miRNA Card

miRNA General Information
miRNA ID hsa-miR-8061
Description Homo sapiens miR-8061 stem-loop
Comment None
Experiment Illumina [1]
Sequence CUUAGAUUAGAGGAUAUUGUU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr17:44352873|44353002 hsa-miR-8061 0 1 0
chr13:75857817|75857950 hsa-miR-8061 0 1 0
chr2:96272145|96272353 hsa-miR-8061 0 1 0
chr1:1756258|1756608 hsa-miR-8061 0 1 0
chr22:45844402|45844490 hsa-miR-8061 0 1 0
chr7:139301221|139301343 hsa-miR-8061 0 1 0
chr1:226146136|226146308 hsa-miR-8061 0 1 0
chr7:142301047|142301175 hsa-miR-8061 0 1 0
chr12:46186359|46186495 hsa-miR-8061 0 1 0
chr3:121663726|121663901 hsa-miR-8061 0 1 0
chr3:196348026|196348177 hsa-miR-8061 0 1 0
chr11:70378050|70382109 hsa-miR-8061 0 1 0
chr17:44352873~44353002 hsa-miR-8061 0 1 0
chr3:121663726~121663860 hsa-miR-8061 0 1 0
chr11:70378053~70382109 hsa-miR-8061 0 1 0
chr3:121663726~121663848 hsa-miR-8061 0 1 0
chr17:44352804~44352949 hsa-miR-8061 0 1 0
chr20:34710385|34710557 hsa-miR-8061 1 0 0
chr2:112648817|112649010 hsa-miR-8061 0 1 0
chr3:111664683|111664837 hsa-miR-8061 0 1 0
chr17:10172179|10172318 hsa-miR-8061 0 1 0
chr5:38935341|38935468 hsa-miR-8061 0 1 0
chr16:23670170|23670289 hsa-miR-8061 0 1 0
chr3:121663726|121663946 hsa-miR-8061 0 1 0
chr20:45841302|45841410 hsa-miR-8061 0 1 0
chr1:1756258|1756568 hsa-miR-8061 0 1 0
chr17:44352873|44352949 hsa-miR-8061 0 1 0
chr16:11846501|11847806 hsa-miR-8061 0 1 0
chr2:15394227|15427794 hsa-miR-8061 0 1 0
chr19:36465999|36466121 hsa-miR-8061 0 1 0
chr20:38921940|38922013 hsa-miR-8061 0 1 0
chr2:65021786|65021889 hsa-miR-8061 0 1 0
chr12:50213067|50213334 hsa-miR-8061 0 1 0
chr2:96272161|96272353 hsa-miR-8061 0 1 0
chr1:226145949|226146308 hsa-miR-8061 0 1 0
chr20:17518726|17518833 hsa-miR-8061 0 1 0
chr2:65021744|65021861 hsa-miR-8061 0 1 0
chr6:136557187|136557366 hsa-miR-8061 0 1 0
chr3:121663726|121663920 hsa-miR-8061 0 1 0
chr4:53080126|53080285 hsa-miR-8061 -9 1 0
chr17:75136198|75147653 hsa-miR-8061 0 1 0
chr3:121663726|121663860 hsa-miR-8061 0 1 0
chr3:31636272|31636425 hsa-miR-8061 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-8061 DENND5B DENN domain containing 5B HGNC:28338 details
hsa-miR-8061 ATP6V1G1 ATPase H+ transporting V1 subunit G1 HGNC:864 details
hsa-miR-8061 PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-8061 ZNF74 zinc finger protein 74 HGNC:13144 details
hsa-miR-8061 RWDD2A RWD domain containing 2A HGNC:21385 details
hsa-miR-8061 ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-8061 STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-8061 RBPJ recombination signal binding protein for immunoglobulin kappa J region HGNC:5724 details
hsa-miR-8061 POLI DNA polymerase iota HGNC:9182 details
hsa-miR-8061 details
hsa-miR-8061 PTMA prothymosin alpha HGNC:9623 details
hsa-miR-8061 details
hsa-miR-8061 FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-8061 SRSF4 serine and arginine rich splicing factor 4 HGNC:10786 details
hsa-miR-8061 CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-8061 WSB2 WD repeat and SOCS box containing 2 HGNC:19222 details
hsa-miR-8061 POF1B POF1B actin binding protein HGNC:13711 details
hsa-miR-8061 SOX11 SRY-box transcription factor 11 HGNC:11191 details
hsa-miR-8061 PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-8061 IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-8061 RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-8061 GTF2E1 general transcription factor IIE subunit 1 HGNC:4650 details
hsa-miR-8061 PM20D2 peptidase M20 domain containing 2 HGNC:21408 details
hsa-miR-8061 VMA21 vacuolar ATPase assembly factor VMA21 HGNC:22082 details
hsa-miR-8061 GDAP2 ganglioside induced differentiation associated protein 2 HGNC:18010 details
hsa-miR-8061 EPHA7 EPH receptor A7 HGNC:3390 details
hsa-miR-8061 NAXD NAD(P)HX dehydratase HGNC:25576 details
hsa-miR-8061 UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-8061 SLAIN2 SLAIN motif family member 2 HGNC:29282 details
hsa-miR-8061 ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-8061 YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-8061 TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-8061 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-8061 ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-8061 APOOL apolipoprotein O like HGNC:24009 details
hsa-miR-8061 ALKBH5 alkB homolog 5, RNA demethylase HGNC:25996 details
hsa-miR-8061 MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-8061 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 HGNC:9385 details
hsa-miR-8061 ANXA4 annexin A4 HGNC:542 details
hsa-miR-8061 DAB2 DAB adaptor protein 2 HGNC:2662 details
hsa-miR-8061 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 HGNC:24048 details
hsa-miR-8061 FCF1 FCF1 rRNA-processing protein HGNC:20220 details
hsa-miR-8061 SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-8061 PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K HGNC:25415 details
hsa-miR-8061 ZYG11B zyg-11 family member B, cell cycle regulator HGNC:25820 details
hsa-miR-8061 USP22 ubiquitin specific peptidase 22 HGNC:12621 details
hsa-miR-8061 TTC39B tetratricopeptide repeat domain 39B HGNC:23704 details
hsa-miR-8061 STON2 stonin 2 HGNC:30652 details
hsa-miR-8061 AQR aquarius intron-binding spliceosomal factor HGNC:29513 details
hsa-miR-8061 ZFR zinc finger RNA binding protein HGNC:17277 details
hsa-miR-8061 FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-8061 LOXL2 lysyl oxidase like 2 HGNC:6666 details
hsa-miR-8061 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 HGNC:29958 details
hsa-miR-8061 PROSER2 proline and serine rich 2 HGNC:23728 details
hsa-miR-8061 CDK13 cyclin dependent kinase 13 HGNC:1733 details
hsa-miR-8061 ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-8061 CSNK1A1 casein kinase 1 alpha 1 HGNC:2451 details
hsa-miR-8061 POLE3 DNA polymerase epsilon 3, accessory subunit HGNC:13546 details
hsa-miR-8061 ARFGEF3 ARFGEF family member 3 HGNC:21213 details
hsa-miR-8061 KCNK2 potassium two pore domain channel subfamily K member 2 HGNC:6277 details
hsa-miR-8061 PAX4 paired box 4 HGNC:8618 details
hsa-miR-8061 RAB40B RAB40B, member RAS oncogene family HGNC:18284 details
hsa-miR-8061 ZNF774 zinc finger protein 774 HGNC:33108 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab