miRNA Card

miRNA General Information
miRNA ID hsa-miR-8067
Description Homo sapiens miR-8067 stem-loop
Comment None
Experiment Illumina [1]
Sequence CCUAGAAACUGUAAACUUAGUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:149867224|149867298 hsa-miR-8067 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:12668100|12668291 hsa-miR-8067 0 1 0
chr5:1052187|1052263 hsa-miR-8067 0 1 0
chr9:114336563|114336714 hsa-miR-8067 0 1 0
chr19:1038215|1038354 hsa-miR-8067 0 1 0
chr7:148731181|148731277 hsa-miR-8067 0 1 0
chr12:66137940|66138057 hsa-miR-8067 0 1 0
chrX:153961845|153962037 hsa-miR-8067 0 1 0
chr19:52225769|52226154 hsa-miR-8067 0 1 0
chr6:75155759|75156276 hsa-miR-8067 0 1 0
chr2:96250779|96250958 hsa-miR-8067 0 1 0
chr14:105588089|105708144 hsa-miR-8067 0 1 0
chr2:33583388|33583486 hsa-miR-8067 0 1 0
chr1:15518171|15518323 hsa-miR-8067 0 1 0
chr12:53211504|53211587 hsa-miR-8067 0 1 0
chr19:12668100|12668217 hsa-miR-8067 0 1 0
chr2:85544006|85544149 hsa-miR-8067 0 1 0
chr1:161868987|161869129 hsa-miR-8067 0 1 0
chr8:18528247|18528386 hsa-miR-8067 0 1 0
chr5:150113858|150113983 hsa-miR-8067 0 1 0
chr2:96809830|96810021 hsa-miR-8067 0 1 0
chr7:102426325|102426430 hsa-miR-8067 0 1 0
chr6:6174780|6174861 hsa-miR-8067 0 1 0
chr8:80637460~80637604 hsa-miR-8067 0 1 0
chr9:37438306~37438460 hsa-miR-8067 0 1 0
chr19:12668100~12668291 hsa-miR-8067 0 1 0
chr6:29887567~29887775 hsa-miR-8067 0 1 0
chr12:92816221~92816310 hsa-miR-8067 0 1 0
chr15:80595638~80595800 hsa-miR-8067 0 1 0
chr19:12668100~12668217 hsa-miR-8067 0 1 0
chr10:97458654~97458857 hsa-miR-8067 0 1 0
chr2:219220086~219220303 hsa-miR-8067 0 1 0
chr4:119300497~119300598 hsa-miR-8067 0 1 0
chr19:7448781|7449029 hsa-miR-8067 0 1 0
chr3:71079929|71080039 hsa-miR-8067 0 1 0
chr1:165870584|165870709 hsa-miR-8067 0 1 0
chr4:85712347|85712452 hsa-miR-8067 0 1 0
chr7:32539053|32539192 hsa-miR-8067 0 1 0
chr15:50118376|50118482 hsa-miR-8067 0 1 0
chr12:65461375|65461477 hsa-miR-8067 0 1 0
chr1:32853980|32854110 hsa-miR-8067 0 1 0
chr5:1052198|1052324 hsa-miR-8067 0 1 0
chr19:18669858|18670108 hsa-miR-8067 0 1 0
chr4:119300497|119300598 hsa-miR-8067 0 1 0
chr11:72097342|72097523 hsa-miR-8067 0 1 0
chr2:86144203|86144402 hsa-miR-8067 0 1 0
chr12:52307114|52307287 hsa-miR-8067 0 1 0
chr3:129326987|129327162 hsa-miR-8067 0 1 0
chr3:170094294|170094453 hsa-miR-8067 0 1 0
chr12:122727935|122728078 hsa-miR-8067 0 1 0
chr17:68544124|68544236 hsa-miR-8067 0 1 0
chr17:46941308|46941499 hsa-miR-8067 0 1 0
chr12:53211464|53211587 hsa-miR-8067 0 1 0
chr3:25596738|25596925 hsa-miR-8067 0 1 0
chr12:22459513|22459900 hsa-miR-8067 0 1 0
chr12:54231752|54231881 hsa-miR-8067 0 1 0
chr2:86144190|86144362 hsa-miR-8067 0 1 0
chr17:4959508|4959790 hsa-miR-8067 0 1 0
chr2:85544006|85544138 hsa-miR-8067 0 1 0
chr14:30715924|30722559 hsa-miR-8067 0 1 0
chr14:54477428|54477641 hsa-miR-8067 0 1 0
chr9:37438319|37438460 hsa-miR-8067 0 1 0
chr16:89299130|89299235 hsa-miR-8067 0 1 0
chr4:119300442|119300598 hsa-miR-8067 0 1 0
chr2:190252284|190261234 hsa-miR-8067 0 1 0
chr3:136991961|136992081 hsa-miR-8067 0 1 0
chr7:101097497|101097656 hsa-miR-8067 0 1 0
chr8:23187849|23187968 hsa-miR-8067 0 1 0
chr4:165495564|165497528 hsa-miR-8067 0 1 0
chr10:79934345|79934507 hsa-miR-8067 0 1 0
chr17:41975651|41975778 hsa-miR-8067 0 1 0
chr17:35269050|35269271 hsa-miR-8067 0 1 0
chr10:56358336|56358687 hsa-miR-8067 0 1 0
chr3:184302488|184302763 hsa-miR-8067 0 1 0
chr14:60975177|60975568 hsa-miR-8067 0 1 0
chr6:36682499|36682687 hsa-miR-8067 0 1 0
chr22:50209968|50210132 hsa-miR-8067 0 1 0
chr6:116279369|116279452 hsa-miR-8067 0 1 0
chr2:32154581|32154734 hsa-miR-8067 0 1 0
chr18:9396342|9396497 hsa-miR-8067 0 1 0
chr18:11852131|11852238 hsa-miR-8067 0 1 0
chr3:188887662|188887798 hsa-miR-8067 0 1 0
chr17:4959508|4959783 hsa-miR-8067 0 1 0
chr10:97458654|97458857 hsa-miR-8067 0 1 0
chr7:101097505|101097656 hsa-miR-8067 0 1 0
chr20:36878745|36878935 hsa-miR-8067 0 1 0
chr12:123621417|123621619 hsa-miR-8067 0 1 0
chr1:46029845|46030207 hsa-miR-8067 0 1 0
chr11:59802347|59802464 hsa-miR-8067 0 1 0
chr2:26394925|26395035 hsa-miR-8067 0 1 0
chr9:21003675|21003768 hsa-miR-8067 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-8067 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 HGNC:7719 details
hsa-miR-8067 TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-8067 KLHL20 kelch like family member 20 HGNC:25056 details
hsa-miR-8067 HPS4 HPS4 biogenesis of lysosomal organelles complex 3 subunit 2 HGNC:15844 details
hsa-miR-8067 SAMD9L sterile alpha motif domain containing 9 like HGNC:1349 details
hsa-miR-8067 LHFPL3 LHFPL tetraspan subfamily member 3 HGNC:6589 details
hsa-miR-8067 ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-8067 ANKRD11 ankyrin repeat domain 11 HGNC:21316 details
hsa-miR-8067 ZNFX1 zinc finger NFX1-type containing 1 HGNC:29271 details
hsa-miR-8067 details
hsa-miR-8067 EBAG9 estrogen receptor binding site associated antigen 9 HGNC:3123 details
hsa-miR-8067 MTRNR2L10 MT-RNR2 like 10 HGNC:37167 details
hsa-miR-8067 TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-8067 MTRNR2L8 MT-RNR2 like 8 HGNC:37165 details
hsa-miR-8067 DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-8067 GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-8067 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-8067 MTRNR2L6 MT-RNR2 like 6 HGNC:37163 details
hsa-miR-8067 BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-8067 PLA2G2C phospholipase A2 group IIC HGNC:9032 details
hsa-miR-8067 RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-8067 PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-8067 FHL2 four and a half LIM domains 2 HGNC:3703 details
hsa-miR-8067 CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-8067 FSIP2 fibrous sheath interacting protein 2 HGNC:21675 details
hsa-miR-8067 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-8067 CCDC169 coiled-coil domain containing 169 HGNC:34361 details
hsa-miR-8067 MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-8067 CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-8067 TRUB1 TruB pseudouridine synthase family member 1 HGNC:16060 details
hsa-miR-8067 ZKSCAN8 zinc finger with KRAB and SCAN domains 8 HGNC:12983 details
hsa-miR-8067 NUP35 nucleoporin 35 HGNC:29797 details
hsa-miR-8067 HEPHL1 hephaestin like 1 HGNC:30477 details
hsa-miR-8067 NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-8067 SCO1 synthesis of cytochrome C oxidase 1 HGNC:10603 details
hsa-miR-8067 ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-miR-8067 ASS1 argininosuccinate synthase 1 HGNC:758 details
hsa-miR-8067 IPMK inositol polyphosphate multikinase HGNC:20739 details
hsa-miR-8067 TMEM97 transmembrane protein 97 HGNC:28106 details
hsa-miR-8067 KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-8067 CCNG1 cyclin G1 HGNC:1592 details
hsa-miR-8067 MRPS30 mitochondrial ribosomal protein S30 HGNC:8769 details
hsa-miR-8067 details
hsa-miR-8067 LUZP1 leucine zipper protein 1 HGNC:14985 details
hsa-miR-8067 HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-8067 ABHD5 abhydrolase domain containing 5, lysophosphatidic acid acyltransferase HGNC:21396 details
hsa-miR-8067 TOB2 transducer of ERBB2, 2 HGNC:11980 details
hsa-miR-8067 TAF7 TATA-box binding protein associated factor 7 HGNC:11541 details
hsa-miR-8067 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma HGNC:3267 details
hsa-miR-8067 TEF TEF transcription factor, PAR bZIP family member HGNC:11722 details
hsa-miR-8067 NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-8067 SEH1L SEH1 like nucleoporin HGNC:30379 details
hsa-miR-8067 SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-8067 KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-8067 YPEL1 yippee like 1 HGNC:12845 details
hsa-miR-8067 details
hsa-miR-8067 LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-8067 BBS9 Bardet-Biedl syndrome 9 HGNC:30000 details
hsa-miR-8067 SMIM18 small integral membrane protein 18 HGNC:42973 details
hsa-miR-8067 FOXN3 forkhead box N3 HGNC:1928 details
hsa-miR-8067 CCDC90B coiled-coil domain containing 90B HGNC:28108 details
hsa-miR-8067 ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-8067 RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-8067 RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-8067 ATP11A ATPase phospholipid transporting 11A HGNC:13552 details
hsa-miR-8067 MED24 mediator complex subunit 24 HGNC:22963 details
hsa-miR-8067 PPP1R3D protein phosphatase 1 regulatory subunit 3D HGNC:9294 details
hsa-miR-8067 RPL24 ribosomal protein L24 HGNC:10325 details
hsa-miR-8067 PPP1R3E protein phosphatase 1 regulatory subunit 3E HGNC:14943 details
hsa-miR-8067 MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-8067 PEAK1 pseudopodium enriched atypical kinase 1 HGNC:29431 details
hsa-miR-8067 SH3RF2 SH3 domain containing ring finger 2 HGNC:26299 details
hsa-miR-8067 AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-8067 RPL13A ribosomal protein L13a HGNC:10304 details
hsa-miR-8067 CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-8067 NFATC3 nuclear factor of activated T cells 3 HGNC:7777 details
hsa-miR-8067 ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab