DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-7-2-3p PVR PVR cell adhesion molecule HGNC:9705 details
hsa-miR-7-2-3p EPB41L4B erythrocyte membrane protein band 4.1 like 4B HGNC:19818 details
hsa-miR-7-2-3p ACTA1 actin alpha 1, skeletal muscle HGNC:129 details
hsa-miR-7-2-3p EMB embigin HGNC:30465 details
hsa-miR-7-2-3p VMA21 vacuolar ATPase assembly factor VMA21 HGNC:22082 details
hsa-miR-7-2-3p PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase HGNC:8728 details
hsa-miR-7-2-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-7-2-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-7-2-3p SF1 splicing factor 1 HGNC:12950 details
hsa-miR-7-2-3p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-7-2-3p MOCS2 molybdenum cofactor synthesis 2 HGNC:7193 details
hsa-miR-7-2-3p PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-7-2-3p ALYREF Aly/REF export factor HGNC:19071 details
hsa-miR-7-2-3p ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-7-2-3p TMEM170B transmembrane protein 170B HGNC:34244 details
hsa-miR-7-2-3p PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-7-2-3p MLLT10 MLLT10 histone lysine methyltransferase DOT1L cofactor HGNC:16063 details
hsa-miR-7-2-3p LBR lamin B receptor HGNC:6518 details
hsa-miR-7-2-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-7-2-3p CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-7-2-3p PPM1B protein phosphatase, Mg2+/Mn2+ dependent 1B HGNC:9276 details
hsa-miR-7-2-3p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-7-2-3p KIAA1549L KIAA1549 like HGNC:24836 details
hsa-miR-7-2-3p ZNF724 zinc finger protein 724 HGNC:32460 details
hsa-miR-7-2-3p TWIST1 twist family bHLH transcription factor 1 HGNC:12428 details
hsa-miR-7-2-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-7-2-3p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-7-2-3p ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-7-2-3p ACTR1A actin related protein 1A HGNC:167 details
hsa-miR-7-2-3p TNPO2 transportin 2 HGNC:19998 details
hsa-miR-7-2-3p PCNT pericentrin HGNC:16068 details
hsa-miR-7-2-3p MTSS1 MTSS I-BAR domain containing 1 HGNC:20443 details
hsa-miR-7-2-3p CRLS1 cardiolipin synthase 1 HGNC:16148 details
hsa-miR-7-2-3p HOXD12 homeobox D12 HGNC:5135 details
hsa-miR-7-2-3p SIX3 SIX homeobox 3 HGNC:10889 details
hsa-miR-7-2-3p FFAR4 free fatty acid receptor 4 HGNC:19061 details
hsa-miR-7-2-3p DERL2 derlin 2 HGNC:17943 details
hsa-miR-7-2-3p SNX24 sorting nexin 24 HGNC:21533 details
hsa-miR-7-2-3p ZNF736 zinc finger protein 736 HGNC:32467 details
hsa-miR-7-2-3p HIPK1 homeodomain interacting protein kinase 1 HGNC:19006 details
hsa-miR-7-2-3p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-7-2-3p ZNF740 zinc finger protein 740 HGNC:27465 details
hsa-miR-7-2-3p PAK3 p21 (RAC1) activated kinase 3 HGNC:8592 details
hsa-miR-7-2-3p ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-7-2-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-7-2-3p LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-7-2-3p ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-7-2-3p TOP2A DNA topoisomerase II alpha HGNC:11989 details
hsa-miR-7-2-3p HS2ST1 heparan sulfate 2-O-sulfotransferase 1 HGNC:5193 details
hsa-miR-7-2-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-7-2-3p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-7-2-3p TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-7-2-3p details
hsa-miR-7-2-3p OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-7-2-3p HEXIM1 HEXIM P-TEFb complex subunit 1 HGNC:24953 details
hsa-miR-7-2-3p SELENOI selenoprotein I HGNC:29361 details
hsa-miR-7-2-3p CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-7-2-3p BAHD1 bromo adjacent homology domain containing 1 HGNC:29153 details
hsa-miR-7-2-3p TTYH3 tweety family member 3 HGNC:22222 details
hsa-miR-7-2-3p KIAA1107 KIAA1107 HGNC:29192 details
hsa-miR-7-2-3p details
hsa-miR-7-2-3p XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-7-2-3p ZBTB8B zinc finger and BTB domain containing 8B HGNC:37057 details
hsa-miR-7-2-3p DGKI diacylglycerol kinase iota HGNC:2855 details
hsa-miR-7-2-3p MATN1 matrilin 1 HGNC:6907 details
hsa-miR-7-2-3p VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-7-2-3p MYEF2 myelin expression factor 2 HGNC:17940 details
hsa-miR-7-2-3p PCLO piccolo presynaptic cytomatrix protein HGNC:13406 details
hsa-miR-7-2-3p NGDN neuroguidin HGNC:20271 details
hsa-miR-7-2-3p SREBF1 sterol regulatory element binding transcription factor 1 HGNC:11289 details
hsa-miR-7-2-3p PABPC1 poly(A) binding protein cytoplasmic 1 HGNC:8554 details
hsa-miR-7-2-3p IL15 interleukin 15 HGNC:5977 details
hsa-miR-7-2-3p C4orf46 chromosome 4 open reading frame 46 HGNC:27320 details
hsa-miR-7-2-3p ELL elongation factor for RNA polymerase II HGNC:23114 details
hsa-miR-7-2-3p TIMM50 translocase of inner mitochondrial membrane 50 HGNC:23656 details
hsa-miR-7-2-3p ARL10 ADP ribosylation factor like GTPase 10 HGNC:22042 details
hsa-miR-7-2-3p CCDC141 coiled-coil domain containing 141 HGNC:26821 details
hsa-miR-7-2-3p CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-7-2-3p DGKB diacylglycerol kinase beta HGNC:2850 details
hsa-miR-7-2-3p EEF2K eukaryotic elongation factor 2 kinase HGNC:24615 details
hsa-miR-7-2-3p GABPB1 GA binding protein transcription factor subunit beta 1 HGNC:4074 details
hsa-miR-7-2-3p HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 HGNC:24941 details
hsa-miR-7-2-3p HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-7-2-3p MAMLD1 mastermind like domain containing 1 HGNC:2568 details
hsa-miR-7-2-3p ACTC1 actin alpha cardiac muscle 1 HGNC:143 details
hsa-miR-7-2-3p MTMR9 myotubularin related protein 9 HGNC:14596 details
hsa-miR-7-2-3p COPS7B COP9 signalosome subunit 7B HGNC:16760 details