CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-8485
Description	Homo sapiens miR-8485 stem-loop
Comment	None
Experiment	RT-PCR [1]
Sequence	CACACACACACACACACGUAU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr5:59193500\|59215968	hsa-miR-8485	1	1	1
chr8:23328382\|23333623	hsa-miR-8485	1	1	1

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr2:138571979\|138572064	hsa-miR-8485	1	1
chr12:108645478\|108645672	hsa-miR-8485	1	1
chr7:64691166\|64691311	hsa-miR-8485	1	1
chr2:234495015\|234495136	hsa-miR-8485	1	1
chr4:775471\|775585	hsa-miR-8485	1	1
chr19:53874935\|53875269	hsa-miR-8485	1	1
chr12:120216088\|120216321	hsa-miR-8485	1	1
chr16:29819972\|29820049	hsa-miR-8485	1	1
chr17:43015302\|43015460	hsa-miR-8485	1	1
chr16:2837735\|2837851	hsa-miR-8485	1	1
chr20:44715104\|44715414	hsa-miR-8485	1	1
chrX:1386548\|1386703	hsa-miR-8485	1	1
chrX:153508993\|153509123	hsa-miR-8485	1	1
chr9:133470159\|133470283	hsa-miR-8485	1	1
chr6:43181162\|43181356	hsa-miR-8485	1	1
chrX:153508970\|153509123	hsa-miR-8485	1	1
chr6:26134187\|26134409	hsa-miR-8485	1	1
chrX:153508993\|153509181	hsa-miR-8485	1	1
chr15:65577396\|65577519	hsa-miR-8485	1	1
chr2:39474580\|39474698	hsa-miR-8485	1	1
chr22:41994751\|41994987	hsa-miR-8485	1	1
chr9:129738392\|129738555	hsa-miR-8485	1	1
chr2:237765193\|237765364	hsa-miR-8485	1	1
chr19:46775042\|46775159	hsa-miR-8485	1	1
chr1:26864176\|26864428	hsa-miR-8485	1	1
chr15:52309820\|52310009	hsa-miR-8485	1	1
chr14:95439671\|95439983	hsa-miR-8485	1	1
chr6:44233840\|44234000	hsa-miR-8485	1	1
chr17:40135797\|40135907	hsa-miR-8485	1	1
chr19:45470381\|45470700	hsa-miR-8485	1	1
chr1:26780643\|26780845	hsa-miR-8485	1	1
chr17:8160722\|8160808	hsa-miR-8485	1	1
chr11:1915081\|1915478	hsa-miR-8485	1	1
chr11:108178409\|108178553	hsa-miR-8485	1	1
chr11:66492829\|66493179	hsa-miR-8485	1	1
chr17:58274237\|58274407	hsa-miR-8485	1	1
chr12:57823269\|57823407	hsa-miR-8485	1	1
chr19:45475284\|45475507	hsa-miR-8485	1	1
chr2:237765193\|237765339	hsa-miR-8485	1	1
chr2:239150315\|239150509	hsa-miR-8485	1	1
chr16:72658201\|72658340	hsa-miR-8485	1	1
chr21:28730240\|28730450	hsa-miR-8485	1	1
chr17:1501706\|1501905	hsa-miR-8485	1	1
chr12:2309353\|2309545	hsa-miR-8485	1	1
chr22:26797592\|26797734	hsa-miR-8485	1	1
chr1:156220508\|156220744	hsa-miR-8485	1	1
chrX:131794154\|131794296	hsa-miR-8485	1	1
chr19:48190994\|48191183	hsa-miR-8485	1	1
chr14:24179897\|24179983	hsa-miR-8485	1	1
chr9:41064596\|41064703	hsa-miR-8485	1	1
chr7:11817794\|11817941	hsa-miR-8485	1	1
chrX:153793104\|153793288	hsa-miR-8485	1	1
chr7:98259563\|98259834	hsa-miR-8485	1	1
chr11:76970514\|76970716	hsa-miR-8485	1	1
chr11:1914751\|1914948	hsa-miR-8485	1	1
chrX:153508993\|153509171	hsa-miR-8485	1	1
chr9:37089787\|37089963	hsa-miR-8485	1	1
chr2:85666105\|85666282	hsa-miR-8485	1	1
chr5:137260\|137451	hsa-miR-8485	1	1
chr1:26780771\|26780929	hsa-miR-8485	1	1
chr19:45410472\|45410650	hsa-miR-8485	1	1
chr1:40422738\|40422917	hsa-miR-8485	1	1
chr3:186148948\|186149063	hsa-miR-8485	1	1
chr19:53874935\|53875267	hsa-miR-8485	1	1
chr2:237765248\|237765364	hsa-miR-8485	1	1
chr2:85666090\|85666195	hsa-miR-8485	1	1
chr19:55661488\|55661629	hsa-miR-8485	1	1
chr5:154819674\|154819856	hsa-miR-8485	1	1
chr6:7289590\|7289761	hsa-miR-8485	1	1
chr2:237765248\|237765339	hsa-miR-8485	1	1
chr1:12208343\|12208525	hsa-miR-8485	1	1
chr11:1753339\|1753494	hsa-miR-8485	1	1
chr17:38921485\|38921631	hsa-miR-8485	1	1
chr2:85666099\|85666195	hsa-miR-8485	1	1
chr21:38301947\|38302120	hsa-miR-8485	1	1
chr6:27757717\|27757945	hsa-miR-8485	1	1
chr2:85666105\|85666195	hsa-miR-8485	1	1
chr9:88477778\|88477865	hsa-miR-8485	1	1
chrX:153508993\|153509134	hsa-miR-8485	1	1
chr14:35082526\|35082648	hsa-miR-8485	1	1
chr16:24919274\|24919450	hsa-miR-8485	1	1
chr17:38767358\|38767549	hsa-miR-8485	1	1
chr5:141825471\|141825584	hsa-miR-8485	1	1
chr3:194202922\|194203014	hsa-miR-8485	1	1
chr3:129197585\|129197818	hsa-miR-8485	1	1
chr17:43015302\|43015585	hsa-miR-8485	1	1
chr2:85666105\|85666258	hsa-miR-8485	1	1
chr2:96185003\|96185159	hsa-miR-8485	1	1
chr3:128813424\|128813743	hsa-miR-8485	1	1
chr2:234495015\|234495101	hsa-miR-8485	1	1
chr2:96184973\|96185116	hsa-miR-8485	1	1
chr8:118190372\|118190569	hsa-miR-8485	1	1
chr17:49677952\|49678094	hsa-miR-8485	1	1
chr12:132950473\|132950677	hsa-miR-8485	1	1
chr14:20471298\|20471443	hsa-miR-8485	1	1
chr11:128891395\|128891548	hsa-miR-8485	1	1
chr7:135167372\|135167662	hsa-miR-8485	1	1
chr3:128813538\|128813743	hsa-miR-8485	1	1
chrX:153508993\|153509148	hsa-miR-8485	1	1
chr4:184022455\|184022570	hsa-miR-8485	1	1
chrX:153508853\|153509171	hsa-miR-8485	1	1
chr4:173332039\|173332173	hsa-miR-8485	1	1
chr19:18279891\|18280089	hsa-miR-8485	1	1
chr2:207763755\|207763959	hsa-miR-8485	1	1
chr12:125030849\|125030997	hsa-miR-8485	1	1
chr20:37983145\|37983285	hsa-miR-8485	1	1
chr22:25724098\|25724256	hsa-miR-8485	1	1
chr14:85627528\|85627658	hsa-miR-8485	1	1
chr3:128813476\|128813727	hsa-miR-8485	1	1
chr17:38921521\|38921648	hsa-miR-8485	1	1
chr17:46938796\|46938970	hsa-miR-8485	1	1
chr17:43544975\|43545313	hsa-miR-8485	1	1
chrX:1386503\|1386600	hsa-miR-8485	1	1
chr10:128106679\|128106886	hsa-miR-8485	1	1
chrX:68841321\|68841514	hsa-miR-8485	1	1
chr14:35082497\|35082650	hsa-miR-8485	1	1
chr12:74541048\|74541199	hsa-miR-8485	1	1
chr6:7289471\|7289827	hsa-miR-8485	1	1
chrX:1386474\|1386600	hsa-miR-8485	1	1
chr9:123103940\|123104064	hsa-miR-8485	1	1
chr1:35566624\|35566726	hsa-miR-8485	1	1
chr12:74541020\|74541199	hsa-miR-8485	1	1
chr11:86808797\|86808916	hsa-miR-8485	1	1
chr20:47654788\|47654911	hsa-miR-8485	1	1
chr10:58397686\|58397792	hsa-miR-8485	1	1
chr1:22091643\|22091857	hsa-miR-8485	1	1
chr10:70879270\|70879481	hsa-miR-8485	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:64782043\|64782205	hsa-miR-8485	0	1
chr9:35684253\|35684629	hsa-miR-8485	0	1
chr10:80157518\|80157703	hsa-miR-8485	0	1
chr22:37807182\|37807259	hsa-miR-8485	0	1
chr22:41907035\|41907238	hsa-miR-8485	0	1
chr6:31889027\|31889292	hsa-miR-8485	0	1
chr3:15648828\|15648990	hsa-miR-8485	0	1
chr3:14943493\|14943633	hsa-miR-8485	0	1
chr1:39759833\|39760052	hsa-miR-8485	0	1
chr10:69507077\|69507207	hsa-miR-8485	0	1
chr4:16170734\|16170940	hsa-miR-8485	0	1
chr20:45420332\|45420578	hsa-miR-8485	0	1
chr15:98963945\|98964039	hsa-miR-8485	0	1
chr17:79936110\|79936292	hsa-miR-8485	0	1
chr10:102813005\|102813196	hsa-miR-8485	0	1
chr19:18431371\|18431706	hsa-miR-8485	0	1
chr5:179836676\|179836840	hsa-miR-8485	0	1
chr11:614238\|614502	hsa-miR-8485	0	1
chr10:119170065\|119170274	hsa-miR-8485	0	1
chr1:156466986\|156467137	hsa-miR-8485	0	1
chr17:43015302\|43015410	hsa-miR-8485	0	1
chr1:2405074\|2405195	hsa-miR-8485	0	1
chr12:2692322\|2692473	hsa-miR-8485	0	1
chr11:12528474\|12528619	hsa-miR-8485	0	1
chr1:2405040\|2405178	hsa-miR-8485	0	1
chr19:7561246\|7561566	hsa-miR-8485	0	1
chr19:58549985\|58550210	hsa-miR-8485	0	1
chr19:56525272\|56525355	hsa-miR-8485	0	1
chr22:41907077\|41907172	hsa-miR-8485	0	1
chr5:179836595\|179836840	hsa-miR-8485	0	1
chr12:122061098\|122061317	hsa-miR-8485	0	1
chr12:115960941\|115961094	hsa-miR-8485	0	1
chr1:43452160\|43452369	hsa-miR-8485	0	1
chr16:84778987\|84779132	hsa-miR-8485	0	1
chr17:82597273\|82597414	hsa-miR-8485	0	1
chr19:45474530\|45474678	hsa-miR-8485	0	1
chr8:18212445\|18212572	hsa-miR-8485	0	1
chr9:136940694\|136940818	hsa-miR-8485	0	1
chr15:74844719\|74844874	hsa-miR-8485	0	1
chr1:151773543\|151773645	hsa-miR-8485	0	1
chr12:123523134\|123523267	hsa-miR-8485	0	1
chr7:2663810\|2663966	hsa-miR-8485	0	1
chr11:102530598\|102530747	hsa-miR-8485	0	1
chr20:5760234\|5760361	hsa-miR-8485	0	1
chr17:77499637\|77499779	hsa-miR-8485	0	1
chr10:49163179\|49163345	hsa-miR-8485	1	0
chr15:63324503\|63324602	hsa-miR-8485	1	0
chr10:20282105\|20282258	hsa-miR-8485	1	0
chr15:65577346\|65577519	hsa-miR-8485	1	0
chr5:40829641\|40829754	hsa-miR-8485	1	0
chrX:110674433\|110674655	hsa-miR-8485	1	0
chr17:79936868\|79936966	hsa-miR-8485	1	0
chr17:77500120\|77500242	hsa-miR-8485	1	0
chr8:117128329\|117128443	hsa-miR-8485	1	0
chr10:102814908\|102815044	hsa-miR-8485	1	0
chr7:47276268\|47276378	hsa-miR-8485	1	0
chr17:79936845\|79936966	hsa-miR-8485	1	0
chr15:74177574\|74177650	hsa-miR-8485	1	0
chr3:128813548\|128813727	hsa-miR-8485	1	0
chr18:3601415\|3601649	hsa-miR-8485	1	0
chrX:153508993\|153509131	hsa-miR-8485	1	0
chr6:131948399\|131948697	hsa-miR-8485	1	0
chr19:10572775\|10573083	hsa-miR-8485	0	1
chr11:66274077\|66274209	hsa-miR-8485	0	1
chr20:36528002\|36528254	hsa-miR-8485	0	1
chr11:1753339\|1753466	hsa-miR-8485	0	1
chr10:79316154\|79316287	hsa-miR-8485	0	1
chr2:241075769\|241076030	hsa-miR-8485	0	1
chr11:64765561\|64765752	hsa-miR-8485	0	1
chr15:98963945\|98964086	hsa-miR-8485	0	1
chr19:15237659\|15237874	hsa-miR-8485	0	1
chr13:110638541\|110638610	hsa-miR-8485	0	1
chr17:81914093\|81914345	hsa-miR-8485	0	1
chr4:1394151\|1394251	hsa-miR-8485	0	1
chr8:22689231\|22689399	hsa-miR-8485	0	1
chr4:141233821\|141234073	hsa-miR-8485	0	1
chr5:149683771\|149683888	hsa-miR-8485	0	1
chr19:16355492\|16355644	hsa-miR-8485	0	1
chr14:24631972\|24632052	hsa-miR-8485	0	1
chr11:1753302\|1753434	hsa-miR-8485	0	1
chr2:237510764\|237511101	hsa-miR-8485	0	1
chr6:138423448\|138423616	hsa-miR-8485	0	1
chr22:32861174\|32861241	hsa-miR-8485	0	1
chr17:32480571\|32480804	hsa-miR-8485	0	1
chr19:2809916\|2810076	hsa-miR-8485	0	1
chr15:40853207\|40853535	hsa-miR-8485	0	1
chr6:44233744\|44233924	hsa-miR-8485	0	1
chr12:122061217\|122061317	hsa-miR-8485	0	1
chr3:119589144\|119589262	hsa-miR-8485	0	1
chr6:35427240\|35427360	hsa-miR-8485	0	1
chr20:41359594\|41359751	hsa-miR-8485	0	1
chr1:244707656\|244707995	hsa-miR-8485	0	1
chr1:45627975\|45628115	hsa-miR-8485	0	1
chr11:65795828\|65795979	hsa-miR-8485	0	1
chr3:149286746\|149286819	hsa-miR-8485	0	1
chr3:38141226\|38141326	hsa-miR-8485	0	1
chr16:30443800\|30444052	hsa-miR-8485	0	1
chr1:2405040\|2405163	hsa-miR-8485	0	1
chr3:123284225\|123284328	hsa-miR-8485	0	1
chr7:5478564\|5478720	hsa-miR-8485	0	1
chr2:205776948\|205777047	hsa-miR-8485	0	1
chr17:63432841\|63432980	hsa-miR-8485	0	1
chr12:122061113\|122061317	hsa-miR-8485	0	1
chr5:151030276\|151030376	hsa-miR-8485	0	1
chr10:73793379\|73793534	hsa-miR-8485	0	1
chr10:70111937\|70112073	hsa-miR-8485	0	1
chr15:78982772\|78982842	hsa-miR-8485	0	1
chr4:77048287\|77048385	hsa-miR-8485	0	1
chr1:155210658\|155210829	hsa-miR-8485	0	1
chr9:2192824\|2193031	hsa-miR-8485	0	1
chr8:42180014\|42180311	hsa-miR-8485	0	1
chr1:2404892\|2405222	hsa-miR-8485	0	1
chr11:94876260\|94876423	hsa-miR-8485	0	1
chr8:22082356\|22082522	hsa-miR-8485	0	1
chr16:84778992\|84779132	hsa-miR-8485	0	1
chr1:151773555\|151773641	hsa-miR-8485	0	1
chr1:2404959\|2405183	hsa-miR-8485	0	1
chr16:77199138\|77199470	hsa-miR-8485	0	1
chr12:125142410\|125142520	hsa-miR-8485	0	1
chr12:122061223\|122061317	hsa-miR-8485	0	1
chr8:42179961\|42180317	hsa-miR-8485	0	1
chr5:58458110~58458428	hsa-miR-8485	0	1
chrX:154352181~154352397	hsa-miR-8485	0	1
chr3:14943525~14943744	hsa-miR-8485	0	1
chr8:22082334~22082475	hsa-miR-8485	0	1
chr9:128178797~128179014	hsa-miR-8485	0	1
chr10:49163179~49163345	hsa-miR-8485	0	1
chr16:71626419~71626544	hsa-miR-8485	0	1
chr3:13628981~13629222	hsa-miR-8485	0	1
chr3:49013784~49013905	hsa-miR-8485	0	1
chr10:100548358~100548510	hsa-miR-8485	0	1
chr16:29819972~29820049	hsa-miR-8485	0	1
chr10:20282105~20282258	hsa-miR-8485	0	1
chr15:63324503~63324602	hsa-miR-8485	0	1
chr12:132643311~132643530	hsa-miR-8485	0	1
chr11:67662480\|67662830	hsa-miR-8485	0	1
chr15:65577346~65577519	hsa-miR-8485	0	1
chr2:219286523~219286640	hsa-miR-8485	0	1
chr5:40829641~40829754	hsa-miR-8485	0	1
chr9:128178851~128178946	hsa-miR-8485	0	1
chr11:85705435~85705545	hsa-miR-8485	0	1
chr16:1446263~1446374	hsa-miR-8485	0	1
chr17:40456569~40456960	hsa-miR-8485	0	1
chr3:119589144~119589262	hsa-miR-8485	0	1
chr10:133262864~133263007	hsa-miR-8485	0	1
chr5:151028216~151028386	hsa-miR-8485	0	1
chrX:110674433~110674655	hsa-miR-8485	0	1
chr1:156466986~156467137	hsa-miR-8485	0	1
chr6:35427240~35427360	hsa-miR-8485	0	1
chr8:117128329~117128443	hsa-miR-8485	0	1
chr17:79936868~79936966	hsa-miR-8485	0	1
chr17:77500120~77500242	hsa-miR-8485	0	1
chr6:42866813~42866964	hsa-miR-8485	0	1
chr19:7561246~7561566	hsa-miR-8485	0	1
chr10:69507077~69507207	hsa-miR-8485	0	1
chr22:27853537\|27854876	hsa-miR-8485	0	1
chr11:69667379~69667482	hsa-miR-8485	0	1
chr17:77499637~77499779	hsa-miR-8485	0	1
chr1:217591240~217591337	hsa-miR-8485	0	1
chr13:98420518\|98420817	hsa-miR-8485	0	1
chr10:102814908~102815044	hsa-miR-8485	0	1
chr11:1018543~1018647	hsa-miR-8485	0	1
chrX:153508993~153509181	hsa-miR-8485	0	1
chr7:47276268~47276378	hsa-miR-8485	0	1
chr17:77499637~77499712	hsa-miR-8485	0	1
chr2:203429921~203430084	hsa-miR-8485	0	1
chr2:188995753~188996458	hsa-miR-8485	0	1
chr2:237510758~237511101	hsa-miR-8485	0	1
chr3:140575786~140575974	hsa-miR-8485	0	1
chr10:133262864~133263085	hsa-miR-8485	0	1
chr17:79936845~79936966	hsa-miR-8485	0	1
chr15:74177574~74177650	hsa-miR-8485	0	1
chr2:96772192~96772360	hsa-miR-8485	0	1
chr17:77499637~77499781	hsa-miR-8485	0	1
chr2:237545493~237545596	hsa-miR-8485	0	1
chr3:128813548~128813727	hsa-miR-8485	0	1
chrX:154022802~154022946	hsa-miR-8485	0	1
chr18:3601415~3601649	hsa-miR-8485	0	1
chr11:840243~840385	hsa-miR-8485	0	1
chr12:94295161~94295283	hsa-miR-8485	0	1
chr20:41179961~41180167	hsa-miR-8485	0	1
chr19:56525272~56525355	hsa-miR-8485	0	1
chr1:46819199~46819306	hsa-miR-8485	0	1
chr5:179836752~179836864	hsa-miR-8485	0	1
chr6:7882754~7883124	hsa-miR-8485	0	1
chr9:34635243~34635439	hsa-miR-8485	0	1
chr11:1753339~1753466	hsa-miR-8485	0	1
chrX:153508993~153509131	hsa-miR-8485	0	1
chr6:131948399~131948697	hsa-miR-8485	0	1
chr8:18529329~18529473	hsa-miR-8485	0	1
chrX:153508970~153509123	hsa-miR-8485	0	1
chrX:154352311~154352630	hsa-miR-8485	0	1
chr19:45474530\|45474662	hsa-miR-8485	0	1
chr10:791676\|791807	hsa-miR-8485	0	1
chr8:103428144\|103428288	hsa-miR-8485	0	1
chr4:57093926\|57094018	hsa-miR-8485	0	1
chr9:77753126\|77753327	hsa-miR-8485	0	1
chr20:35628926\|35629177	hsa-miR-8485	0	1
chr19:15237659\|15237822	hsa-miR-8485	0	1
chr2:230819759\|230819884	hsa-miR-8485	0	1
chr1:155736281\|155736405	hsa-miR-8485	0	1
chr5:139626929\|139627053	hsa-miR-8485	0	1
chr1:2405040\|2405222	hsa-miR-8485	0	1
chr2:96772192\|96772360	hsa-miR-8485	0	1
chr16:18836210\|18836363	hsa-miR-8485	0	1
chr18:76896244\|76896373	hsa-miR-8485	0	1
chr6:34587373\|34587484	hsa-miR-8485	0	1
chr4:139020457\|139020537	hsa-miR-8485	0	1
chr10:30436451\|30436596	hsa-miR-8485	0	1
chr17:49827904\|49828017	hsa-miR-8485	0	1
chr9:2120579\|2120761	hsa-miR-8485	0	1
chr16:67883586\|67883720	hsa-miR-8485	0	1
chr7:2646964\|2647204	hsa-miR-8485	0	1
chr14:68135035\|68135167	hsa-miR-8485	0	1
chr19:7557046\|7557247	hsa-miR-8485	0	1
chr18:2981127\|2981372	hsa-miR-8485	0	1
chr9:92729204\|92764549	hsa-miR-8485	0	1
chr2:203429921\|203430163	hsa-miR-8485	0	1
chr1:236215604\|236215771	hsa-miR-8485	0	1
chr11:62542005\|62542328	hsa-miR-8485	0	1
chr3:63998322\|63998458	hsa-miR-8485	0	1
chr7:80653418\|80653598	hsa-miR-8485	0	1
chr21:44311308\|44311489	hsa-miR-8485	0	1
chr3:33048386\|33048553	hsa-miR-8485	0	1
chr7:74404341\|74404586	hsa-miR-8485	0	1
chr7:43798777\|43798942	hsa-miR-8485	0	1
chr15:90083511\|90083594	hsa-miR-8485	0	1
chr6:36720740\|36721010	hsa-miR-8485	0	1
chr16:1446210\|1446374	hsa-miR-8485	0	1
chr11:9220829\|9221017	hsa-miR-8485	0	1
chrX:71103117\|71103251	hsa-miR-8485	0	1
chr14:24179170\|24179281	hsa-miR-8485	0	1
chr17:75498925\|75499035	hsa-miR-8485	0	1
chr21:39011974\|39012089	hsa-miR-8485	0	1
chr6:20949388\|20949524	hsa-miR-8485	0	1
chr22:20064953\|20065101	hsa-miR-8485	0	1
chrX:71249628\|71249742	hsa-miR-8485	0	1
chr16:12547995\|12548105	hsa-miR-8485	0	1
chr6:5378947\|5379163	hsa-miR-8485	0	1
chr1:205626982\|205627184	hsa-miR-8485	0	1
chr10:26475372\|26475493	hsa-miR-8485	0	1
chr17:29074006\|29074275	hsa-miR-8485	0	1
chr2:16450851\|16451012	hsa-miR-8485	0	1
chr3:15030332\|15030452	hsa-miR-8485	0	1
chr3:81698133\|81698277	hsa-miR-8485	0	1
chr18:76362073\|76362184	hsa-miR-8485	0	1
chr20:51597992\|51598162	hsa-miR-8485	0	1
chr6:43785628\|43785791	hsa-miR-8485	0	1
chr15:40853172\|40853558	hsa-miR-8485	0	1
chr6:31927763\|31928054	hsa-miR-8485	0	1
chr17:79935993\|79936292	hsa-miR-8485	0	1
chr22:19175898\|19176106	hsa-miR-8485	0	1
chr21:41885963\|41886111	hsa-miR-8485	0	1
chr14:24416637\|24416758	hsa-miR-8485	0	1
chr12:10221950\|10222129	hsa-miR-8485	0	1
chr17:18209677\|18209918	hsa-miR-8485	0	1
chr22:46362309\|46362499	hsa-miR-8485	0	1
chr6:30897425\|30897505	hsa-miR-8485	0	1
chr4:54739643\|54739740	hsa-miR-8485	0	1
chr5:179836745\|179836840	hsa-miR-8485	0	1
chr2:230819757\|230819884	hsa-miR-8485	0	1
chr19:10643847\|10644083	hsa-miR-8485	0	1
chr1:155899379\|155899523	hsa-miR-8485	0	1
chr7:30446009\|30446163	hsa-miR-8485	0	1
chr6:349285\|349409	hsa-miR-8485	0	1
chr15:75371926\|75372057	hsa-miR-8485	0	1
chr1:161158510\|161158795	hsa-miR-8485	0	1
chr6:90515689\|90515817	hsa-miR-8485	0	1
chr20:57649473\|57649645	hsa-miR-8485	0	1
chr20:36527955\|36528135	hsa-miR-8485	0	1
chr2:3477948\|3478233	hsa-miR-8485	0	1
chr19:18671095\|18671268	hsa-miR-8485	0	1
chr10:128107564\|128107663	hsa-miR-8485	0	1
chr14:91018750\|91018925	hsa-miR-8485	0	1
chr6:32746030\|32746325	hsa-miR-8485	0	1
chr9:115086433\|115086584	hsa-miR-8485	0	1
chr2:221419922\|221420064	hsa-miR-8485	0	1
chr6:138423519\|138423633	hsa-miR-8485	0	1
chr22:35739400\|35739613	hsa-miR-8485	0	1
chr19:10643847\|10644027	hsa-miR-8485	0	1
chr19:50496919\|50497092	hsa-miR-8485	0	1
chr12:10221974\|10222129	hsa-miR-8485	0	1
chr11:70436010\|70436181	hsa-miR-8485	0	1
chr3:66003562\|66003661	hsa-miR-8485	0	1
chr2:229124832\|229124998	hsa-miR-8485	0	1
chr14:90407944\|90408098	hsa-miR-8485	0	1
chr1:2405040\|2405199	hsa-miR-8485	0	1
chr22:32859857\|32860058	hsa-miR-8485	0	1
chr1:228205324\|228205444	hsa-miR-8485	0	1
chr20:3805266\|3805354	hsa-miR-8485	0	1
chr10:89418064\|89418257	hsa-miR-8485	0	1
chr6:31927752\|31928094	hsa-miR-8485	0	1
chr9:136718289\|136718480	hsa-miR-8485	0	1
chr12:122061199\|122061317	hsa-miR-8485	0	1
chr2:120221754\|120221911	hsa-miR-8485	0	1
chr19:46624997\|46625105	hsa-miR-8485	0	1
chr7:1549147\|1549310	hsa-miR-8485	0	1
chr1:149846035\|149846181	hsa-miR-8485	0	1
chrX:154352263\|154352372	hsa-miR-8485	0	1
chr1:161047218\|161047327	hsa-miR-8485	0	1
chr6:32948724\|32949627	hsa-miR-8485	0	1
chr9:137102499\|137102739	hsa-miR-8485	0	1
chr2:237510677\|237511039	hsa-miR-8485	0	1
chrX:23784925\|23785039	hsa-miR-8485	0	1
chr17:47928378\|47928515	hsa-miR-8485	0	1
chr3:50269191\|50269264	hsa-miR-8485	0	1
chr1:156466986\|156467148	hsa-miR-8485	0	1
chr22:19019389\|19019556	hsa-miR-8485	0	1
chr17:63432860\|63432980	hsa-miR-8485	0	1
chr12:2849553\|2849752	hsa-miR-8485	0	1
chr9:133254567\|133254726	hsa-miR-8485	0	1
chr9:127749419\|127749542	hsa-miR-8485	0	1
chr7:102282735\|102283108	hsa-miR-8485	0	1
chr1:151773555\|151773645	hsa-miR-8485	0	1
chr7:137976862\|137977002	hsa-miR-8485	0	1
chr21:44079564\|44080127	hsa-miR-8485	0	1
chr7:845141\|845330	hsa-miR-8485	0	1
chr2:237510704\|237511095	hsa-miR-8485	0	1
chr1:12011936\|12012292	hsa-miR-8485	0	1
chr2:20201387\|20201534	hsa-miR-8485	0	1
chr12:57096212\|57096400	hsa-miR-8485	0	1
chr15:72250146\|72250300	hsa-miR-8485	0	1
chr5:179836608\|179836807	hsa-miR-8485	0	1
chr6:32948724\|32948852	hsa-miR-8485	0	1
chr6:33453329\|33453446	hsa-miR-8485	0	1
chr12:10221960\|10222129	hsa-miR-8485	0	1
chr15:98963952\|98964039	hsa-miR-8485	0	1
chr1:156465568\|156465667	hsa-miR-8485	0	1
chr1:3775965\|3776081	hsa-miR-8485	0	1
chr7:138001700\|138001994	hsa-miR-8485	0	1
chr15:98963948\|98964039	hsa-miR-8485	0	1
chr16:67438052\|67438202	hsa-miR-8485	0	1
chr14:36482091\|36482240	hsa-miR-8485	0	1
chr11:840243\|840351	hsa-miR-8485	0	1
chr14:36482091\|36482266	hsa-miR-8485	0	1
chr8:42179961\|42180298	hsa-miR-8485	0	1
chr11:490780\|490943	hsa-miR-8485	0	1
chr22:41179179\|41179270	hsa-miR-8485	0	1
chr17:81231213\|81231365	hsa-miR-8485	0	1
chr2:188996150\|188996471	hsa-miR-8485	0	1
chr9:115086448\|115086563	hsa-miR-8485	0	1
chr17:29073935\|29074205	hsa-miR-8485	0	1
chrX:118793592\|118793763	hsa-miR-8485	0	1
chr1:156466928\|156467137	hsa-miR-8485	0	1
chr1:206487669\|206487847	hsa-miR-8485	0	1
chr6:31171197\|31171386	hsa-miR-8485	0	1
chr16:28595415\|28595671	hsa-miR-8485	0	1
chr6:33006474\|33006666	hsa-miR-8485	0	1
chr11:1753275\|1753468	hsa-miR-8485	0	1
chr2:188996125\|188996461	hsa-miR-8485	0	1
chr12:56238146\|56238354	hsa-miR-8485	0	1
chr12:122061155\|122061317	hsa-miR-8485	0	1
chr16:19062252\|19062421	hsa-miR-8485	0	1
chr8:42180017\|42180298	hsa-miR-8485	0	1
chr9:136940601\|136940856	hsa-miR-8485	0	1
chr11:75205424\|75205589	hsa-miR-8485	0	1
chr6:160105650\|160105752	hsa-miR-8485	0	1
chr6:32938684\|32938840	hsa-miR-8485	0	1
chr20:47209853\|47209985	hsa-miR-8485	0	1
chr19:2715885\|2716019	hsa-miR-8485	0	1
chr2:46386184\|46386461	hsa-miR-8485	0	1
chr22:41906912\|41907228	hsa-miR-8485	0	1
chr6:35427210\|35427360	hsa-miR-8485	0	1
chrX:154352181\|154352423	hsa-miR-8485	0	1
chr22:32861191\|32861383	hsa-miR-8485	0	1
chr11:790987\|791293	hsa-miR-8485	0	1
chr17:81117961\|81118138	hsa-miR-8485	0	1
chr1:205714059\|205714174	hsa-miR-8485	0	1
chr7:88283046\|88283171	hsa-miR-8485	0	1
chr2:12717788\|12718017	hsa-miR-8485	0	1
chr17:77499637\|77499788	hsa-miR-8485	0	1
chr3:49013787\|49013959	hsa-miR-8485	0	1
chr17:77499637\|77499771	hsa-miR-8485	0	1
chr3:171859693\|171859891	hsa-miR-8485	0	1
chr17:77499637\|77499781	hsa-miR-8485	0	1
chr17:18317500\|18317663	hsa-miR-8485	-2	1
chr5:151028216\|151028386	hsa-miR-8485	-9	1
chr1:161158629\|161158781	hsa-miR-8485	-10	1
chr19:55202056\|55205592	hsa-miR-8485	-4	1
chr6:7882894\|7883139	hsa-miR-8485	-9	1
chr13:112885383\|112885570	hsa-miR-8485	-11	1
chr10:70879334\|70879481	hsa-miR-8485	-26	1
chr1:205768158\|205768276	hsa-miR-8485	-1	1
chr22:40323858\|40324106	hsa-miR-8485	-10	1
chr16:71626424\|71626544	hsa-miR-8485	-3	1
chr11:118897437\|118897601	hsa-miR-8485	-2	1
chr7:74195984\|74196122	hsa-miR-8485	0	1
chr10:133262805\|133262924	hsa-miR-8485	0	1
chr9:86300735\|86300869	hsa-miR-8485	0	1
chr7:101004761\|101004934	hsa-miR-8485	0	1
chr20:57649588\|57649770	hsa-miR-8485	0	1
chr9:128178797\|128178916	hsa-miR-8485	0	1
chr20:54004008\|54004125	hsa-miR-8485	0	1
chr5:176397666\|176397991	hsa-miR-8485	0	1
chr21:46193952\|46194079	hsa-miR-8485	0	1
chr3:38142286\|38142355	hsa-miR-8485	0	1
chr20:3805266\|3805371	hsa-miR-8485	0	1
chr2:188996125\|188996463	hsa-miR-8485	0	1
chr1:45627975\|45628119	hsa-miR-8485	0	1
chrX:106928154\|106928525	hsa-miR-8485	0	1
chrX:48819391\|48819485	hsa-miR-8485	0	1
chr2:96622751\|96622888	hsa-miR-8485	0	1
chr9:128178851\|128179198	hsa-miR-8485	0	1
chr9:21331466\|21331573	hsa-miR-8485	0	1
chr16:84778992\|84779150	hsa-miR-8485	0	1
chr12:57096212\|57096409	hsa-miR-8485	0	1
chr2:189578090\|189578221	hsa-miR-8485	0	1
chr6:160105542\|160105744	hsa-miR-8485	0	1
chr6:160105601\|160105762	hsa-miR-8485	0	1
chr16:77200156\|77200326	hsa-miR-8485	0	1
chr21:44853040\|44853223	hsa-miR-8485	0	1
chr8:141431440\|141431696	hsa-miR-8485	0	1
chr1:161158521\|161158728	hsa-miR-8485	0	1
chr6:154738004\|154738121	hsa-miR-8485	0	1
chr6:30897087\|30897469	hsa-miR-8485	0	1
chr9:129889822\|129890128	hsa-miR-8485	0	1
chr11:490709\|490890	hsa-miR-8485	0	1
chr5:179836595\|179836923	hsa-miR-8485	0	1
chr6:31927752\|31928054	hsa-miR-8485	0	1
chr1:45627940\|45628121	hsa-miR-8485	0	1
chr5:139482586\|139482759	hsa-miR-8485	0	1
chr19:19197213\|19197605	hsa-miR-8485	0	1
chr17:43210932\|43211034	hsa-miR-8485	0	1
chr17:28723893\|28724017	hsa-miR-8485	0	1
chr1:12209029\|12209208	hsa-miR-8485	0	1
chr2:25743057\|25743202	hsa-miR-8485	0	1
chr11:57700365\|57700506	hsa-miR-8485	0	1
chr11:12942447\|12942576	hsa-miR-8485	0	1
chr19:13927049\|13927247	hsa-miR-8485	0	1
chr12:56238265\|56238354	hsa-miR-8485	0	1
chr9:121179456\|121179581	hsa-miR-8485	0	1
chr2:230819759\|230819873	hsa-miR-8485	0	1
chr2:219220154\|219220341	hsa-miR-8485	0	1
chr9:136940676\|136940818	hsa-miR-8485	0	1
chr1:160997780\|160997903	hsa-miR-8485	0	1
chr1:156466986\|156467120	hsa-miR-8485	0	1
chr16:2239774\|2239893	hsa-miR-8485	0	1
chr19:56423594\|56423756	hsa-miR-8485	0	1
chrX:106930659\|106930788	hsa-miR-8485	0	1
chr1:2405040\|2405183	hsa-miR-8485	0	1
chr16:84778987\|84779142	hsa-miR-8485	0	1
chr6:35427124\|35427360	hsa-miR-8485	0	1
chr12:48148982\|48149146	hsa-miR-8485	0	1
chr9:95468980\|95469116	hsa-miR-8485	0	1
chr3:125190443\|125190811	hsa-miR-8485	0	1
chr19:7561230\|7561566	hsa-miR-8485	0	1
chr6:33453337\|33453446	hsa-miR-8485	0	1
chr15:40853181\|40853535	hsa-miR-8485	0	1
chr22:32859964\|32860104	hsa-miR-8485	0	1
chr11:69652204\|69652392	hsa-miR-8485	0	1
chr15:43403753\|43403950	hsa-miR-8485	0	1
chr13:113640402\|113640620	hsa-miR-8485	0	1
chr2:20448161\|20448364	hsa-miR-8485	0	1
chr14:24416681\|24416849	hsa-miR-8485	0	1
chr20:37518675\|37518795	hsa-miR-8485	0	1
chr6:44233744\|44233911	hsa-miR-8485	0	1
chr20:45420394\|45420578	hsa-miR-8485	0	1
chr18:8406206\|8406418	hsa-miR-8485	0	1
chr9:136940516\|136940850	hsa-miR-8485	0	1
chrX:154352306\|154352418	hsa-miR-8485	0	1
chr1:225846480\|225846626	hsa-miR-8485	0	1
chr2:47070255\|47070420	hsa-miR-8485	0	1
chr4:110050192\|110050364	hsa-miR-8485	0	1
chr2:96860205\|96860393	hsa-miR-8485	0	1
chr12:122061199\|122061341	hsa-miR-8485	0	1
chr7:135675751\|135675921	hsa-miR-8485	0	1
chr4:158833556\|158833854	hsa-miR-8485	0	1
chr16:89638286\|89638400	hsa-miR-8485	0	1
chr16:67883592\|67883664	hsa-miR-8485	0	1
chr12:89521918\|89522067	hsa-miR-8485	0	1
chr12:10851413\|10851651	hsa-miR-8485	0	1
chr2:105893768\|105893996	hsa-miR-8485	0	1
chr6:30897117\|30897469	hsa-miR-8485	0	1
chr17:4164749\|4164891	hsa-miR-8485	0	1
chr6:15520672\|15520807	hsa-miR-8485	1	0
chr19:41207247\|41207408	hsa-miR-8485	1	0
chr2:85344299\|85344659	hsa-miR-8485	1	0
chr4:121127239\|121127384	hsa-miR-8485	1	0
chr12:38652567\|38652810	hsa-miR-8485	1	0
chr1:26854817\|26854993	hsa-miR-8485	1	0
chr6:15520613\|15520807	hsa-miR-8485	1	0
chr2:241745876\|241746037	hsa-miR-8485	1	0
chr17:8160598\|8160790	hsa-miR-8485	1	0
chr10:112446208\|112446340	hsa-miR-8485	1	0
chr10:70879329\|70879492	hsa-miR-8485	1	0
chr11:57407405\|57407769	hsa-miR-8485	1	0
chrX:68841242\|68841524	hsa-miR-8485	1	0
chr20:36607797\|36607931	hsa-miR-8485	1	0
chr1:43704712\|43704917	hsa-miR-8485	1	0
chr14:104889565\|104892991	hsa-miR-8485	1	0
chr11:1753339\|1753479	hsa-miR-8485	1	0
chr5:126777216\|126777421	hsa-miR-8485	1	0
chr9:35104471\|35104628	hsa-miR-8485	1	0
chr12:117208269\|117208626	hsa-miR-8485	1	0
chr6:15520611\|15520807	hsa-miR-8485	1	0
chr16:79598232\|79598438	hsa-miR-8485	1	0
chr9:123103934\|123104067	hsa-miR-8485	1	0
chr17:78972672\|78973037	hsa-miR-8485	1	0
chr15:89834422\|89834591	hsa-miR-8485	1	0
chr5:97030440\|97030714	hsa-miR-8485	1	0
chr17:43015302\|43015444	hsa-miR-8485	1	0
chr16:30084257\|30084370	hsa-miR-8485	1	0
chr6:143060977\|143061295	hsa-miR-8485	1	0
chr3:128813336\|128813721	hsa-miR-8485	1	0
chr16:81711260\|81711520	hsa-miR-8485	1	0
chr16:67438444\|67438563	hsa-miR-8485	1	0
chr3:143122506\|143122639	hsa-miR-8485	1	0
chr22:37772849\|37773136	hsa-miR-8485	1	0
chr11:59637884\|59638056	hsa-miR-8485	1	0
chr19:35123275\|35123594	hsa-miR-8485	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-8485	TARDBP	TAR DNA binding protein	HGNC:11571	details
hsa-miR-8485	SERINC1	serine incorporator 1	HGNC:13464	details
hsa-miR-8485	FLCN	folliculin	HGNC:27310	details
hsa-miR-8485	SHOC2	SHOC2 leucine rich repeat scaffold protein	HGNC:15454	details
hsa-miR-8485	NR3C1	nuclear receptor subfamily 3 group C member 1	HGNC:7978	details
hsa-miR-8485	CANX	calnexin	HGNC:1473	details
hsa-miR-8485	C5orf51	chromosome 5 open reading frame 51	HGNC:27750	details
hsa-miR-8485	FAM177A1	family with sequence similarity 177 member A1	HGNC:19829	details
hsa-miR-8485	ALPK3	alpha kinase 3	HGNC:17574	details
hsa-miR-8485	SF3B3	splicing factor 3b subunit 3	HGNC:10770	details
hsa-miR-8485	PNRC1	proline rich nuclear receptor coactivator 1	HGNC:17278	details
hsa-miR-8485	CTBP2	C-terminal binding protein 2	HGNC:2495	details
hsa-miR-8485	PPTC7	protein phosphatase targeting COQ7	HGNC:30695	details
hsa-miR-8485	MMAB	metabolism of cobalamin associated B	HGNC:19331	details
hsa-miR-8485	TIGIT	T cell immunoreceptor with Ig and ITIM domains	HGNC:26838	details
hsa-miR-8485	ZNF780A	zinc finger protein 780A	HGNC:27603	details
hsa-miR-8485	ATP6V0D1	ATPase H+ transporting V0 subunit d1	HGNC:13724	details
hsa-miR-8485	RAB11FIP5	RAB11 family interacting protein 5	HGNC:24845	details
hsa-miR-8485	TBPL1	TATA-box binding protein like 1	HGNC:11589	details
hsa-miR-8485	MTHFD2	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	HGNC:7434	details
hsa-miR-8485	LPAR3	lysophosphatidic acid receptor 3	HGNC:14298	details
hsa-miR-8485	RTL6	retrotransposon Gag like 6	HGNC:13343	details
hsa-miR-8485	KCTD11	potassium channel tetramerization domain containing 11	HGNC:21302	details
hsa-miR-8485	CLIC4	chloride intracellular channel 4	HGNC:13518	details
hsa-miR-8485	TSPAN2	tetraspanin 2	HGNC:20659	details
hsa-miR-8485	KCNK1	potassium two pore domain channel subfamily K member 1	HGNC:6272	details
hsa-miR-8485	TMEM132B	transmembrane protein 132B	HGNC:29397	details
hsa-miR-8485	CASD1	CAS1 domain containing 1	HGNC:16014	details
hsa-miR-8485	HHIP	hedgehog interacting protein	HGNC:14866	details
hsa-miR-8485	AGPS	alkylglycerone phosphate synthase	HGNC:327	details
hsa-miR-8485	STARD8	StAR related lipid transfer domain containing 8	HGNC:19161	details
hsa-miR-8485	CSTF1	cleavage stimulation factor subunit 1	HGNC:2483	details
hsa-miR-8485	ZDHHC5	zinc finger DHHC-type palmitoyltransferase 5	HGNC:18472	details
hsa-miR-8485	KPNA4	karyopherin subunit alpha 4	HGNC:6397	details
hsa-miR-8485	KLHL23	kelch like family member 23	HGNC:27506	details
hsa-miR-8485	HMGB2	high mobility group box 2	HGNC:5000	details
hsa-miR-8485	DIRAS2	DIRAS family GTPase 2	HGNC:19323	details
hsa-miR-8485	CRK	CRK proto-oncogene, adaptor protein	HGNC:2362	details
hsa-miR-8485	RHOQ	ras homolog family member Q	HGNC:17736	details
hsa-miR-8485	LRRC63	leucine rich repeat containing 63	HGNC:34296	details
hsa-miR-8485	SLC35E3	solute carrier family 35 member E3	HGNC:20864	details
hsa-miR-8485	WDR72	WD repeat domain 72	HGNC:26790	details
hsa-miR-8485	CCT4	chaperonin containing TCP1 subunit 4	HGNC:1617	details
hsa-miR-8485	WDR17	WD repeat domain 17	HGNC:16661	details
hsa-miR-8485	TECRL	trans-2,3-enoyl-CoA reductase like	HGNC:27365	details
hsa-miR-8485	AJAP1	adherens junctions associated protein 1	HGNC:30801	details
hsa-miR-8485	AR	androgen receptor	HGNC:644	details
hsa-miR-8485	DBT	dihydrolipoamide branched chain transacylase E2	HGNC:2698	details
hsa-miR-8485	PIK3CG	phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma	HGNC:8978	details
hsa-miR-8485	VENTX	VENT homeobox	HGNC:13639	details
hsa-miR-8485	SCIN	scinderin	HGNC:21695	details
hsa-miR-8485	COL8A1	collagen type VIII alpha 1 chain	HGNC:2215	details
hsa-miR-8485	CD180	CD180 molecule	HGNC:6726	details
hsa-miR-8485	ZMYM2	zinc finger MYM-type containing 2	HGNC:12989	details
hsa-miR-8485	ZBTB20	zinc finger and BTB domain containing 20	HGNC:13503	details
hsa-miR-8485	UCHL3	ubiquitin C-terminal hydrolase L3	HGNC:12515	details
hsa-miR-8485	UBN2	ubinuclein 2	HGNC:21931	details
hsa-miR-8485	PLRG1	pleiotropic regulator 1	HGNC:9089	details
hsa-miR-8485	PLAG1	PLAG1 zinc finger	HGNC:9045	details
hsa-miR-8485	PIK3R1	phosphoinositide-3-kinase regulatory subunit 1	HGNC:8979	details
hsa-miR-8485	PIAS1	protein inhibitor of activated STAT 1	HGNC:2752	details
hsa-miR-8485	PHAX	phosphorylated adaptor for RNA export	HGNC:10241	details
hsa-miR-8485	PDCD10	programmed cell death 10	HGNC:8761	details
hsa-miR-8485	MSL1	MSL complex subunit 1	HGNC:27905	details
hsa-miR-8485	MON1B	MON1 homolog B, secretory trafficking associated	HGNC:25020	details
hsa-miR-8485	NEXMIF	neurite extension and migration factor	HGNC:29433	details
hsa-miR-8485	IPO5	importin 5	HGNC:6402	details
hsa-miR-8485	INTU	inturned planar cell polarity protein	HGNC:29239	details
hsa-miR-8485	IL6ST	interleukin 6 cytokine family signal transducer	HGNC:6021	details
hsa-miR-8485	IL1RAPL1	interleukin 1 receptor accessory protein like 1	HGNC:5996	details
hsa-miR-8485	FBXO9	F-box protein 9	HGNC:13588	details
hsa-miR-8485	EIF5	eukaryotic translation initiation factor 5	HGNC:3299	details
hsa-miR-8485	CFL2	cofilin 2	HGNC:1875	details
hsa-miR-8485	BRMS1L	BRMS1 like transcriptional repressor	HGNC:20512	details
hsa-miR-8485	BRI3BP	BRI3 binding protein	HGNC:14251	details
hsa-miR-8485	BACH1	BTB domain and CNC homolog 1	HGNC:935	details
hsa-miR-8485	ANKRD44	ankyrin repeat domain 44	HGNC:25259	details
hsa-miR-8485	AMMECR1	AMMECR nuclear protein 1	HGNC:467	details
hsa-miR-8485	AFF1	AF4/FMR2 family member 1	HGNC:7135	details
hsa-miR-8485	DROSHA	drosha ribonuclease III	HGNC:17904	details
hsa-miR-8485	CCDC169	coiled-coil domain containing 169	HGNC:34361	details
hsa-miR-8485	POU5F1B	POU class 5 homeobox 1B	HGNC:9223	details
hsa-miR-8485	IL5RA	interleukin 5 receptor subunit alpha	HGNC:6017	details
hsa-miR-8485	HAT1	histone acetyltransferase 1	HGNC:4821	details
hsa-miR-8485	LRRC38	leucine rich repeat containing 38	HGNC:27005	details
hsa-miR-8485	CNTF	ciliary neurotrophic factor	HGNC:2169	details
hsa-miR-8485	ISLR2	immunoglobulin superfamily containing leucine rich repeat 2	HGNC:29286	details
hsa-miR-8485	XPNPEP3	X-prolyl aminopeptidase 3	HGNC:28052	details
hsa-miR-8485	ADAM33	ADAM metallopeptidase domain 33	HGNC:15478	details
hsa-miR-8485	IGBP1	immunoglobulin binding protein 1	HGNC:5461	details
hsa-miR-8485	MPO	myeloperoxidase	HGNC:7218	details
hsa-miR-8485	WAPL	WAPL cohesin release factor	HGNC:23293	details
hsa-miR-8485	VANGL1	VANGL planar cell polarity protein 1	HGNC:15512	details
hsa-miR-8485	TATDN2	TatD DNase domain containing 2	HGNC:28988	details
hsa-miR-8485	ESYT2	extended synaptotagmin 2	HGNC:22211	details
hsa-miR-8485	DYRK2	dual specificity tyrosine phosphorylation regulated kinase 2	HGNC:3093	details
hsa-miR-8485				details
hsa-miR-8485	ARID3A	AT-rich interaction domain 3A	HGNC:3031	details
hsa-miR-8485	ZNF556	zinc finger protein 556	HGNC:25669	details
hsa-miR-8485	CD19	CD19 molecule	HGNC:1633	details
hsa-miR-8485	PHEX	phosphate regulating endopeptidase homolog X-linked	HGNC:8918	details
hsa-miR-8485	EID1	EP300 interacting inhibitor of differentiation 1	HGNC:1191	details
hsa-miR-8485	KIAA0408	KIAA0408	HGNC:21636	details
hsa-miR-8485	NDUFA5	NADH:ubiquinone oxidoreductase subunit A5	HGNC:7688	details
hsa-miR-8485	DNTTIP2	deoxynucleotidyltransferase terminal interacting protein 2	HGNC:24013	details
hsa-miR-8485	MTA3	metastasis associated 1 family member 3	HGNC:23784	details
hsa-miR-8485	LILRB2	leukocyte immunoglobulin like receptor B2	HGNC:6606	details
hsa-miR-8485	ABHD18	abhydrolase domain containing 18	HGNC:26111	details
hsa-miR-8485	AFF2	AF4/FMR2 family member 2	HGNC:3776	details
hsa-miR-8485	GSTM4	glutathione S-transferase mu 4	HGNC:4636	details
hsa-miR-8485	SH3PXD2A	SH3 and PX domains 2A	HGNC:23664	details
hsa-miR-8485				details
hsa-miR-8485	ATAT1	alpha tubulin acetyltransferase 1	HGNC:21186	details
hsa-miR-8485	OCLN	occludin	HGNC:8104	details
hsa-miR-8485	ZC3H6	zinc finger CCCH-type containing 6	HGNC:24762	details
hsa-miR-8485	MC2R	melanocortin 2 receptor	HGNC:6930	details
hsa-miR-8485	MLLT6	MLLT6, PHD finger containing	HGNC:7138	details
hsa-miR-8485	ZMAT4	zinc finger matrin-type 4	HGNC:25844	details
hsa-miR-8485	DMXL1	Dmx like 1	HGNC:2937	details
hsa-miR-8485	NLRP8	NLR family pyrin domain containing 8	HGNC:22940	details
hsa-miR-8485	LHFPL3	LHFPL tetraspan subfamily member 3	HGNC:6589	details
hsa-miR-8485	ATG10	autophagy related 10	HGNC:20315	details
hsa-miR-8485	STRN	striatin	HGNC:11424	details
hsa-miR-8485	CRISPLD2	cysteine rich secretory protein LCCL domain containing 2	HGNC:25248	details
hsa-miR-8485	RALGPS1	Ral GEF with PH domain and SH3 binding motif 1	HGNC:16851	details
hsa-miR-8485	TBRG4	transforming growth factor beta regulator 4	HGNC:17443	details
hsa-miR-8485	PDZD2	PDZ domain containing 2	HGNC:18486	details
hsa-miR-8485	ST8SIA4	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	HGNC:10871	details
hsa-miR-8485	STRBP	spermatid perinuclear RNA binding protein	HGNC:16462	details
hsa-miR-8485	SOGA3	SOGA family member 3	HGNC:21494	details
hsa-miR-8485	MYADM	myeloid associated differentiation marker	HGNC:7544	details
hsa-miR-8485	KCNJ12	potassium inwardly rectifying channel subfamily J member 12	HGNC:6258	details
hsa-miR-8485	FRMD3	FERM domain containing 3	HGNC:24125	details
hsa-miR-8485	ARHGAP12	Rho GTPase activating protein 12	HGNC:16348	details
hsa-miR-8485	ARF3	ADP ribosylation factor 3	HGNC:654	details
hsa-miR-8485	SYT5	synaptotagmin 5	HGNC:11513	details
hsa-miR-8485	PELP1	proline, glutamate and leucine rich protein 1	HGNC:30134	details
hsa-miR-8485				details
hsa-miR-8485	CCDC160	coiled-coil domain containing 160	HGNC:37286	details
hsa-miR-8485	PLCL1	phospholipase C like 1 (inactive)	HGNC:9063	details
hsa-miR-8485	KIAA0232	KIAA0232	HGNC:28992	details
hsa-miR-8485	MGAT5	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase	HGNC:7049	details
hsa-miR-8485	SLC16A9	solute carrier family 16 member 9	HGNC:23520	details
hsa-miR-8485	NBPF10	NBPF member 10	HGNC:31992	details
hsa-miR-8485	FAM180B	family with sequence similarity 180 member B	HGNC:34451	details
hsa-miR-8485	ASS1	argininosuccinate synthase 1	HGNC:758	details
hsa-miR-8485	KCNK10	potassium two pore domain channel subfamily K member 10	HGNC:6273	details
hsa-miR-8485	REXO2	RNA exonuclease 2	HGNC:17851	details
hsa-miR-8485	NPTXR	neuronal pentraxin receptor	HGNC:7954	details
hsa-miR-8485	EPHB3	EPH receptor B3	HGNC:3394	details
hsa-miR-8485	EGR3	early growth response 3	HGNC:3240	details
hsa-miR-8485	CSRNP3	cysteine and serine rich nuclear protein 3	HGNC:30729	details
hsa-miR-8485	IRS1	insulin receptor substrate 1	HGNC:6125	details
hsa-miR-8485	VAC14	VAC14 component of PIKFYVE complex	HGNC:25507	details
hsa-miR-8485	TFCP2	transcription factor CP2	HGNC:11748	details
hsa-miR-8485	ZC3H12C	zinc finger CCCH-type containing 12C	HGNC:29362	details
hsa-miR-8485				details
hsa-miR-8485	SLC6A6	solute carrier family 6 member 6	HGNC:11052	details
hsa-miR-8485	PLEKHA3	pleckstrin homology domain containing A3	HGNC:14338	details
hsa-miR-8485	MAPK6	mitogen-activated protein kinase 6	HGNC:6879	details
hsa-miR-8485	KLHL42	kelch like family member 42	HGNC:29252	details
hsa-miR-8485	CYLD	CYLD lysine 63 deubiquitinase	HGNC:2584	details
hsa-miR-8485	LAMTOR3	late endosomal/lysosomal adaptor, MAPK and MTOR activator 3	HGNC:15606	details
hsa-miR-8485	UGT2B4	UDP glucuronosyltransferase family 2 member B4	HGNC:12553	details
hsa-miR-8485	ZNF551	zinc finger protein 551	HGNC:25108	details
hsa-miR-8485	SLC12A2	solute carrier family 12 member 2	HGNC:10911	details
hsa-miR-8485	NDUFS1	NADH:ubiquinone oxidoreductase core subunit S1	HGNC:7707	details
hsa-miR-8485	TAOK1	TAO kinase 1	HGNC:29259	details
hsa-miR-8485	HOXA5	homeobox A5	HGNC:5106	details
hsa-miR-8485	ASH1L	ASH1 like histone lysine methyltransferase	HGNC:19088	details
hsa-miR-8485	ACSL4	acyl-CoA synthetase long chain family member 4	HGNC:3571	details
hsa-miR-8485	NUP37	nucleoporin 37	HGNC:29929	details
hsa-miR-8485	RHCG	Rh family C glycoprotein	HGNC:18140	details
hsa-miR-8485	CLEC12A	C-type lectin domain family 12 member A	HGNC:31713	details
hsa-miR-8485	PLCXD1	phosphatidylinositol specific phospholipase C X domain containing 1	HGNC:23148	details
hsa-miR-8485	OPN5	opsin 5	HGNC:19992	details
hsa-miR-8485	POT1	protection of telomeres 1	HGNC:17284	details
hsa-miR-8485	UBTF	upstream binding transcription factor	HGNC:12511	details
hsa-miR-8485	RASSF6	Ras association domain family member 6	HGNC:20796	details
hsa-miR-8485	MESD	mesoderm development LRP chaperone	HGNC:13520	details
hsa-miR-8485	ZNF562	zinc finger protein 562	HGNC:25950	details
hsa-miR-8485	VEGFA	vascular endothelial growth factor A	HGNC:12680	details
hsa-miR-8485	TRAF5	TNF receptor associated factor 5	HGNC:12035	details
hsa-miR-8485	TNRC6B	trinucleotide repeat containing adaptor 6B	HGNC:29190	details
hsa-miR-8485	TIMM10	translocase of inner mitochondrial membrane 10	HGNC:11814	details
hsa-miR-8485	SYNCRIP	synaptotagmin binding cytoplasmic RNA interacting protein	HGNC:16918	details
hsa-miR-8485	SV2B	synaptic vesicle glycoprotein 2B	HGNC:16874	details
hsa-miR-8485				details
hsa-miR-8485	KCNJ3	potassium inwardly rectifying channel subfamily J member 3	HGNC:6264	details
hsa-miR-8485	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-8485	DDX5	DEAD-box helicase 5	HGNC:2746	details
hsa-miR-8485	BLOC1S4	biogenesis of lysosomal organelles complex 1 subunit 4	HGNC:24206	details
hsa-miR-8485	RAB1A	RAB1A, member RAS oncogene family	HGNC:9758	details
hsa-miR-8485	CBX2	chromobox 2	HGNC:1552	details
hsa-miR-8485	PAGR1	PAXIP1 associated glutamate rich protein 1	HGNC:28707	details
hsa-miR-8485	YTHDF1	YTH N6-methyladenosine RNA binding protein 1	HGNC:15867	details
hsa-miR-8485	WEE1	WEE1 G2 checkpoint kinase	HGNC:12761	details
hsa-miR-8485	KCNC4	potassium voltage-gated channel subfamily C member 4	HGNC:6236	details
hsa-miR-8485	GRPEL2	GrpE like 2, mitochondrial	HGNC:21060	details
hsa-miR-8485	PPM1B	protein phosphatase, Mg2+/Mn2+ dependent 1B	HGNC:9276	details
hsa-miR-8485	LRFN1	leucine rich repeat and fibronectin type III domain containing 1	HGNC:29290	details
hsa-miR-8485	PTP4A2	protein tyrosine phosphatase 4A2	HGNC:9635	details
hsa-miR-8485				details
hsa-miR-8485	TBC1D13	TBC1 domain family member 13	HGNC:25571	details
hsa-miR-8485	PDE3A	phosphodiesterase 3A	HGNC:8778	details
hsa-miR-8485	AKAP11	A-kinase anchoring protein 11	HGNC:369	details
hsa-miR-8485	EVI2A	ecotropic viral integration site 2A	HGNC:3499	details
hsa-miR-8485	DONSON	DNA replication fork stabilization factor DONSON	HGNC:2993	details
hsa-miR-8485	PHKA1	phosphorylase kinase regulatory subunit alpha 1	HGNC:8925	details
hsa-miR-8485	KCNB1	potassium voltage-gated channel subfamily B member 1	HGNC:6231	details
hsa-miR-8485	SGIP1	SH3GL interacting endocytic adaptor 1	HGNC:25412	details
hsa-miR-8485	SERBP1	SERPINE1 mRNA binding protein 1	HGNC:17860	details
hsa-miR-8485	SLC25A44	solute carrier family 25 member 44	HGNC:29036	details
hsa-miR-8485				details
hsa-miR-8485	TPGS2	tubulin polyglutamylase complex subunit 2	HGNC:24561	details
hsa-miR-8485	P2RY1	purinergic receptor P2Y1	HGNC:8539	details
hsa-miR-8485	TNFRSF21	TNF receptor superfamily member 21	HGNC:13469	details
hsa-miR-8485	ETS1	ETS proto-oncogene 1, transcription factor	HGNC:3488	details
hsa-miR-8485	SLC1A5	solute carrier family 1 member 5	HGNC:10943	details
hsa-miR-8485	SYT2	synaptotagmin 2	HGNC:11510	details
hsa-miR-8485	TMEM30B	transmembrane protein 30B	HGNC:27254	details
hsa-miR-8485	MYSM1	Myb like, SWIRM and MPN domains 1	HGNC:29401	details
hsa-miR-8485	PIWIL2	piwi like RNA-mediated gene silencing 2	HGNC:17644	details
hsa-miR-8485	PRKX	protein kinase X-linked	HGNC:9441	details
hsa-miR-8485	CD36	CD36 molecule	HGNC:1663	details
hsa-miR-8485	ABCF3	ATP binding cassette subfamily F member 3	HGNC:72	details
hsa-miR-8485	BNC2	basonuclin 2	HGNC:30988	details
hsa-miR-8485	COPS7B	COP9 signalosome subunit 7B	HGNC:16760	details
hsa-miR-8485	MCTS1	MCTS1 re-initiation and release factor	HGNC:23357	details
hsa-miR-8485	CACUL1	CDK2 associated cullin domain 1	HGNC:23727	details
hsa-miR-8485	ZXDA	zinc finger X-linked duplicated A	HGNC:13198	details
hsa-miR-8485	UNC5B	unc-5 netrin receptor B	HGNC:12568	details
hsa-miR-8485				details
hsa-miR-8485	ZDHHC22	zinc finger DHHC-type palmitoyltransferase 22	HGNC:20106	details
hsa-miR-8485	RNF152	ring finger protein 152	HGNC:26811	details
hsa-miR-8485	STAT5B	signal transducer and activator of transcription 5B	HGNC:11367	details
hsa-miR-8485	FLT1	fms related receptor tyrosine kinase 1	HGNC:3763	details
hsa-miR-8485	EPG5	ectopic P-granules autophagy protein 5 homolog	HGNC:29331	details
hsa-miR-8485	NFAT5	nuclear factor of activated T cells 5	HGNC:7774	details
hsa-miR-8485	TMEM178B	transmembrane protein 178B	HGNC:44112	details
hsa-miR-8485	TMPPE	transmembrane protein with metallophosphoesterase domain	HGNC:33865	details
hsa-miR-8485	CLASP1	cytoplasmic linker associated protein 1	HGNC:17088	details
hsa-miR-8485	HPS4	HPS4 biogenesis of lysosomal organelles complex 3 subunit 2	HGNC:15844	details
hsa-miR-8485				details
hsa-miR-8485	ANKLE1	ankyrin repeat and LEM domain containing 1	HGNC:26812	details
hsa-miR-8485	NMRK1	nicotinamide riboside kinase 1	HGNC:26057	details
hsa-miR-8485	MRRF	mitochondrial ribosome recycling factor	HGNC:7234	details
hsa-miR-8485	CCDC9	coiled-coil domain containing 9	HGNC:24560	details
hsa-miR-8485	KIF5C	kinesin family member 5C	HGNC:6325	details
hsa-miR-8485	ABLIM1	actin binding LIM protein 1	HGNC:78	details
hsa-miR-8485	CHRDL1	chordin like 1	HGNC:29861	details
hsa-miR-8485	KCNJ10	potassium inwardly rectifying channel subfamily J member 10	HGNC:6256	details
hsa-miR-8485				details
hsa-miR-8485	NANOS1	nanos C2HC-type zinc finger 1	HGNC:23044	details
hsa-miR-8485	SLFN5	schlafen family member 5	HGNC:28286	details
hsa-miR-8485	DHODH	dihydroorotate dehydrogenase (quinone)	HGNC:2867	details
hsa-miR-8485	GTPBP1	GTP binding protein 1	HGNC:4669	details
hsa-miR-8485	MOBP	myelin associated oligodendrocyte basic protein	HGNC:7189	details
hsa-miR-8485	HRK	harakiri, BCL2 interacting protein	HGNC:5185	details
hsa-miR-8485	MUC15	mucin 15, cell surface associated	HGNC:14956	details
hsa-miR-8485	ASAH2	N-acylsphingosine amidohydrolase 2	HGNC:18860	details
hsa-miR-8485	PTPN3	protein tyrosine phosphatase non-receptor type 3	HGNC:9655	details
hsa-miR-8485	REEP3	receptor accessory protein 3	HGNC:23711	details
hsa-miR-8485	RAPGEFL1	Rap guanine nucleotide exchange factor like 1	HGNC:17428	details
hsa-miR-8485	PAK6	p21 (RAC1) activated kinase 6	HGNC:16061	details
hsa-miR-8485	MED28	mediator complex subunit 28	HGNC:24628	details
hsa-miR-8485	LNPEP	leucyl and cystinyl aminopeptidase	HGNC:6656	details
hsa-miR-8485	MGAT4C	MGAT4 family member C	HGNC:30871	details
hsa-miR-8485	FAM216B	family with sequence similarity 216 member B	HGNC:26883	details
hsa-miR-8485	PARN	poly(A)-specific ribonuclease	HGNC:8609	details
hsa-miR-8485	PCK1	phosphoenolpyruvate carboxykinase 1	HGNC:8724	details
hsa-miR-8485	SLC30A3	solute carrier family 30 member 3	HGNC:11014	details
hsa-miR-8485	GLCCI1	glucocorticoid induced 1	HGNC:18713	details
hsa-miR-8485	ATP9A	ATPase phospholipid transporting 9A (putative)	HGNC:13540	details
hsa-miR-8485	PIGS	phosphatidylinositol glycan anchor biosynthesis class S	HGNC:14937	details
hsa-miR-8485	NLRP11	NLR family pyrin domain containing 11	HGNC:22945	details
hsa-miR-8485	SMCO4	single-pass membrane protein with coiled-coil domains 4	HGNC:24810	details
hsa-miR-8485	ASAH2B	N-acylsphingosine amidohydrolase 2B	HGNC:23456	details
hsa-miR-8485				details
hsa-miR-8485				details
hsa-miR-8485	WNT7A	Wnt family member 7A	HGNC:12786	details
hsa-miR-8485	PRSS23	serine protease 23	HGNC:14370	details
hsa-miR-8485	FIG4	FIG4 phosphoinositide 5-phosphatase	HGNC:16873	details
hsa-miR-8485	TNIP3	TNFAIP3 interacting protein 3	HGNC:19315	details
hsa-miR-8485	FOXK1	forkhead box K1	HGNC:23480	details
hsa-miR-8485	CPEB3	cytoplasmic polyadenylation element binding protein 3	HGNC:21746	details
hsa-miR-8485	SYT17	synaptotagmin 17	HGNC:24119	details
hsa-miR-8485	WSCD2	WSC domain containing 2	HGNC:29117	details
hsa-miR-8485	TMEM79	transmembrane protein 79	HGNC:28196	details
hsa-miR-8485	PKNOX1	PBX/knotted 1 homeobox 1	HGNC:9022	details
hsa-miR-8485	WNT9A	Wnt family member 9A	HGNC:12778	details
hsa-miR-8485	ITGBL1	integrin subunit beta like 1	HGNC:6164	details
hsa-miR-8485	GADL1	glutamate decarboxylase like 1	HGNC:27949	details
hsa-miR-8485	KIFC1	kinesin family member C1	HGNC:6389	details
hsa-miR-8485	KIAA2026	KIAA2026	HGNC:23378	details
hsa-miR-8485	PLCE1	phospholipase C epsilon 1	HGNC:17175	details
hsa-miR-8485	IGF2R	insulin like growth factor 2 receptor	HGNC:5467	details
hsa-miR-8485	SEMA6D	semaphorin 6D	HGNC:16770	details
hsa-miR-8485	BGN	biglycan	HGNC:1044	details
hsa-miR-8485	WDR37	WD repeat domain 37	HGNC:31406	details
hsa-miR-8485	FAM126B	family with sequence similarity 126 member B	HGNC:28593	details
hsa-miR-8485	CHEK1	checkpoint kinase 1	HGNC:1925	details
hsa-miR-8485	NECAB1	N-terminal EF-hand calcium binding protein 1	HGNC:20983	details
hsa-miR-8485	TBX4	T-box transcription factor 4	HGNC:11603	details
hsa-miR-8485	RASSF4	Ras association domain family member 4	HGNC:20793	details
hsa-miR-8485				details
hsa-miR-8485	FNBP1	formin binding protein 1	HGNC:17069	details
hsa-miR-8485	CLEC14A	C-type lectin domain containing 14A	HGNC:19832	details
hsa-miR-8485	NFAM1	NFAT activating protein with ITAM motif 1	HGNC:29872	details
hsa-miR-8485	NSUN3	NOP2/Sun RNA methyltransferase 3	HGNC:26208	details
hsa-miR-8485	CAVIN4	caveolae associated protein 4	HGNC:33742	details
hsa-miR-8485	RAB3C	RAB3C, member RAS oncogene family	HGNC:30269	details
hsa-miR-8485	GPRC5A	G protein-coupled receptor class C group 5 member A	HGNC:9836	details
hsa-miR-8485	DNAL1	dynein axonemal light chain 1	HGNC:23247	details
hsa-miR-8485	SLC22A18AS	solute carrier family 22 member 18 antisense	HGNC:10965	details
hsa-miR-8485	CADPS	calcium dependent secretion activator	HGNC:1426	details
hsa-miR-8485	LY6G6E	lymphocyte antigen 6 family member G6E	HGNC:13934	details
hsa-miR-8485	FGF9	fibroblast growth factor 9	HGNC:3687	details
hsa-miR-8485	MATN1	matrilin 1	HGNC:6907	details
hsa-miR-8485	TIPRL	TOR signaling pathway regulator	HGNC:30231	details
hsa-miR-8485	ZNF670	zinc finger protein 670	HGNC:28167	details
hsa-miR-8485	HMGN5	high mobility group nucleosome binding domain 5	HGNC:8013	details
hsa-miR-8485	WDR3	WD repeat domain 3	HGNC:12755	details
hsa-miR-8485	ZBTB42	zinc finger and BTB domain containing 42	HGNC:32550	details
hsa-miR-8485	UGT8	UDP glycosyltransferase 8	HGNC:12555	details
hsa-miR-8485	GGA2	golgi associated, gamma adaptin ear containing, ARF binding protein 2	HGNC:16064	details
hsa-miR-8485	PPIC	peptidylprolyl isomerase C	HGNC:9256	details
hsa-miR-8485	DYNC1LI1	dynein cytoplasmic 1 light intermediate chain 1	HGNC:18745	details
hsa-miR-8485	EHD2	EH domain containing 2	HGNC:3243	details
hsa-miR-8485	BHLHE40	basic helix-loop-helix family member e40	HGNC:1046	details
hsa-miR-8485	NKTR	natural killer cell triggering receptor	HGNC:7833	details
hsa-miR-8485	STX1B	syntaxin 1B	HGNC:18539	details
hsa-miR-8485	ZNF703	zinc finger protein 703	HGNC:25883	details
hsa-miR-8485	MBOAT2	membrane bound O-acyltransferase domain containing 2	HGNC:25193	details
hsa-miR-8485	CDK6	cyclin dependent kinase 6	HGNC:1777	details
hsa-miR-8485	CD2AP	CD2 associated protein	HGNC:14258	details
hsa-miR-8485	SP1	Sp1 transcription factor	HGNC:11205	details
hsa-miR-8485	SYT1	synaptotagmin 1	HGNC:11509	details
hsa-miR-8485	PABPC1L2A	poly(A) binding protein cytoplasmic 1 like 2A	HGNC:27989	details
hsa-miR-8485	PTGES	prostaglandin E synthase	HGNC:9599	details
hsa-miR-8485	HMGCR	3-hydroxy-3-methylglutaryl-CoA reductase	HGNC:5006	details
hsa-miR-8485	BACH2	BTB domain and CNC homolog 2	HGNC:14078	details
hsa-miR-8485	SMIM15	small integral membrane protein 15	HGNC:33861	details
hsa-miR-8485	NUDT3	nudix hydrolase 3	HGNC:8050	details
hsa-miR-8485	ADAT2	adenosine deaminase tRNA specific 2	HGNC:21172	details
hsa-miR-8485	ZNF610	zinc finger protein 610	HGNC:26687	details
hsa-miR-8485	PNMA8B	PNMA family member 8B	HGNC:29206	details
hsa-miR-8485	DPY19L3	dpy-19 like C-mannosyltransferase 3	HGNC:27120	details
hsa-miR-8485	GOSR2	golgi SNAP receptor complex member 2	HGNC:4431	details
hsa-miR-8485	PAPOLA	poly(A) polymerase alpha	HGNC:14981	details
hsa-miR-8485	RBM23	RNA binding motif protein 23	HGNC:20155	details
hsa-miR-8485	LIN52	lin-52 DREAM MuvB core complex component	HGNC:19856	details
hsa-miR-8485	ZNF878	zinc finger protein 878	HGNC:37246	details
hsa-miR-8485	FXYD6	FXYD domain containing ion transport regulator 6	HGNC:4030	details
hsa-miR-8485	TAS2R30	taste 2 receptor member 30	HGNC:19112	details
hsa-miR-8485				details
hsa-miR-8485	DAAM2	dishevelled associated activator of morphogenesis 2	HGNC:18143	details
hsa-miR-8485	ACOT2	acyl-CoA thioesterase 2	HGNC:18431	details
hsa-miR-8485	SOD2	superoxide dismutase 2	HGNC:11180	details
hsa-miR-8485	MTX3	metaxin 3	HGNC:24812	details
hsa-miR-8485	USP27X	ubiquitin specific peptidase 27 X-linked	HGNC:13486	details
hsa-miR-8485	CCDC149	coiled-coil domain containing 149	HGNC:25405	details
hsa-miR-8485	ADAM9	ADAM metallopeptidase domain 9	HGNC:216	details
hsa-miR-8485	DNAJC19	DnaJ heat shock protein family (Hsp40) member C19	HGNC:30528	details
hsa-miR-8485	GJD2	gap junction protein delta 2	HGNC:19154	details
hsa-miR-8485	TRA2B	transformer 2 beta homolog	HGNC:10781	details
hsa-miR-8485	PLEKHA8	pleckstrin homology domain containing A8	HGNC:30037	details
hsa-miR-8485	AMPD3	adenosine monophosphate deaminase 3	HGNC:470	details
hsa-miR-8485	CTDSPL	CTD small phosphatase like	HGNC:16890	details
hsa-miR-8485	CPSF6	cleavage and polyadenylation specific factor 6	HGNC:13871	details
hsa-miR-8485	MLXIPL	MLX interacting protein like	HGNC:12744	details
hsa-miR-8485				details
hsa-miR-8485	TSPAN14	tetraspanin 14	HGNC:23303	details
hsa-miR-8485	SLBP	stem-loop binding protein	HGNC:10904	details
hsa-miR-8485	PINX1	PIN2 (TERF1) interacting telomerase inhibitor 1	HGNC:30046	details
hsa-miR-8485	ZDHHC17	zinc finger DHHC-type palmitoyltransferase 17	HGNC:18412	details
hsa-miR-8485	PLEKHA2	pleckstrin homology domain containing A2	HGNC:14336	details
hsa-miR-8485	ZNF557	zinc finger protein 557	HGNC:28632	details
hsa-miR-8485	RAD54L2	RAD54 like 2	HGNC:29123	details
hsa-miR-8485	C21orf91	chromosome 21 open reading frame 91	HGNC:16459	details
hsa-miR-8485	MACC1	MET transcriptional regulator MACC1	HGNC:30215	details
hsa-miR-8485	SEL1L3	SEL1L family member 3	HGNC:29108	details
hsa-miR-8485	SPTLC3	serine palmitoyltransferase long chain base subunit 3	HGNC:16253	details
hsa-miR-8485	MED13	mediator complex subunit 13	HGNC:22474	details
hsa-miR-8485	MYCBP	MYC binding protein	HGNC:7554	details
hsa-miR-8485	SLC23A3	solute carrier family 23 member 3	HGNC:20601	details
hsa-miR-8485	LILRB1	leukocyte immunoglobulin like receptor B1	HGNC:6605	details
hsa-miR-8485	MED24	mediator complex subunit 24	HGNC:22963	details
hsa-miR-8485	RNF121	ring finger protein 121	HGNC:21070	details
hsa-miR-8485	LONRF2	LON peptidase N-terminal domain and ring finger 2	HGNC:24788	details
hsa-miR-8485	CNOT6	CCR4-NOT transcription complex subunit 6	HGNC:14099	details
hsa-miR-8485	CRLF1	cytokine receptor like factor 1	HGNC:2364	details
hsa-miR-8485	CSNK1D	casein kinase 1 delta	HGNC:2452	details
hsa-miR-8485	KRTAP4-9	keratin associated protein 4-9	HGNC:18910	details
hsa-miR-8485	ARL4C	ADP ribosylation factor like GTPase 4C	HGNC:698	details
hsa-miR-8485	FOXI2	forkhead box I2	HGNC:32448	details
hsa-miR-8485	DOK6	docking protein 6	HGNC:28301	details
hsa-miR-8485	PRMT8	protein arginine methyltransferase 8	HGNC:5188	details
hsa-miR-8485	FBXL18	F-box and leucine rich repeat protein 18	HGNC:21874	details
hsa-miR-8485	SPATA13	spermatogenesis associated 13	HGNC:23222	details
hsa-miR-8485				details
hsa-miR-8485	CD99	CD99 molecule (Xg blood group)	HGNC:7082	details
hsa-miR-8485	ZDHHC21	zinc finger DHHC-type palmitoyltransferase 21	HGNC:20750	details
hsa-miR-8485	HDAC9	histone deacetylase 9	HGNC:14065	details
hsa-miR-8485	PTCHD1	patched domain containing 1	HGNC:26392	details
hsa-miR-8485	ACOT9	acyl-CoA thioesterase 9	HGNC:17152	details
hsa-miR-8485	WT1	WT1 transcription factor	HGNC:12796	details
hsa-miR-8485				details
hsa-miR-8485	PLXDC2	plexin domain containing 2	HGNC:21013	details
hsa-miR-8485	CBY3	chibby family member 3	HGNC:33278	details
hsa-miR-8485	GRIPAP1	GRIP1 associated protein 1	HGNC:18706	details
hsa-miR-8485				details
hsa-miR-8485	TMEM245	transmembrane protein 245	HGNC:1363	details
hsa-miR-8485				details
hsa-miR-8485	AKAP2	A-kinase anchoring protein 2	HGNC:372	details
hsa-miR-8485	CSMD2	CUB and Sushi multiple domains 2	HGNC:19290	details
hsa-miR-8485	SGPL1	sphingosine-1-phosphate lyase 1	HGNC:10817	details
hsa-miR-8485	FOXP4	forkhead box P4	HGNC:20842	details
hsa-miR-8485	MTF1	metal regulatory transcription factor 1	HGNC:7428	details
hsa-miR-8485	TAF8	TATA-box binding protein associated factor 8	HGNC:17300	details
hsa-miR-8485	SYNPO2L	synaptopodin 2 like	HGNC:23532	details
hsa-miR-8485	BMP5	bone morphogenetic protein 5	HGNC:1072	details
hsa-miR-8485	GPC4	glypican 4	HGNC:4452	details
hsa-miR-8485	PRRG3	proline rich and Gla domain 3	HGNC:30798	details
hsa-miR-8485	GSTM5	glutathione S-transferase mu 5	HGNC:4637	details
hsa-miR-8485	WNT2B	Wnt family member 2B	HGNC:12781	details
hsa-miR-8485	NBPF14	NBPF member 14	HGNC:25232	details
hsa-miR-8485				details
hsa-miR-8485				details
hsa-miR-8485	NUS1	NUS1 dehydrodolichyl diphosphate synthase subunit	HGNC:21042	details
hsa-miR-8485	SPTA1	spectrin alpha, erythrocytic 1	HGNC:11272	details
hsa-miR-8485	CADM3	cell adhesion molecule 3	HGNC:17601	details
hsa-miR-8485				details
hsa-miR-8485	ZNF548	zinc finger protein 548	HGNC:26561	details
hsa-miR-8485	GPX6	glutathione peroxidase 6	HGNC:4558	details
hsa-miR-8485	LRIG2	leucine rich repeats and immunoglobulin like domains 2	HGNC:20889	details
hsa-miR-8485	NUDT16	nudix hydrolase 16	HGNC:26442	details
hsa-miR-8485	KCNK5	potassium two pore domain channel subfamily K member 5	HGNC:6280	details
hsa-miR-8485	ARNT	aryl hydrocarbon receptor nuclear translocator	HGNC:700	details
hsa-miR-8485	COL9A1	collagen type IX alpha 1 chain	HGNC:2217	details
hsa-miR-8485	ZNF585A	zinc finger protein 585A	HGNC:26305	details
hsa-miR-8485	SCN8A	sodium voltage-gated channel alpha subunit 8	HGNC:10596	details
hsa-miR-8485	GNAI1	G protein subunit alpha i1	HGNC:4384	details
hsa-miR-8485	FCN2	ficolin 2	HGNC:3624	details
hsa-miR-8485	NF2	neurofibromin 2	HGNC:7773	details
hsa-miR-8485	CHST15	carbohydrate sulfotransferase 15	HGNC:18137	details
hsa-miR-8485	STAT5A	signal transducer and activator of transcription 5A	HGNC:11366	details
hsa-miR-8485	ADRB3	adrenoceptor beta 3	HGNC:288	details
hsa-miR-8485	PLEKHG7	pleckstrin homology and RhoGEF domain containing G7	HGNC:33829	details
hsa-miR-8485	CXCL12	C-X-C motif chemokine ligand 12	HGNC:10672	details
hsa-miR-8485	RDX	radixin	HGNC:9944	details
hsa-miR-8485	GNA14	G protein subunit alpha 14	HGNC:4382	details
hsa-miR-8485	FGFR3	fibroblast growth factor receptor 3	HGNC:3690	details
hsa-miR-8485	FASLG	Fas ligand	HGNC:11936	details
hsa-miR-8485	ZNF621	zinc finger protein 621	HGNC:24787	details
hsa-miR-8485	PHF8	PHD finger protein 8	HGNC:20672	details
hsa-miR-8485	STARD7	StAR related lipid transfer domain containing 7	HGNC:18063	details
hsa-miR-8485	BTLA	B and T lymphocyte associated	HGNC:21087	details
hsa-miR-8485	SREK1	splicing regulatory glutamic acid and lysine rich protein 1	HGNC:17882	details
hsa-miR-8485	GPR173	G protein-coupled receptor 173	HGNC:18186	details
hsa-miR-8485	NPBWR1	neuropeptides B and W receptor 1	HGNC:4522	details
hsa-miR-8485	CLN8	CLN8 transmembrane ER and ERGIC protein	HGNC:2079	details
hsa-miR-8485	FAM174B	family with sequence similarity 174 member B	HGNC:34339	details
hsa-miR-8485	ACAP2	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	HGNC:16469	details
hsa-miR-8485	TMEM78	transmembrane protein 78	HGNC:32307	details
hsa-miR-8485	EHD3	EH domain containing 3	HGNC:3244	details
hsa-miR-8485	MOB3C	MOB kinase activator 3C	HGNC:29800	details
hsa-miR-8485	CA8	carbonic anhydrase 8	HGNC:1382	details
hsa-miR-8485	USF3	upstream transcription factor family member 3	HGNC:30494	details
hsa-miR-8485	FZD2	frizzled class receptor 2	HGNC:4040	details
hsa-miR-8485	PNMA8A	PNMA family member 8A	HGNC:25578	details
hsa-miR-8485	PEAK1	pseudopodium enriched atypical kinase 1	HGNC:29431	details
hsa-miR-8485	ZNF431	zinc finger protein 431	HGNC:20809	details
hsa-miR-8485	C11orf45	chromosome 11 open reading frame 45	HGNC:28584	details
hsa-miR-8485				details
hsa-miR-8485	LRP8	LDL receptor related protein 8	HGNC:6700	details
hsa-miR-8485	HSPA4	heat shock protein family A (Hsp70) member 4	HGNC:5237	details
hsa-miR-8485	OR1L3	olfactory receptor family 1 subfamily L member 3	HGNC:8215	details
hsa-miR-8485	ADCYAP1R1	ADCYAP receptor type I	HGNC:242	details
hsa-miR-8485	DDB1	damage specific DNA binding protein 1	HGNC:2717	details
hsa-miR-8485	ZNF428	zinc finger protein 428	HGNC:20804	details
hsa-miR-8485	NAT16	N-acetyltransferase 16 (putative)	HGNC:22030	details
hsa-miR-8485	CLEC4D	C-type lectin domain family 4 member D	HGNC:14554	details
hsa-miR-8485	JAKMIP3	Janus kinase and microtubule interacting protein 3	HGNC:23523	details
hsa-miR-8485	AQP3	aquaporin 3 (Gill blood group)	HGNC:636	details
hsa-miR-8485	SLFN13	schlafen family member 13	HGNC:26481	details
hsa-miR-8485	CACNA1B	calcium voltage-gated channel subunit alpha1 B	HGNC:1389	details
hsa-miR-8485	PLA2G7	phospholipase A2 group VII	HGNC:9040	details
hsa-miR-8485	TBCK	TBC1 domain containing kinase	HGNC:28261	details
hsa-miR-8485	ABCG8	ATP binding cassette subfamily G member 8	HGNC:13887	details
hsa-miR-8485	CACNG8	calcium voltage-gated channel auxiliary subunit gamma 8	HGNC:13628	details
hsa-miR-8485	MED16	mediator complex subunit 16	HGNC:17556	details
hsa-miR-8485	TCF12	transcription factor 12	HGNC:11623	details
hsa-miR-8485	ICAM1	intercellular adhesion molecule 1	HGNC:5344	details
hsa-miR-8485	NNT	nicotinamide nucleotide transhydrogenase	HGNC:7863	details
hsa-miR-8485	GSK3B	glycogen synthase kinase 3 beta	HGNC:4617	details
hsa-miR-8485	RAB3GAP1	RAB3 GTPase activating protein catalytic subunit 1	HGNC:17063	details
hsa-miR-8485	SLC5A7	solute carrier family 5 member 7	HGNC:14025	details
hsa-miR-8485	PKD1	polycystin 1, transient receptor potential channel interacting	HGNC:9008	details
hsa-miR-8485	ZNF175	zinc finger protein 175	HGNC:12964	details
hsa-miR-8485	FOXF2	forkhead box F2	HGNC:3810	details
hsa-miR-8485	HEMGN	hemogen	HGNC:17509	details
hsa-miR-8485	NDRG4	NDRG family member 4	HGNC:14466	details
hsa-miR-8485	CEP135	centrosomal protein 135	HGNC:29086	details
hsa-miR-8485	ZNF764	zinc finger protein 764	HGNC:28200	details
hsa-miR-8485	CLN6	CLN6 transmembrane ER protein	HGNC:2077	details
hsa-miR-8485	TCF15	transcription factor 15	HGNC:11627	details
hsa-miR-8485	TWIST1	twist family bHLH transcription factor 1	HGNC:12428	details
hsa-miR-8485	CCDC77	coiled-coil domain containing 77	HGNC:28203	details
hsa-miR-8485	UMPS	uridine monophosphate synthetase	HGNC:12563	details
hsa-miR-8485				details
hsa-miR-8485	ABCC6	ATP binding cassette subfamily C member 6	HGNC:57	details
hsa-miR-8485	PDZD4	PDZ domain containing 4	HGNC:21167	details
hsa-miR-8485	ZNF226	zinc finger protein 226	HGNC:13019	details
hsa-miR-8485	ZFX	zinc finger protein X-linked	HGNC:12869	details
hsa-miR-8485	ZFP14	ZFP14 zinc finger protein	HGNC:29312	details
hsa-miR-8485	UBE2H	ubiquitin conjugating enzyme E2 H	HGNC:12484	details
hsa-miR-8485	TNRC6C	trinucleotide repeat containing adaptor 6C	HGNC:29318	details
hsa-miR-8485	TNPO1	transportin 1	HGNC:6401	details
hsa-miR-8485	TMOD2	tropomodulin 2	HGNC:11872	details
hsa-miR-8485	TCTE1	t-complex-associated-testis-expressed 1	HGNC:11693	details
hsa-miR-8485	STX7	syntaxin 7	HGNC:11442	details
hsa-miR-8485	SPAG7	sperm associated antigen 7	HGNC:11216	details
hsa-miR-8485	SOX9	SRY-box transcription factor 9	HGNC:11204	details
hsa-miR-8485	SMAD2	SMAD family member 2	HGNC:6768	details
hsa-miR-8485	SIK1	salt inducible kinase 1	HGNC:11142	details
hsa-miR-8485	SAMD4A	sterile alpha motif domain containing 4A	HGNC:23023	details
hsa-miR-8485	RSF1	remodeling and spacing factor 1	HGNC:18118	details
hsa-miR-8485	RUNX1	RUNX family transcription factor 1	HGNC:10471	details
hsa-miR-8485	RPAP2	RNA polymerase II associated protein 2	HGNC:25791	details
hsa-miR-8485	RORA	RAR related orphan receptor A	HGNC:10258	details
hsa-miR-8485	RABL3	RAB, member of RAS oncogene family like 3	HGNC:18072	details
hsa-miR-8485	PPM1A	protein phosphatase, Mg2+/Mn2+ dependent 1A	HGNC:9275	details
hsa-miR-8485	PPARGC1B	PPARG coactivator 1 beta	HGNC:30022	details
hsa-miR-8485	PLXNA4	plexin A4	HGNC:9102	details
hsa-miR-8485	NUFIP2	nuclear FMR1 interacting protein 2	HGNC:17634	details
hsa-miR-8485	NRG2	neuregulin 2	HGNC:7998	details
hsa-miR-8485	NR2F2	nuclear receptor subfamily 2 group F member 2	HGNC:7976	details
hsa-miR-8485	TSPAN1	tetraspanin 1	HGNC:20657	details
hsa-miR-8485	NCOA3	nuclear receptor coactivator 3	HGNC:7670	details
hsa-miR-8485	MLXIP	MLX interacting protein	HGNC:17055	details
hsa-miR-8485	MAPKAPK2	MAPK activated protein kinase 2	HGNC:6887	details
hsa-miR-8485	MAP3K9	mitogen-activated protein kinase kinase kinase 9	HGNC:6861	details
hsa-miR-8485	LSM14A	LSM14A mRNA processing body assembly factor	HGNC:24489	details
hsa-miR-8485	LRP6	LDL receptor related protein 6	HGNC:6698	details
hsa-miR-8485	LMX1A	LIM homeobox transcription factor 1 alpha	HGNC:6653	details
hsa-miR-8485	KLHL3	kelch like family member 3	HGNC:6354	details
hsa-miR-8485	JAZF1	JAZF zinc finger 1	HGNC:28917	details
hsa-miR-8485	ITGA1	integrin subunit alpha 1	HGNC:6134	details
hsa-miR-8485	IGF2BP1	insulin like growth factor 2 mRNA binding protein 1	HGNC:28866	details
hsa-miR-8485	IGF1R	insulin like growth factor 1 receptor	HGNC:5465	details
hsa-miR-8485	HLF	HLF transcription factor, PAR bZIP family member	HGNC:4977	details
hsa-miR-8485	HIF1AN	hypoxia inducible factor 1 subunit alpha inhibitor	HGNC:17113	details
hsa-miR-8485	GTDC1	glycosyltransferase like domain containing 1	HGNC:20887	details
hsa-miR-8485	GPRIN3	GPRIN family member 3	HGNC:27733	details
hsa-miR-8485	GCK	glucokinase	HGNC:4195	details
hsa-miR-8485	GID4	GID complex subunit 4 homolog	HGNC:28453	details
hsa-miR-8485	GEMIN6	gem nuclear organelle associated protein 6	HGNC:20044	details
hsa-miR-8485	GATA6	GATA binding protein 6	HGNC:4174	details
hsa-miR-8485	FOXP1	forkhead box P1	HGNC:3823	details
hsa-miR-8485	FAT3	FAT atypical cadherin 3	HGNC:23112	details
hsa-miR-8485	TOGARAM2	TOG array regulator of axonemal microtubules 2	HGNC:33715	details
hsa-miR-8485	SRCAP	Snf2 related CREBBP activator protein	HGNC:16974	details
hsa-miR-8485	DUSP6	dual specificity phosphatase 6	HGNC:3072	details
hsa-miR-8485	DSEL	dermatan sulfate epimerase like	HGNC:18144	details
hsa-miR-8485	DENND2C	DENN domain containing 2C	HGNC:24748	details
hsa-miR-8485	CRY2	cryptochrome circadian regulator 2	HGNC:2385	details
hsa-miR-8485	CRIM1	cysteine rich transmembrane BMP regulator 1	HGNC:2359	details
hsa-miR-8485	CREB5	cAMP responsive element binding protein 5	HGNC:16844	details
hsa-miR-8485	KALRN	kalirin RhoGEF kinase	HGNC:4814	details
hsa-miR-8485	CACFD1	calcium channel flower domain containing 1	HGNC:1365	details
hsa-miR-8485	C2orf72	chromosome 2 open reading frame 72	HGNC:27418	details
hsa-miR-8485	BAMBI	BMP and activin membrane bound inhibitor	HGNC:30251	details
hsa-miR-8485	ARL6IP6	ADP ribosylation factor like GTPase 6 interacting protein 6	HGNC:24048	details
hsa-miR-8485	ARL5C	ADP ribosylation factor like GTPase 5C	HGNC:31111	details
hsa-miR-8485	ANTXR2	ANTXR cell adhesion molecule 2	HGNC:21732	details
hsa-miR-8485	ALX1	ALX homeobox 1	HGNC:1494	details
hsa-miR-8485	AGO2	argonaute RISC catalytic component 2	HGNC:3263	details
hsa-miR-8485	GRK3	G protein-coupled receptor kinase 3	HGNC:290	details
hsa-miR-8485	ADAMTS4	ADAM metallopeptidase with thrombospondin type 1 motif 4	HGNC:220	details
hsa-miR-8485	ACVR1B	activin A receptor type 1B	HGNC:172	details
hsa-miR-8485	AAK1	AP2 associated kinase 1	HGNC:19679	details
hsa-miR-8485	LYRM7	LYR motif containing 7	HGNC:28072	details
hsa-miR-8485	VAPB	VAMP associated protein B and C	HGNC:12649	details
hsa-miR-8485	MICA	MHC class I polypeptide-related sequence A	HGNC:7090	details
hsa-miR-8485	CEP72	centrosomal protein 72	HGNC:25547	details
hsa-miR-8485	PTCH1	patched 1	HGNC:9585	details
hsa-miR-8485	PPP1R1C	protein phosphatase 1 regulatory inhibitor subunit 1C	HGNC:14940	details
hsa-miR-8485	HIC2	HIC ZBTB transcriptional repressor 2	HGNC:18595	details
hsa-miR-8485	DUSP18	dual specificity phosphatase 18	HGNC:18484	details
hsa-miR-8485	IKBKG	inhibitor of nuclear factor kappa B kinase regulatory subunit gamma	HGNC:5961	details
hsa-miR-8485	MTPN	myotrophin	HGNC:15667	details
hsa-miR-8485	LANCL3	LanC like 3	HGNC:24767	details
hsa-miR-8485	COBLL1	cordon-bleu WH2 repeat protein like 1	HGNC:23571	details
hsa-miR-8485				details
hsa-miR-8485	CRB2	crumbs cell polarity complex component 2	HGNC:18688	details
hsa-miR-8485	MDN1	midasin AAA ATPase 1	HGNC:18302	details
hsa-miR-8485	NDUFS2	NADH:ubiquinone oxidoreductase core subunit S2	HGNC:7708	details
hsa-miR-8485	IBA57	iron-sulfur cluster assembly factor IBA57	HGNC:27302	details
hsa-miR-8485	TCF20	transcription factor 20	HGNC:11631	details
hsa-miR-8485	QSOX2	quiescin sulfhydryl oxidase 2	HGNC:30249	details
hsa-miR-8485	TUBD1	tubulin delta 1	HGNC:16811	details
hsa-miR-8485	GALNT17	polypeptide N-acetylgalactosaminyltransferase 17	HGNC:16347	details
hsa-miR-8485	NPAP1	nuclear pore associated protein 1	HGNC:1190	details
hsa-miR-8485	ING5	inhibitor of growth family member 5	HGNC:19421	details
hsa-miR-8485	FGFBP3	fibroblast growth factor binding protein 3	HGNC:23428	details
hsa-miR-8485	TNS3	tensin 3	HGNC:21616	details
hsa-miR-8485				details
hsa-miR-8485	PTPN9	protein tyrosine phosphatase non-receptor type 9	HGNC:9661	details
hsa-miR-8485	STK36	serine/threonine kinase 36	HGNC:17209	details
hsa-miR-8485	ANK3	ankyrin 3	HGNC:494	details
hsa-miR-8485	MMS22L	MMS22 like, DNA repair protein	HGNC:21475	details
hsa-miR-8485	C1orf216	chromosome 1 open reading frame 216	HGNC:26800	details
hsa-miR-8485	RHBDL3	rhomboid like 3	HGNC:16502	details
hsa-miR-8485	METTL16	methyltransferase 16, N6-methyladenosine	HGNC:28484	details
hsa-miR-8485	SLCO1B3	solute carrier organic anion transporter family member 1B3	HGNC:10961	details
hsa-miR-8485	TOR1B	torsin family 1 member B	HGNC:11995	details
hsa-miR-8485	ELOF1	elongation factor 1	HGNC:28691	details
hsa-miR-8485	SLC1A4	solute carrier family 1 member 4	HGNC:10942	details
hsa-miR-8485	SPINT3	serine peptidase inhibitor, Kunitz type 3	HGNC:11248	details
hsa-miR-8485	CYP24A1	cytochrome P450 family 24 subfamily A member 1	HGNC:2602	details
hsa-miR-8485	SLC22A4	solute carrier family 22 member 4	HGNC:10968	details
hsa-miR-8485	STYK1	serine/threonine/tyrosine kinase 1	HGNC:18889	details
hsa-miR-8485	TNFRSF13C	TNF receptor superfamily member 13C	HGNC:17755	details
hsa-miR-8485	SOCS7	suppressor of cytokine signaling 7	HGNC:29846	details
hsa-miR-8485	SLC7A11	solute carrier family 7 member 11	HGNC:11059	details
hsa-miR-8485	SLC44A1	solute carrier family 44 member 1	HGNC:18798	details
hsa-miR-8485	SLC41A2	solute carrier family 41 member 2	HGNC:31045	details
hsa-miR-8485	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-miR-8485	RAPGEF1	Rap guanine nucleotide exchange factor 1	HGNC:4568	details
hsa-miR-8485	PTEN	phosphatase and tensin homolog	HGNC:9588	details
hsa-miR-8485	PARD3B	par-3 family cell polarity regulator beta	HGNC:14446	details
hsa-miR-8485	NAV1	neuron navigator 1	HGNC:15989	details
hsa-miR-8485	KLF7	Kruppel like factor 7	HGNC:6350	details
hsa-miR-8485	GRIK3	glutamate ionotropic receptor kainate type subunit 3	HGNC:4581	details
hsa-miR-8485	DGKG	diacylglycerol kinase gamma	HGNC:2853	details
hsa-miR-8485	DCAF12	DDB1 and CUL4 associated factor 12	HGNC:19911	details
hsa-miR-8485	B4GALT5	beta-1,4-galactosyltransferase 5	HGNC:928	details
hsa-miR-8485	ATXN3	ataxin 3	HGNC:7106	details
hsa-miR-8485	ATXN1	ataxin 1	HGNC:10548	details
hsa-miR-8485	B3GALT5	beta-1,3-galactosyltransferase 5	HGNC:920	details
hsa-miR-8485	MPP2	membrane palmitoylated protein 2	HGNC:7220	details
hsa-miR-8485	GOLGA7B	golgin A7 family member B	HGNC:31668	details
hsa-miR-8485	F11R	F11 receptor	HGNC:14685	details
hsa-miR-8485	TNFSF4	TNF superfamily member 4	HGNC:11934	details
hsa-miR-8485	MYO16	myosin XVI	HGNC:29822	details
hsa-miR-8485	ASCC1	activating signal cointegrator 1 complex subunit 1	HGNC:24268	details
hsa-miR-8485	SMCHD1	structural maintenance of chromosomes flexible hinge domain containing 1	HGNC:29090	details
hsa-miR-8485	ATF7IP	activating transcription factor 7 interacting protein	HGNC:20092	details
hsa-miR-8485	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-8485	MEF2D	myocyte enhancer factor 2D	HGNC:6997	details
hsa-miR-8485	LONRF1	LON peptidase N-terminal domain and ring finger 1	HGNC:26302	details
hsa-miR-8485	ZNF280B	zinc finger protein 280B	HGNC:23022	details
hsa-miR-8485	LARP4B	La ribonucleoprotein 4B	HGNC:28987	details
hsa-miR-8485	KYNU	kynureninase	HGNC:6469	details
hsa-miR-8485	DSG2	desmoglein 2	HGNC:3049	details
hsa-miR-8485	SYTL4	synaptotagmin like 4	HGNC:15588	details
hsa-miR-8485	ELK4	ETS transcription factor ELK4	HGNC:3326	details
hsa-miR-8485				details
hsa-miR-8485	TRAPPC6A	trafficking protein particle complex subunit 6A	HGNC:23069	details
hsa-miR-8485	AKAIN1	A-kinase anchor inhibitor 1	HGNC:28285	details
hsa-miR-8485	GREM1	gremlin 1, DAN family BMP antagonist	HGNC:2001	details
hsa-miR-8485	SPATS2	spermatogenesis associated serine rich 2	HGNC:18650	details
hsa-miR-8485	MAPKAPK5	MAPK activated protein kinase 5	HGNC:6889	details
hsa-miR-8485				details
hsa-miR-8485	TANK	TRAF family member associated NFKB activator	HGNC:11562	details
hsa-miR-8485	CLCN7	chloride voltage-gated channel 7	HGNC:2025	details
hsa-miR-8485				details
hsa-miR-8485	GABARAPL3	GABA type A receptor associated protein like 3 pseudogene	HGNC:4069	details
hsa-miR-8485	ARPC4	actin related protein 2/3 complex subunit 4	HGNC:707	details
hsa-miR-8485	IL21R	interleukin 21 receptor	HGNC:6006	details
hsa-miR-8485	ATP2A2	ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2	HGNC:812	details
hsa-miR-8485	SIGLEC15	sialic acid binding Ig like lectin 15	HGNC:27596	details
hsa-miR-8485	CCDC174	coiled-coil domain containing 174	HGNC:28033	details
hsa-miR-8485	STAG1	stromal antigen 1	HGNC:11354	details
hsa-miR-8485	GPR78	G protein-coupled receptor 78	HGNC:4528	details
hsa-miR-8485	KIF13A	kinesin family member 13A	HGNC:14566	details
hsa-miR-8485	HS6ST3	heparan sulfate 6-O-sulfotransferase 3	HGNC:19134	details
hsa-miR-8485	JPH2	junctophilin 2	HGNC:14202	details
hsa-miR-8485	KIRREL1	kirre like nephrin family adhesion molecule 1	HGNC:15734	details
hsa-miR-8485	NOS1AP	nitric oxide synthase 1 adaptor protein	HGNC:16859	details
hsa-miR-8485	RASSF9	Ras association domain family member 9	HGNC:15739	details
hsa-miR-8485	C6	complement C6	HGNC:1339	details
hsa-miR-8485	HLCS	holocarboxylase synthetase	HGNC:4976	details
hsa-miR-8485	C10orf67	chromosome 10 open reading frame 67	HGNC:28716	details
hsa-miR-8485	PACS1	phosphofurin acidic cluster sorting protein 1	HGNC:30032	details
hsa-miR-8485	MYO1H	myosin IH	HGNC:13879	details
hsa-miR-8485	MMADHC	metabolism of cobalamin associated D	HGNC:25221	details
hsa-miR-8485	CLSTN3	calsyntenin 3	HGNC:18371	details
hsa-miR-8485	FLVCR2	FLVCR heme transporter 2	HGNC:20105	details
hsa-miR-8485	ZBTB7C	zinc finger and BTB domain containing 7C	HGNC:31700	details
hsa-miR-8485	WTIP	WT1 interacting protein	HGNC:20964	details
hsa-miR-8485	USH1G	USH1 protein network component sans	HGNC:16356	details
hsa-miR-8485	TCF7L2	transcription factor 7 like 2	HGNC:11641	details
hsa-miR-8485	SS18	SS18 subunit of BAF chromatin remodeling complex	HGNC:11340	details
hsa-miR-8485	SRRM4	serine/arginine repetitive matrix 4	HGNC:29389	details
hsa-miR-8485	SPOPL	speckle type BTB/POZ protein like	HGNC:27934	details
hsa-miR-8485	SPOCK2	SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2	HGNC:13564	details
hsa-miR-8485	SLITRK4	SLIT and NTRK like family member 4	HGNC:23502	details
hsa-miR-8485	SLC36A1	solute carrier family 36 member 1	HGNC:18761	details
hsa-miR-8485	RNF213	ring finger protein 213	HGNC:14539	details
hsa-miR-8485	PLXNC1	plexin C1	HGNC:9106	details
hsa-miR-8485	PDGFRA	platelet derived growth factor receptor alpha	HGNC:8803	details
hsa-miR-8485	PAX3	paired box 3	HGNC:8617	details
hsa-miR-8485	PAG1	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	HGNC:30043	details
hsa-miR-8485	NFATC2	nuclear factor of activated T cells 2	HGNC:7776	details
hsa-miR-8485	NEURL1B	neuralized E3 ubiquitin protein ligase 1B	HGNC:35422	details
hsa-miR-8485	MYORG	myogenesis regulating glycosidase (putative)	HGNC:19918	details
hsa-miR-8485	JAK2	Janus kinase 2	HGNC:6192	details
hsa-miR-8485	ITPKB	inositol-trisphosphate 3-kinase B	HGNC:6179	details
hsa-miR-8485	GRID1	glutamate ionotropic receptor delta type subunit 1	HGNC:4575	details
hsa-miR-8485	FBXO45	F-box protein 45	HGNC:29148	details
hsa-miR-8485	CTTNBP2NL	CTTNBP2 N-terminal like	HGNC:25330	details
hsa-miR-8485	COL12A1	collagen type XII alpha 1 chain	HGNC:2188	details
hsa-miR-8485	CBX8	chromobox 8	HGNC:15962	details
hsa-miR-8485	BMPR1A	bone morphogenetic protein receptor type 1A	HGNC:1076	details
hsa-miR-8485	ATXN7L3B	ataxin 7 like 3B	HGNC:37931	details
hsa-miR-8485	ARMC10	armadillo repeat containing 10	HGNC:21706	details
hsa-miR-8485	AP5M1	adaptor related protein complex 5 subunit mu 1	HGNC:20192	details
hsa-miR-8485	ABHD13	abhydrolase domain containing 13	HGNC:20293	details
hsa-miR-8485	CCDC91	coiled-coil domain containing 91	HGNC:24855	details
hsa-miR-8485	MTO1	mitochondrial tRNA translation optimization 1	HGNC:19261	details
hsa-miR-8485	CPA4	carboxypeptidase A4	HGNC:15740	details
hsa-miR-8485	SHROOM1	shroom family member 1	HGNC:24084	details
hsa-miR-8485	PADI2	peptidyl arginine deiminase 2	HGNC:18341	details
hsa-miR-8485	TMEM35A	transmembrane protein 35A	HGNC:25864	details
hsa-miR-8485	LAMP2	lysosomal associated membrane protein 2	HGNC:6501	details
hsa-miR-8485	PKP1	plakophilin 1	HGNC:9023	details
hsa-miR-8485	ATP1A3	ATPase Na+/K+ transporting subunit alpha 3	HGNC:801	details
hsa-miR-8485	TXNL4B	thioredoxin like 4B	HGNC:26041	details
hsa-miR-8485	IL18RAP	interleukin 18 receptor accessory protein	HGNC:5989	details
hsa-miR-8485	CEP162	centrosomal protein 162	HGNC:21107	details
hsa-miR-8485	GRN	granulin precursor	HGNC:4601	details
hsa-miR-8485	GLYR1	glyoxylate reductase 1 homolog	HGNC:24434	details
hsa-miR-8485	CHRFAM7A	CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion	HGNC:15781	details
hsa-miR-8485	BSN	bassoon presynaptic cytomatrix protein	HGNC:1117	details
hsa-miR-8485	ETFDH	electron transfer flavoprotein dehydrogenase	HGNC:3483	details
hsa-miR-8485	SH3TC2	SH3 domain and tetratricopeptide repeats 2	HGNC:29427	details
hsa-miR-8485	GPR21	G protein-coupled receptor 21	HGNC:4476	details
hsa-miR-8485	MVB12B	multivesicular body subunit 12B	HGNC:23368	details
hsa-miR-8485	IQSEC3	IQ motif and Sec7 domain ArfGEF 3	HGNC:29193	details
hsa-miR-8485	SLC5A8	solute carrier family 5 member 8	HGNC:19119	details
hsa-miR-8485	CRLS1	cardiolipin synthase 1	HGNC:16148	details
hsa-miR-8485	GSN	gelsolin	HGNC:4620	details
hsa-miR-8485	CISD2	CDGSH iron sulfur domain 2	HGNC:24212	details
hsa-miR-8485	GTPBP8	GTP binding protein 8 (putative)	HGNC:25007	details
hsa-miR-8485				details
hsa-miR-8485	TFAM	transcription factor A, mitochondrial	HGNC:11741	details
hsa-miR-8485				details
hsa-miR-8485	ELK1	ETS transcription factor ELK1	HGNC:3321	details
hsa-miR-8485	HUNK	hormonally up-regulated Neu-associated kinase	HGNC:13326	details
hsa-miR-8485	GDNF	glial cell derived neurotrophic factor	HGNC:4232	details
hsa-miR-8485	ZNF730	zinc finger protein 730	HGNC:32470	details
hsa-miR-8485	CBX3	chromobox 3	HGNC:1553	details
hsa-miR-8485	FKBP9	FKBP prolyl isomerase 9	HGNC:3725	details
hsa-miR-8485	VPS13D	vacuolar protein sorting 13 homolog D	HGNC:23595	details
hsa-miR-8485	FOXL1	forkhead box L1	HGNC:3817	details
hsa-miR-8485	ENTHD1	ENTH domain containing 1	HGNC:26352	details
hsa-miR-8485	RAET1E	retinoic acid early transcript 1E	HGNC:16793	details
hsa-miR-8485	RABGAP1	RAB GTPase activating protein 1	HGNC:17155	details
hsa-miR-8485	BMP10	bone morphogenetic protein 10	HGNC:20869	details
hsa-miR-8485	SUGT1	SGT1 homolog, MIS12 kinetochore complex assembly cochaperone	HGNC:16987	details
hsa-miR-8485	BHLHB9	basic helix-loop-helix family member b9	HGNC:29353	details
hsa-miR-8485	EML4	EMAP like 4	HGNC:1316	details
hsa-miR-8485	SLCO5A1	solute carrier organic anion transporter family member 5A1	HGNC:19046	details
hsa-miR-8485	NACC1	nucleus accumbens associated 1	HGNC:20967	details
hsa-miR-8485	EMC10	ER membrane protein complex subunit 10	HGNC:27609	details
hsa-miR-8485	FAM169B	family with sequence similarity 169 member B	HGNC:26835	details
hsa-miR-8485	TBC1D2B	TBC1 domain family member 2B	HGNC:29183	details
hsa-miR-8485	MIOX	myo-inositol oxygenase	HGNC:14522	details
hsa-miR-8485	ZKSCAN4	zinc finger with KRAB and SCAN domains 4	HGNC:13854	details
hsa-miR-8485	STOML1	stomatin like 1	HGNC:14560	details
hsa-miR-8485	SMNDC1	survival motor neuron domain containing 1	HGNC:16900	details
hsa-miR-8485	NACC2	NACC family member 2	HGNC:23846	details
hsa-miR-8485	GDPGP1	GDP-D-glucose phosphorylase 1	HGNC:34360	details
hsa-miR-8485	ZFP1	ZFP1 zinc finger protein	HGNC:23328	details
hsa-miR-8485	PRSS21	serine protease 21	HGNC:9485	details
hsa-miR-8485	WWC2	WW and C2 domain containing 2	HGNC:24148	details
hsa-miR-8485	BEX4	brain expressed X-linked 4	HGNC:25475	details
hsa-miR-8485	GOT1	glutamic-oxaloacetic transaminase 1	HGNC:4432	details
hsa-miR-8485	DNAH8	dynein axonemal heavy chain 8	HGNC:2952	details
hsa-miR-8485				details
hsa-miR-8485	SPNS2	sphingolipid transporter 2	HGNC:26992	details
hsa-miR-8485	PARL	presenilin associated rhomboid like	HGNC:18253	details
hsa-miR-8485	PLIN1	perilipin 1	HGNC:9076	details
hsa-miR-8485	ITPKC	inositol-trisphosphate 3-kinase C	HGNC:14897	details
hsa-miR-8485	FHOD1	formin homology 2 domain containing 1	HGNC:17905	details
hsa-miR-8485	CLNK	cytokine dependent hematopoietic cell linker	HGNC:17438	details
hsa-miR-8485	SLC30A4	solute carrier family 30 member 4	HGNC:11015	details
hsa-miR-8485	MAP3K21	mitogen-activated protein kinase kinase kinase 21	HGNC:29798	details
hsa-miR-8485	KCNA4	potassium voltage-gated channel subfamily A member 4	HGNC:6222	details
hsa-miR-8485	FAM107B	family with sequence similarity 107 member B	HGNC:23726	details
hsa-miR-8485	DTNA	dystrobrevin alpha	HGNC:3057	details
hsa-miR-8485	DENND5B	DENN domain containing 5B	HGNC:28338	details
hsa-miR-8485	CDH2	cadherin 2	HGNC:1759	details
hsa-miR-8485	BRD4	bromodomain containing 4	HGNC:13575	details
hsa-miR-8485	RPL18A	ribosomal protein L18a	HGNC:10311	details
hsa-miR-8485	PSD4	pleckstrin and Sec7 domain containing 4	HGNC:19096	details
hsa-miR-8485	IFNAR2	interferon alpha and beta receptor subunit 2	HGNC:5433	details
hsa-miR-8485	IGSF9	immunoglobulin superfamily member 9	HGNC:18132	details
hsa-miR-8485	ASTN2	astrotactin 2	HGNC:17021	details
hsa-miR-8485	TBC1D22A	TBC1 domain family member 22A	HGNC:1309	details
hsa-miR-8485	WNK3	WNK lysine deficient protein kinase 3	HGNC:14543	details
hsa-miR-8485	VAPA	VAMP associated protein A	HGNC:12648	details
hsa-miR-8485	TAL1	TAL bHLH transcription factor 1, erythroid differentiation factor	HGNC:11556	details
hsa-miR-8485	RIMS3	regulating synaptic membrane exocytosis 3	HGNC:21292	details
hsa-miR-8485	PTBP3	polypyrimidine tract binding protein 3	HGNC:10253	details
hsa-miR-8485	PCNX1	pecanex 1	HGNC:19740	details
hsa-miR-8485	CPE	carboxypeptidase E	HGNC:2303	details
hsa-miR-8485	NPTX1	neuronal pentraxin 1	HGNC:7952	details
hsa-miR-8485	TMC7	transmembrane channel like 7	HGNC:23000	details
hsa-miR-8485	C1orf116	chromosome 1 open reading frame 116	HGNC:28667	details
hsa-miR-8485	LONRF3	LON peptidase N-terminal domain and ring finger 3	HGNC:21152	details
hsa-miR-8485	CDH7	cadherin 7	HGNC:1766	details
hsa-miR-8485	PCDH7	protocadherin 7	HGNC:8659	details
hsa-miR-8485	MDGA1	MAM domain containing glycosylphosphatidylinositol anchor 1	HGNC:19267	details
hsa-miR-8485	F2RL1	F2R like trypsin receptor 1	HGNC:3538	details
hsa-miR-8485	NRIP1	nuclear receptor interacting protein 1	HGNC:8001	details
hsa-miR-8485				details
hsa-miR-8485	ALDH1A3	aldehyde dehydrogenase 1 family member A3	HGNC:409	details
hsa-miR-8485	LYPD3	LY6/PLAUR domain containing 3	HGNC:24880	details
hsa-miR-8485	CPNE8	copine 8	HGNC:23498	details
hsa-miR-8485	BAZ2A	bromodomain adjacent to zinc finger domain 2A	HGNC:962	details
hsa-miR-8485	STAM	signal transducing adaptor molecule	HGNC:11357	details
hsa-miR-8485	SIK3	SIK family kinase 3	HGNC:29165	details
hsa-miR-8485	CALHM5	calcium homeostasis modulator family member 5	HGNC:21568	details
hsa-miR-8485	WDTC1	WD and tetratricopeptide repeats 1	HGNC:29175	details
hsa-miR-8485	CHAF1B	chromatin assembly factor 1 subunit B	HGNC:1911	details
hsa-miR-8485	ADAMTS9	ADAM metallopeptidase with thrombospondin type 1 motif 9	HGNC:13202	details
hsa-miR-8485				details
hsa-miR-8485	FAM47E-STBD1	FAM47E-STBD1 readthrough	HGNC:44667	details
hsa-miR-8485	ZNF264	zinc finger protein 264	HGNC:13057	details
hsa-miR-8485	ZBED3	zinc finger BED-type containing 3	HGNC:20711	details
hsa-miR-8485	STYX	serine/threonine/tyrosine interacting protein	HGNC:11447	details
hsa-miR-8485	SRGAP2	SLIT-ROBO Rho GTPase activating protein 2	HGNC:19751	details
hsa-miR-8485	SNRK	SNF related kinase	HGNC:30598	details
hsa-miR-8485	PAPPA	pappalysin 1	HGNC:8602	details
hsa-miR-8485	NR2C2	nuclear receptor subfamily 2 group C member 2	HGNC:7972	details
hsa-miR-8485	GREB1L	GREB1 like retinoic acid receptor coactivator	HGNC:31042	details
hsa-miR-8485				details
hsa-miR-8485	C18orf32	chromosome 18 open reading frame 32	HGNC:31690	details
hsa-miR-8485	B4GALT6	beta-1,4-galactosyltransferase 6	HGNC:929	details
hsa-miR-8485	TRERF1	transcriptional regulating factor 1	HGNC:18273	details
hsa-miR-8485	NMNAT1	nicotinamide nucleotide adenylyltransferase 1	HGNC:17877	details
hsa-miR-8485	FRMPD3	FERM and PDZ domain containing 3	HGNC:29382	details
hsa-miR-8485	SPCS2	signal peptidase complex subunit 2	HGNC:28962	details
hsa-miR-8485	PET117	PET117 cytochrome c oxidase chaperone	HGNC:40045	details
hsa-miR-8485	TMED9	transmembrane p24 trafficking protein 9	HGNC:24878	details
hsa-miR-8485	SORBS3	sorbin and SH3 domain containing 3	HGNC:30907	details
hsa-miR-8485	GRIN2A	glutamate ionotropic receptor NMDA type subunit 2A	HGNC:4585	details
hsa-miR-8485	RIOX2	ribosomal oxygenase 2	HGNC:19441	details
hsa-miR-8485	TRAPPC6B	trafficking protein particle complex subunit 6B	HGNC:23066	details
hsa-miR-8485	RAPH1	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	HGNC:14436	details
hsa-miR-8485	RASSF2	Ras association domain family member 2	HGNC:9883	details
hsa-miR-8485	RBM41	RNA binding motif protein 41	HGNC:25617	details
hsa-miR-8485	MPEG1	macrophage expressed 1	HGNC:29619	details
hsa-miR-8485	OVOL1	ovo like transcriptional repressor 1	HGNC:8525	details
hsa-miR-8485	NUP205	nucleoporin 205	HGNC:18658	details
hsa-miR-8485	GDF11	growth differentiation factor 11	HGNC:4216	details
hsa-miR-8485	SYNRG	synergin gamma	HGNC:557	details
hsa-miR-8485	PPARGC1A	PPARG coactivator 1 alpha	HGNC:9237	details
hsa-miR-8485	CBX6	chromobox 6	HGNC:1556	details
hsa-miR-8485	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-8485	DAZAP2	DAZ associated protein 2	HGNC:2684	details
hsa-miR-8485	G3BP1	G3BP stress granule assembly factor 1	HGNC:30292	details
hsa-miR-8485	GDI1	GDP dissociation inhibitor 1	HGNC:4226	details
hsa-miR-8485	MLLT1	MLLT1 super elongation complex subunit	HGNC:7134	details
hsa-miR-8485	SBF1	SET binding factor 1	HGNC:10542	details
hsa-miR-8485	SF1	splicing factor 1	HGNC:12950	details
hsa-miR-8485				details
hsa-miR-8485	ABL2	ABL proto-oncogene 2, non-receptor tyrosine kinase	HGNC:77	details
hsa-miR-8485	EIF4H	eukaryotic translation initiation factor 4H	HGNC:12741	details
hsa-miR-8485	TMEM184B	transmembrane protein 184B	HGNC:1310	details
hsa-miR-8485	TRMT112	tRNA methyltransferase activator subunit 11-2	HGNC:26940	details
hsa-miR-8485	EAF1	ELL associated factor 1	HGNC:20907	details
hsa-miR-8485	FOXL2NB	FOXL2 neighbor	HGNC:34428	details
hsa-miR-8485	LHFPL4	LHFPL tetraspan subfamily member 4	HGNC:29568	details
hsa-miR-8485	NOS1	nitric oxide synthase 1	HGNC:7872	details
hsa-miR-8485	PIN1	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	HGNC:8988	details
hsa-miR-8485	SFN	stratifin	HGNC:10773	details
hsa-miR-8485	TAT	tyrosine aminotransferase	HGNC:11573	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)