miRNA Card

miRNA General Information
miRNA ID hsa-miR-8485
Description Homo sapiens miR-8485 stem-loop
Comment None
Experiment RT-PCR [1]
Sequence CACACACACACACACACGUAU
miRNA Expression in different cancers



circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr5:59193500|59215968 hsa-miR-8485 1 1 1
chr8:23328382|23333623 hsa-miR-8485 1 1 1

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:138571979|138572064 hsa-miR-8485 1 1 0
chr12:108645478|108645672 hsa-miR-8485 1 1 0
chr7:64691166|64691311 hsa-miR-8485 1 1 0
chr2:234495015|234495136 hsa-miR-8485 1 1 0
chr4:775471|775585 hsa-miR-8485 1 1 0
chr19:53874935|53875269 hsa-miR-8485 1 1 0
chr12:120216088|120216321 hsa-miR-8485 1 1 0
chr16:29819972|29820049 hsa-miR-8485 1 1 0
chr17:43015302|43015460 hsa-miR-8485 1 1 0
chr16:2837735|2837851 hsa-miR-8485 1 1 0
chr20:44715104|44715414 hsa-miR-8485 1 1 0
chrX:1386548|1386703 hsa-miR-8485 1 1 0
chrX:153508993|153509123 hsa-miR-8485 1 1 0
chr9:133470159|133470283 hsa-miR-8485 1 1 0
chr6:43181162|43181356 hsa-miR-8485 1 1 0
chrX:153508970|153509123 hsa-miR-8485 1 1 0
chr6:26134187|26134409 hsa-miR-8485 1 1 0
chrX:153508993|153509181 hsa-miR-8485 1 1 0
chr15:65577396|65577519 hsa-miR-8485 1 1 0
chr2:39474580|39474698 hsa-miR-8485 1 1 0
chr22:41994751|41994987 hsa-miR-8485 1 1 0
chr9:129738392|129738555 hsa-miR-8485 1 1 0
chr2:237765193|237765364 hsa-miR-8485 1 1 0
chr19:46775042|46775159 hsa-miR-8485 1 1 0
chr1:26864176|26864428 hsa-miR-8485 1 1 0
chr15:52309820|52310009 hsa-miR-8485 1 1 0
chr14:95439671|95439983 hsa-miR-8485 1 1 0
chr6:44233840|44234000 hsa-miR-8485 1 1 0
chr17:40135797|40135907 hsa-miR-8485 1 1 0
chr19:45470381|45470700 hsa-miR-8485 1 1 0
chr1:26780643|26780845 hsa-miR-8485 1 1 0
chr17:8160722|8160808 hsa-miR-8485 1 1 0
chr11:1915081|1915478 hsa-miR-8485 1 1 0
chr11:108178409|108178553 hsa-miR-8485 1 1 0
chr11:66492829|66493179 hsa-miR-8485 1 1 0
chr17:58274237|58274407 hsa-miR-8485 1 1 0
chr12:57823269|57823407 hsa-miR-8485 1 1 0
chr19:45475284|45475507 hsa-miR-8485 1 1 0
chr2:237765193|237765339 hsa-miR-8485 1 1 0
chr2:239150315|239150509 hsa-miR-8485 1 1 0
chr16:72658201|72658340 hsa-miR-8485 1 1 0
chr21:28730240|28730450 hsa-miR-8485 1 1 0
chr17:1501706|1501905 hsa-miR-8485 1 1 0
chr12:2309353|2309545 hsa-miR-8485 1 1 0
chr22:26797592|26797734 hsa-miR-8485 1 1 0
chr1:156220508|156220744 hsa-miR-8485 1 1 0
chrX:131794154|131794296 hsa-miR-8485 1 1 0
chr19:48190994|48191183 hsa-miR-8485 1 1 0
chr14:24179897|24179983 hsa-miR-8485 1 1 0
chr9:41064596|41064703 hsa-miR-8485 1 1 0
chr7:11817794|11817941 hsa-miR-8485 1 1 0
chrX:153793104|153793288 hsa-miR-8485 1 1 0
chr7:98259563|98259834 hsa-miR-8485 1 1 0
chr11:76970514|76970716 hsa-miR-8485 1 1 0
chr11:1914751|1914948 hsa-miR-8485 1 1 0
chrX:153508993|153509171 hsa-miR-8485 1 1 0
chr9:37089787|37089963 hsa-miR-8485 1 1 0
chr2:85666105|85666282 hsa-miR-8485 1 1 0
chr5:137260|137451 hsa-miR-8485 1 1 0
chr1:26780771|26780929 hsa-miR-8485 1 1 0
chr19:45410472|45410650 hsa-miR-8485 1 1 0
chr1:40422738|40422917 hsa-miR-8485 1 1 0
chr3:186148948|186149063 hsa-miR-8485 1 1 0
chr19:53874935|53875267 hsa-miR-8485 1 1 0
chr2:237765248|237765364 hsa-miR-8485 1 1 0
chr2:85666090|85666195 hsa-miR-8485 1 1 0
chr19:55661488|55661629 hsa-miR-8485 1 1 0
chr5:154819674|154819856 hsa-miR-8485 1 1 0
chr6:7289590|7289761 hsa-miR-8485 1 1 0
chr2:237765248|237765339 hsa-miR-8485 1 1 0
chr1:12208343|12208525 hsa-miR-8485 1 1 0
chr11:1753339|1753494 hsa-miR-8485 1 1 0
chr17:38921485|38921631 hsa-miR-8485 1 1 0
chr2:85666099|85666195 hsa-miR-8485 1 1 0
chr21:38301947|38302120 hsa-miR-8485 1 1 0
chr6:27757717|27757945 hsa-miR-8485 1 1 0
chr2:85666105|85666195 hsa-miR-8485 1 1 0
chr9:88477778|88477865 hsa-miR-8485 1 1 0
chrX:153508993|153509134 hsa-miR-8485 1 1 0
chr14:35082526|35082648 hsa-miR-8485 1 1 0
chr16:24919274|24919450 hsa-miR-8485 1 1 0
chr17:38767358|38767549 hsa-miR-8485 1 1 0
chr5:141825471|141825584 hsa-miR-8485 1 1 0
chr3:194202922|194203014 hsa-miR-8485 1 1 0
chr3:129197585|129197818 hsa-miR-8485 1 1 0
chr17:43015302|43015585 hsa-miR-8485 1 1 0
chr2:85666105|85666258 hsa-miR-8485 1 1 0
chr2:96185003|96185159 hsa-miR-8485 1 1 0
chr3:128813424|128813743 hsa-miR-8485 1 1 0
chr2:234495015|234495101 hsa-miR-8485 1 1 0
chr2:96184973|96185116 hsa-miR-8485 1 1 0
chr8:118190372|118190569 hsa-miR-8485 1 1 0
chr17:49677952|49678094 hsa-miR-8485 1 1 0
chr12:132950473|132950677 hsa-miR-8485 1 1 0
chr14:20471298|20471443 hsa-miR-8485 1 1 0
chr11:128891395|128891548 hsa-miR-8485 1 1 0
chr7:135167372|135167662 hsa-miR-8485 1 1 0
chr3:128813538|128813743 hsa-miR-8485 1 1 0
chrX:153508993|153509148 hsa-miR-8485 1 1 0
chr4:184022455|184022570 hsa-miR-8485 1 1 0
chrX:153508853|153509171 hsa-miR-8485 1 1 0
chr4:173332039|173332173 hsa-miR-8485 1 1 0
chr19:18279891|18280089 hsa-miR-8485 1 1 0
chr2:207763755|207763959 hsa-miR-8485 1 1 0
chr12:125030849|125030997 hsa-miR-8485 1 1 0
chr20:37983145|37983285 hsa-miR-8485 1 1 0
chr22:25724098|25724256 hsa-miR-8485 1 1 0
chr14:85627528|85627658 hsa-miR-8485 1 1 0
chr3:128813476|128813727 hsa-miR-8485 1 1 0
chr17:38921521|38921648 hsa-miR-8485 1 1 0
chr17:46938796|46938970 hsa-miR-8485 1 1 0
chr17:43544975|43545313 hsa-miR-8485 1 1 0
chrX:1386503|1386600 hsa-miR-8485 1 1 0
chr10:128106679|128106886 hsa-miR-8485 1 1 0
chrX:68841321|68841514 hsa-miR-8485 1 1 0
chr14:35082497|35082650 hsa-miR-8485 1 1 0
chr12:74541048|74541199 hsa-miR-8485 1 1 0
chr6:7289471|7289827 hsa-miR-8485 1 1 0
chrX:1386474|1386600 hsa-miR-8485 1 1 0
chr9:123103940|123104064 hsa-miR-8485 1 1 0
chr1:35566624|35566726 hsa-miR-8485 1 1 0
chr12:74541020|74541199 hsa-miR-8485 1 1 0
chr11:86808797|86808916 hsa-miR-8485 1 1 0
chr20:47654788|47654911 hsa-miR-8485 1 1 0
chr10:58397686|58397792 hsa-miR-8485 1 1 0
chr1:22091643|22091857 hsa-miR-8485 1 1 0
chr10:70879270|70879481 hsa-miR-8485 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr17:64782043|64782205 hsa-miR-8485 0 1 0
chr9:35684253|35684629 hsa-miR-8485 0 1 0
chr10:80157518|80157703 hsa-miR-8485 0 1 0
chr22:37807182|37807259 hsa-miR-8485 0 1 0
chr22:41907035|41907238 hsa-miR-8485 0 1 0
chr6:31889027|31889292 hsa-miR-8485 0 1 0
chr3:15648828|15648990 hsa-miR-8485 0 1 0
chr3:14943493|14943633 hsa-miR-8485 0 1 0
chr1:39759833|39760052 hsa-miR-8485 0 1 0
chr10:69507077|69507207 hsa-miR-8485 0 1 0
chr4:16170734|16170940 hsa-miR-8485 0 1 0
chr20:45420332|45420578 hsa-miR-8485 0 1 0
chr15:98963945|98964039 hsa-miR-8485 0 1 0
chr17:79936110|79936292 hsa-miR-8485 0 1 0
chr10:102813005|102813196 hsa-miR-8485 0 1 0
chr19:18431371|18431706 hsa-miR-8485 0 1 0
chr5:179836676|179836840 hsa-miR-8485 0 1 0
chr11:614238|614502 hsa-miR-8485 0 1 0
chr10:119170065|119170274 hsa-miR-8485 0 1 0
chr1:156466986|156467137 hsa-miR-8485 0 1 0
chr17:43015302|43015410 hsa-miR-8485 0 1 0
chr1:2405074|2405195 hsa-miR-8485 0 1 0
chr12:2692322|2692473 hsa-miR-8485 0 1 0
chr11:12528474|12528619 hsa-miR-8485 0 1 0
chr1:2405040|2405178 hsa-miR-8485 0 1 0
chr19:7561246|7561566 hsa-miR-8485 0 1 0
chr19:58549985|58550210 hsa-miR-8485 0 1 0
chr19:56525272|56525355 hsa-miR-8485 0 1 0
chr22:41907077|41907172 hsa-miR-8485 0 1 0
chr5:179836595|179836840 hsa-miR-8485 0 1 0
chr12:122061098|122061317 hsa-miR-8485 0 1 0
chr12:115960941|115961094 hsa-miR-8485 0 1 0
chr1:43452160|43452369 hsa-miR-8485 0 1 0
chr16:84778987|84779132 hsa-miR-8485 0 1 0
chr17:82597273|82597414 hsa-miR-8485 0 1 0
chr19:45474530|45474678 hsa-miR-8485 0 1 0
chr8:18212445|18212572 hsa-miR-8485 0 1 0
chr9:136940694|136940818 hsa-miR-8485 0 1 0
chr15:74844719|74844874 hsa-miR-8485 0 1 0
chr1:151773543|151773645 hsa-miR-8485 0 1 0
chr12:123523134|123523267 hsa-miR-8485 0 1 0
chr7:2663810|2663966 hsa-miR-8485 0 1 0
chr11:102530598|102530747 hsa-miR-8485 0 1 0
chr20:5760234|5760361 hsa-miR-8485 0 1 0
chr17:77499637|77499779 hsa-miR-8485 0 1 0
chr10:49163179|49163345 hsa-miR-8485 1 0 0
chr15:63324503|63324602 hsa-miR-8485 1 0 0
chr10:20282105|20282258 hsa-miR-8485 1 0 0
chr15:65577346|65577519 hsa-miR-8485 1 0 0
chr5:40829641|40829754 hsa-miR-8485 1 0 0
chrX:110674433|110674655 hsa-miR-8485 1 0 0
chr17:79936868|79936966 hsa-miR-8485 1 0 0
chr17:77500120|77500242 hsa-miR-8485 1 0 0
chr8:117128329|117128443 hsa-miR-8485 1 0 0
chr10:102814908|102815044 hsa-miR-8485 1 0 0
chr7:47276268|47276378 hsa-miR-8485 1 0 0
chr17:79936845|79936966 hsa-miR-8485 1 0 0
chr15:74177574|74177650 hsa-miR-8485 1 0 0
chr3:128813548|128813727 hsa-miR-8485 1 0 0
chr18:3601415|3601649 hsa-miR-8485 1 0 0
chrX:153508993|153509131 hsa-miR-8485 1 0 0
chr6:131948399|131948697 hsa-miR-8485 1 0 0
chr19:10572775|10573083 hsa-miR-8485 0 1 0
chr11:66274077|66274209 hsa-miR-8485 0 1 0
chr20:36528002|36528254 hsa-miR-8485 0 1 0
chr11:1753339|1753466 hsa-miR-8485 0 1 0
chr10:79316154|79316287 hsa-miR-8485 0 1 0
chr2:241075769|241076030 hsa-miR-8485 0 1 0
chr11:64765561|64765752 hsa-miR-8485 0 1 0
chr15:98963945|98964086 hsa-miR-8485 0 1 0
chr19:15237659|15237874 hsa-miR-8485 0 1 0
chr13:110638541|110638610 hsa-miR-8485 0 1 0
chr17:81914093|81914345 hsa-miR-8485 0 1 0
chr4:1394151|1394251 hsa-miR-8485 0 1 0
chr8:22689231|22689399 hsa-miR-8485 0 1 0
chr4:141233821|141234073 hsa-miR-8485 0 1 0
chr5:149683771|149683888 hsa-miR-8485 0 1 0
chr19:16355492|16355644 hsa-miR-8485 0 1 0
chr14:24631972|24632052 hsa-miR-8485 0 1 0
chr11:1753302|1753434 hsa-miR-8485 0 1 0
chr2:237510764|237511101 hsa-miR-8485 0 1 0
chr6:138423448|138423616 hsa-miR-8485 0 1 0
chr22:32861174|32861241 hsa-miR-8485 0 1 0
chr17:32480571|32480804 hsa-miR-8485 0 1 0
chr19:2809916|2810076 hsa-miR-8485 0 1 0
chr15:40853207|40853535 hsa-miR-8485 0 1 0
chr6:44233744|44233924 hsa-miR-8485 0 1 0
chr12:122061217|122061317 hsa-miR-8485 0 1 0
chr3:119589144|119589262 hsa-miR-8485 0 1 0
chr6:35427240|35427360 hsa-miR-8485 0 1 0
chr20:41359594|41359751 hsa-miR-8485 0 1 0
chr1:244707656|244707995 hsa-miR-8485 0 1 0
chr1:45627975|45628115 hsa-miR-8485 0 1 0
chr11:65795828|65795979 hsa-miR-8485 0 1 0
chr3:149286746|149286819 hsa-miR-8485 0 1 0
chr3:38141226|38141326 hsa-miR-8485 0 1 0
chr16:30443800|30444052 hsa-miR-8485 0 1 0
chr1:2405040|2405163 hsa-miR-8485 0 1 0
chr3:123284225|123284328 hsa-miR-8485 0 1 0
chr7:5478564|5478720 hsa-miR-8485 0 1 0
chr2:205776948|205777047 hsa-miR-8485 0 1 0
chr17:63432841|63432980 hsa-miR-8485 0 1 0
chr12:122061113|122061317 hsa-miR-8485 0 1 0
chr5:151030276|151030376 hsa-miR-8485 0 1 0
chr10:73793379|73793534 hsa-miR-8485 0 1 0
chr10:70111937|70112073 hsa-miR-8485 0 1 0
chr15:78982772|78982842 hsa-miR-8485 0 1 0
chr4:77048287|77048385 hsa-miR-8485 0 1 0
chr1:155210658|155210829 hsa-miR-8485 0 1 0
chr9:2192824|2193031 hsa-miR-8485 0 1 0
chr8:42180014|42180311 hsa-miR-8485 0 1 0
chr1:2404892|2405222 hsa-miR-8485 0 1 0
chr11:94876260|94876423 hsa-miR-8485 0 1 0
chr8:22082356|22082522 hsa-miR-8485 0 1 0
chr16:84778992|84779132 hsa-miR-8485 0 1 0
chr1:151773555|151773641 hsa-miR-8485 0 1 0
chr1:2404959|2405183 hsa-miR-8485 0 1 0
chr16:77199138|77199470 hsa-miR-8485 0 1 0
chr12:125142410|125142520 hsa-miR-8485 0 1 0
chr12:122061223|122061317 hsa-miR-8485 0 1 0
chr8:42179961|42180317 hsa-miR-8485 0 1 0
chr5:58458110~58458428 hsa-miR-8485 0 1 0
chrX:154352181~154352397 hsa-miR-8485 0 1 0
chr3:14943525~14943744 hsa-miR-8485 0 1 0
chr8:22082334~22082475 hsa-miR-8485 0 1 0
chr9:128178797~128179014 hsa-miR-8485 0 1 0
chr10:49163179~49163345 hsa-miR-8485 0 1 0
chr16:71626419~71626544 hsa-miR-8485 0 1 0
chr3:13628981~13629222 hsa-miR-8485 0 1 0
chr3:49013784~49013905 hsa-miR-8485 0 1 0
chr10:100548358~100548510 hsa-miR-8485 0 1 0
chr16:29819972~29820049 hsa-miR-8485 0 1 0
chr10:20282105~20282258 hsa-miR-8485 0 1 0
chr15:63324503~63324602 hsa-miR-8485 0 1 0
chr12:132643311~132643530 hsa-miR-8485 0 1 0
chr11:67662480|67662830 hsa-miR-8485 0 1 0
chr15:65577346~65577519 hsa-miR-8485 0 1 0
chr2:219286523~219286640 hsa-miR-8485 0 1 0
chr5:40829641~40829754 hsa-miR-8485 0 1 0
chr9:128178851~128178946 hsa-miR-8485 0 1 0
chr11:85705435~85705545 hsa-miR-8485 0 1 0
chr16:1446263~1446374 hsa-miR-8485 0 1 0
chr17:40456569~40456960 hsa-miR-8485 0 1 0
chr3:119589144~119589262 hsa-miR-8485 0 1 0
chr10:133262864~133263007 hsa-miR-8485 0 1 0
chr5:151028216~151028386 hsa-miR-8485 0 1 0
chrX:110674433~110674655 hsa-miR-8485 0 1 0
chr1:156466986~156467137 hsa-miR-8485 0 1 0
chr6:35427240~35427360 hsa-miR-8485 0 1 0
chr8:117128329~117128443 hsa-miR-8485 0 1 0
chr17:79936868~79936966 hsa-miR-8485 0 1 0
chr17:77500120~77500242 hsa-miR-8485 0 1 0
chr6:42866813~42866964 hsa-miR-8485 0 1 0
chr19:7561246~7561566 hsa-miR-8485 0 1 0
chr10:69507077~69507207 hsa-miR-8485 0 1 0
chr22:27853537|27854876 hsa-miR-8485 0 1 0
chr11:69667379~69667482 hsa-miR-8485 0 1 0
chr17:77499637~77499779 hsa-miR-8485 0 1 0
chr1:217591240~217591337 hsa-miR-8485 0 1 0
chr13:98420518|98420817 hsa-miR-8485 0 1 0
chr10:102814908~102815044 hsa-miR-8485 0 1 0
chr11:1018543~1018647 hsa-miR-8485 0 1 0
chrX:153508993~153509181 hsa-miR-8485 0 1 0
chr7:47276268~47276378 hsa-miR-8485 0 1 0
chr17:77499637~77499712 hsa-miR-8485 0 1 0
chr2:203429921~203430084 hsa-miR-8485 0 1 0
chr2:188995753~188996458 hsa-miR-8485 0 1 0
chr2:237510758~237511101 hsa-miR-8485 0 1 0
chr3:140575786~140575974 hsa-miR-8485 0 1 0
chr10:133262864~133263085 hsa-miR-8485 0 1 0
chr17:79936845~79936966 hsa-miR-8485 0 1 0
chr15:74177574~74177650 hsa-miR-8485 0 1 0
chr2:96772192~96772360 hsa-miR-8485 0 1 0
chr17:77499637~77499781 hsa-miR-8485 0 1 0
chr2:237545493~237545596 hsa-miR-8485 0 1 0
chr3:128813548~128813727 hsa-miR-8485 0 1 0
chrX:154022802~154022946 hsa-miR-8485 0 1 0
chr18:3601415~3601649 hsa-miR-8485 0 1 0
chr11:840243~840385 hsa-miR-8485 0 1 0
chr12:94295161~94295283 hsa-miR-8485 0 1 0
chr20:41179961~41180167 hsa-miR-8485 0 1 0
chr19:56525272~56525355 hsa-miR-8485 0 1 0
chr1:46819199~46819306 hsa-miR-8485 0 1 0
chr5:179836752~179836864 hsa-miR-8485 0 1 0
chr6:7882754~7883124 hsa-miR-8485 0 1 0
chr9:34635243~34635439 hsa-miR-8485 0 1 0
chr11:1753339~1753466 hsa-miR-8485 0 1 0
chrX:153508993~153509131 hsa-miR-8485 0 1 0
chr6:131948399~131948697 hsa-miR-8485 0 1 0
chr8:18529329~18529473 hsa-miR-8485 0 1 0
chrX:153508970~153509123 hsa-miR-8485 0 1 0
chrX:154352311~154352630 hsa-miR-8485 0 1 0
chr19:45474530|45474662 hsa-miR-8485 0 1 0
chr10:791676|791807 hsa-miR-8485 0 1 0
chr8:103428144|103428288 hsa-miR-8485 0 1 0
chr4:57093926|57094018 hsa-miR-8485 0 1 0
chr9:77753126|77753327 hsa-miR-8485 0 1 0
chr20:35628926|35629177 hsa-miR-8485 0 1 0
chr19:15237659|15237822 hsa-miR-8485 0 1 0
chr2:230819759|230819884 hsa-miR-8485 0 1 0
chr1:155736281|155736405 hsa-miR-8485 0 1 0
chr5:139626929|139627053 hsa-miR-8485 0 1 0
chr1:2405040|2405222 hsa-miR-8485 0 1 0
chr2:96772192|96772360 hsa-miR-8485 0 1 0
chr16:18836210|18836363 hsa-miR-8485 0 1 0
chr18:76896244|76896373 hsa-miR-8485 0 1 0
chr6:34587373|34587484 hsa-miR-8485 0 1 0
chr4:139020457|139020537 hsa-miR-8485 0 1 0
chr10:30436451|30436596 hsa-miR-8485 0 1 0
chr17:49827904|49828017 hsa-miR-8485 0 1 0
chr9:2120579|2120761 hsa-miR-8485 0 1 0
chr16:67883586|67883720 hsa-miR-8485 0 1 0
chr7:2646964|2647204 hsa-miR-8485 0 1 0
chr14:68135035|68135167 hsa-miR-8485 0 1 0
chr19:7557046|7557247 hsa-miR-8485 0 1 0
chr18:2981127|2981372 hsa-miR-8485 0 1 0
chr9:92729204|92764549 hsa-miR-8485 0 1 0
chr2:203429921|203430163 hsa-miR-8485 0 1 0
chr1:236215604|236215771 hsa-miR-8485 0 1 0
chr11:62542005|62542328 hsa-miR-8485 0 1 0
chr3:63998322|63998458 hsa-miR-8485 0 1 0
chr7:80653418|80653598 hsa-miR-8485 0 1 0
chr21:44311308|44311489 hsa-miR-8485 0 1 0
chr3:33048386|33048553 hsa-miR-8485 0 1 0
chr7:74404341|74404586 hsa-miR-8485 0 1 0
chr7:43798777|43798942 hsa-miR-8485 0 1 0
chr15:90083511|90083594 hsa-miR-8485 0 1 0
chr6:36720740|36721010 hsa-miR-8485 0 1 0
chr16:1446210|1446374 hsa-miR-8485 0 1 0
chr11:9220829|9221017 hsa-miR-8485 0 1 0
chrX:71103117|71103251 hsa-miR-8485 0 1 0
chr14:24179170|24179281 hsa-miR-8485 0 1 0
chr17:75498925|75499035 hsa-miR-8485 0 1 0
chr21:39011974|39012089 hsa-miR-8485 0 1 0
chr6:20949388|20949524 hsa-miR-8485 0 1 0
chr22:20064953|20065101 hsa-miR-8485 0 1 0
chrX:71249628|71249742 hsa-miR-8485 0 1 0
chr16:12547995|12548105 hsa-miR-8485 0 1 0
chr6:5378947|5379163 hsa-miR-8485 0 1 0
chr1:205626982|205627184 hsa-miR-8485 0 1 0
chr10:26475372|26475493 hsa-miR-8485 0 1 0
chr17:29074006|29074275 hsa-miR-8485 0 1 0
chr2:16450851|16451012 hsa-miR-8485 0 1 0
chr3:15030332|15030452 hsa-miR-8485 0 1 0
chr3:81698133|81698277 hsa-miR-8485 0 1 0
chr18:76362073|76362184 hsa-miR-8485 0 1 0
chr20:51597992|51598162 hsa-miR-8485 0 1 0
chr6:43785628|43785791 hsa-miR-8485 0 1 0
chr15:40853172|40853558 hsa-miR-8485 0 1 0
chr6:31927763|31928054 hsa-miR-8485 0 1 0
chr17:79935993|79936292 hsa-miR-8485 0 1 0
chr22:19175898|19176106 hsa-miR-8485 0 1 0
chr21:41885963|41886111 hsa-miR-8485 0 1 0
chr14:24416637|24416758 hsa-miR-8485 0 1 0
chr12:10221950|10222129 hsa-miR-8485 0 1 0
chr17:18209677|18209918 hsa-miR-8485 0 1 0
chr22:46362309|46362499 hsa-miR-8485 0 1 0
chr6:30897425|30897505 hsa-miR-8485 0 1 0
chr4:54739643|54739740 hsa-miR-8485 0 1 0
chr5:179836745|179836840 hsa-miR-8485 0 1 0
chr2:230819757|230819884 hsa-miR-8485 0 1 0
chr19:10643847|10644083 hsa-miR-8485 0 1 0
chr1:155899379|155899523 hsa-miR-8485 0 1 0
chr7:30446009|30446163 hsa-miR-8485 0 1 0
chr6:349285|349409 hsa-miR-8485 0 1 0
chr15:75371926|75372057 hsa-miR-8485 0 1 0
chr1:161158510|161158795 hsa-miR-8485 0 1 0
chr6:90515689|90515817 hsa-miR-8485 0 1 0
chr20:57649473|57649645 hsa-miR-8485 0 1 0
chr20:36527955|36528135 hsa-miR-8485 0 1 0
chr2:3477948|3478233 hsa-miR-8485 0 1 0
chr19:18671095|18671268 hsa-miR-8485 0 1 0
chr10:128107564|128107663 hsa-miR-8485 0 1 0
chr14:91018750|91018925 hsa-miR-8485 0 1 0
chr6:32746030|32746325 hsa-miR-8485 0 1 0
chr9:115086433|115086584 hsa-miR-8485 0 1 0
chr2:221419922|221420064 hsa-miR-8485 0 1 0
chr6:138423519|138423633 hsa-miR-8485 0 1 0
chr22:35739400|35739613 hsa-miR-8485 0 1 0
chr19:10643847|10644027 hsa-miR-8485 0 1 0
chr19:50496919|50497092 hsa-miR-8485 0 1 0
chr12:10221974|10222129 hsa-miR-8485 0 1 0
chr11:70436010|70436181 hsa-miR-8485 0 1 0
chr3:66003562|66003661 hsa-miR-8485 0 1 0
chr2:229124832|229124998 hsa-miR-8485 0 1 0
chr14:90407944|90408098 hsa-miR-8485 0 1 0
chr1:2405040|2405199 hsa-miR-8485 0 1 0
chr22:32859857|32860058 hsa-miR-8485 0 1 0
chr1:228205324|228205444 hsa-miR-8485 0 1 0
chr20:3805266|3805354 hsa-miR-8485 0 1 0
chr10:89418064|89418257 hsa-miR-8485 0 1 0
chr6:31927752|31928094 hsa-miR-8485 0 1 0
chr9:136718289|136718480 hsa-miR-8485 0 1 0
chr12:122061199|122061317 hsa-miR-8485 0 1 0
chr2:120221754|120221911 hsa-miR-8485 0 1 0
chr19:46624997|46625105 hsa-miR-8485 0 1 0
chr7:1549147|1549310 hsa-miR-8485 0 1 0
chr1:149846035|149846181 hsa-miR-8485 0 1 0
chrX:154352263|154352372 hsa-miR-8485 0 1 0
chr1:161047218|161047327 hsa-miR-8485 0 1 0
chr6:32948724|32949627 hsa-miR-8485 0 1 0
chr9:137102499|137102739 hsa-miR-8485 0 1 0
chr2:237510677|237511039 hsa-miR-8485 0 1 0
chrX:23784925|23785039 hsa-miR-8485 0 1 0
chr17:47928378|47928515 hsa-miR-8485 0 1 0
chr3:50269191|50269264 hsa-miR-8485 0 1 0
chr1:156466986|156467148 hsa-miR-8485 0 1 0
chr22:19019389|19019556 hsa-miR-8485 0 1 0
chr17:63432860|63432980 hsa-miR-8485 0 1 0
chr12:2849553|2849752 hsa-miR-8485 0 1 0
chr9:133254567|133254726 hsa-miR-8485 0 1 0
chr9:127749419|127749542 hsa-miR-8485 0 1 0
chr7:102282735|102283108 hsa-miR-8485 0 1 0
chr1:151773555|151773645 hsa-miR-8485 0 1 0
chr7:137976862|137977002 hsa-miR-8485 0 1 0
chr21:44079564|44080127 hsa-miR-8485 0 1 0
chr7:845141|845330 hsa-miR-8485 0 1 0
chr2:237510704|237511095 hsa-miR-8485 0 1 0
chr1:12011936|12012292 hsa-miR-8485 0 1 0
chr2:20201387|20201534 hsa-miR-8485 0 1 0
chr12:57096212|57096400 hsa-miR-8485 0 1 0
chr15:72250146|72250300 hsa-miR-8485 0 1 0
chr5:179836608|179836807 hsa-miR-8485 0 1 0
chr6:32948724|32948852 hsa-miR-8485 0 1 0
chr6:33453329|33453446 hsa-miR-8485 0 1 0
chr12:10221960|10222129 hsa-miR-8485 0 1 0
chr15:98963952|98964039 hsa-miR-8485 0 1 0
chr1:156465568|156465667 hsa-miR-8485 0 1 0
chr1:3775965|3776081 hsa-miR-8485 0 1 0
chr7:138001700|138001994 hsa-miR-8485 0 1 0
chr15:98963948|98964039 hsa-miR-8485 0 1 0
chr16:67438052|67438202 hsa-miR-8485 0 1 0
chr14:36482091|36482240 hsa-miR-8485 0 1 0
chr11:840243|840351 hsa-miR-8485 0 1 0
chr14:36482091|36482266 hsa-miR-8485 0 1 0
chr8:42179961|42180298 hsa-miR-8485 0 1 0
chr11:490780|490943 hsa-miR-8485 0 1 0
chr22:41179179|41179270 hsa-miR-8485 0 1 0
chr17:81231213|81231365 hsa-miR-8485 0 1 0
chr2:188996150|188996471 hsa-miR-8485 0 1 0
chr9:115086448|115086563 hsa-miR-8485 0 1 0
chr17:29073935|29074205 hsa-miR-8485 0 1 0
chrX:118793592|118793763 hsa-miR-8485 0 1 0
chr1:156466928|156467137 hsa-miR-8485 0 1 0
chr1:206487669|206487847 hsa-miR-8485 0 1 0
chr6:31171197|31171386 hsa-miR-8485 0 1 0
chr16:28595415|28595671 hsa-miR-8485 0 1 0
chr6:33006474|33006666 hsa-miR-8485 0 1 0
chr11:1753275|1753468 hsa-miR-8485 0 1 0
chr2:188996125|188996461 hsa-miR-8485 0 1 0
chr12:56238146|56238354 hsa-miR-8485 0 1 0
chr12:122061155|122061317 hsa-miR-8485 0 1 0
chr16:19062252|19062421 hsa-miR-8485 0 1 0
chr8:42180017|42180298 hsa-miR-8485 0 1 0
chr9:136940601|136940856 hsa-miR-8485 0 1 0
chr11:75205424|75205589 hsa-miR-8485 0 1 0
chr6:160105650|160105752 hsa-miR-8485 0 1 0
chr6:32938684|32938840 hsa-miR-8485 0 1 0
chr20:47209853|47209985 hsa-miR-8485 0 1 0
chr19:2715885|2716019 hsa-miR-8485 0 1 0
chr2:46386184|46386461 hsa-miR-8485 0 1 0
chr22:41906912|41907228 hsa-miR-8485 0 1 0
chr6:35427210|35427360 hsa-miR-8485 0 1 0
chrX:154352181|154352423 hsa-miR-8485 0 1 0
chr22:32861191|32861383 hsa-miR-8485 0 1 0
chr11:790987|791293 hsa-miR-8485 0 1 0
chr17:81117961|81118138 hsa-miR-8485 0 1 0
chr1:205714059|205714174 hsa-miR-8485 0 1 0
chr7:88283046|88283171 hsa-miR-8485 0 1 0
chr2:12717788|12718017 hsa-miR-8485 0 1 0
chr17:77499637|77499788 hsa-miR-8485 0 1 0
chr3:49013787|49013959 hsa-miR-8485 0 1 0
chr17:77499637|77499771 hsa-miR-8485 0 1 0
chr3:171859693|171859891 hsa-miR-8485 0 1 0
chr17:77499637|77499781 hsa-miR-8485 0 1 0
chr17:18317500|18317663 hsa-miR-8485 -2 1 0
chr5:151028216|151028386 hsa-miR-8485 -9 1 0
chr1:161158629|161158781 hsa-miR-8485 -10 1 0
chr19:55202056|55205592 hsa-miR-8485 -4 1 0
chr6:7882894|7883139 hsa-miR-8485 -9 1 0
chr13:112885383|112885570 hsa-miR-8485 -11 1 0
chr10:70879334|70879481 hsa-miR-8485 -26 1 0
chr1:205768158|205768276 hsa-miR-8485 -1 1 0
chr22:40323858|40324106 hsa-miR-8485 -10 1 0
chr16:71626424|71626544 hsa-miR-8485 -3 1 0
chr11:118897437|118897601 hsa-miR-8485 -2 1 0
chr7:74195984|74196122 hsa-miR-8485 0 1 0
chr10:133262805|133262924 hsa-miR-8485 0 1 0
chr9:86300735|86300869 hsa-miR-8485 0 1 0
chr7:101004761|101004934 hsa-miR-8485 0 1 0
chr20:57649588|57649770 hsa-miR-8485 0 1 0
chr9:128178797|128178916 hsa-miR-8485 0 1 0
chr20:54004008|54004125 hsa-miR-8485 0 1 0
chr5:176397666|176397991 hsa-miR-8485 0 1 0
chr21:46193952|46194079 hsa-miR-8485 0 1 0
chr3:38142286|38142355 hsa-miR-8485 0 1 0
chr20:3805266|3805371 hsa-miR-8485 0 1 0
chr2:188996125|188996463 hsa-miR-8485 0 1 0
chr1:45627975|45628119 hsa-miR-8485 0 1 0
chrX:106928154|106928525 hsa-miR-8485 0 1 0
chrX:48819391|48819485 hsa-miR-8485 0 1 0
chr2:96622751|96622888 hsa-miR-8485 0 1 0
chr9:128178851|128179198 hsa-miR-8485 0 1 0
chr9:21331466|21331573 hsa-miR-8485 0 1 0
chr16:84778992|84779150 hsa-miR-8485 0 1 0
chr12:57096212|57096409 hsa-miR-8485 0 1 0
chr2:189578090|189578221 hsa-miR-8485 0 1 0
chr6:160105542|160105744 hsa-miR-8485 0 1 0
chr6:160105601|160105762 hsa-miR-8485 0 1 0
chr16:77200156|77200326 hsa-miR-8485 0 1 0
chr21:44853040|44853223 hsa-miR-8485 0 1 0
chr8:141431440|141431696 hsa-miR-8485 0 1 0
chr1:161158521|161158728 hsa-miR-8485 0 1 0
chr6:154738004|154738121 hsa-miR-8485 0 1 0
chr6:30897087|30897469 hsa-miR-8485 0 1 0
chr9:129889822|129890128 hsa-miR-8485 0 1 0
chr11:490709|490890 hsa-miR-8485 0 1 0
chr5:179836595|179836923 hsa-miR-8485 0 1 0
chr6:31927752|31928054 hsa-miR-8485 0 1 0
chr1:45627940|45628121 hsa-miR-8485 0 1 0
chr5:139482586|139482759 hsa-miR-8485 0 1 0
chr19:19197213|19197605 hsa-miR-8485 0 1 0
chr17:43210932|43211034 hsa-miR-8485 0 1 0
chr17:28723893|28724017 hsa-miR-8485 0 1 0
chr1:12209029|12209208 hsa-miR-8485 0 1 0
chr2:25743057|25743202 hsa-miR-8485 0 1 0
chr11:57700365|57700506 hsa-miR-8485 0 1 0
chr11:12942447|12942576 hsa-miR-8485 0 1 0
chr19:13927049|13927247 hsa-miR-8485 0 1 0
chr12:56238265|56238354 hsa-miR-8485 0 1 0
chr9:121179456|121179581 hsa-miR-8485 0 1 0
chr2:230819759|230819873 hsa-miR-8485 0 1 0
chr2:219220154|219220341 hsa-miR-8485 0 1 0
chr9:136940676|136940818 hsa-miR-8485 0 1 0
chr1:160997780|160997903 hsa-miR-8485 0 1 0
chr1:156466986|156467120 hsa-miR-8485 0 1 0
chr16:2239774|2239893 hsa-miR-8485 0 1 0
chr19:56423594|56423756 hsa-miR-8485 0 1 0
chrX:106930659|106930788 hsa-miR-8485 0 1 0
chr1:2405040|2405183 hsa-miR-8485 0 1 0
chr16:84778987|84779142 hsa-miR-8485 0 1 0
chr6:35427124|35427360 hsa-miR-8485 0 1 0
chr12:48148982|48149146 hsa-miR-8485 0 1 0
chr9:95468980|95469116 hsa-miR-8485 0 1 0
chr3:125190443|125190811 hsa-miR-8485 0 1 0
chr19:7561230|7561566 hsa-miR-8485 0 1 0
chr6:33453337|33453446 hsa-miR-8485 0 1 0
chr15:40853181|40853535 hsa-miR-8485 0 1 0
chr22:32859964|32860104 hsa-miR-8485 0 1 0
chr11:69652204|69652392 hsa-miR-8485 0 1 0
chr15:43403753|43403950 hsa-miR-8485 0 1 0
chr13:113640402|113640620 hsa-miR-8485 0 1 0
chr2:20448161|20448364 hsa-miR-8485 0 1 0
chr14:24416681|24416849 hsa-miR-8485 0 1 0
chr20:37518675|37518795 hsa-miR-8485 0 1 0
chr6:44233744|44233911 hsa-miR-8485 0 1 0
chr20:45420394|45420578 hsa-miR-8485 0 1 0
chr18:8406206|8406418 hsa-miR-8485 0 1 0
chr9:136940516|136940850 hsa-miR-8485 0 1 0
chrX:154352306|154352418 hsa-miR-8485 0 1 0
chr1:225846480|225846626 hsa-miR-8485 0 1 0
chr2:47070255|47070420 hsa-miR-8485 0 1 0
chr4:110050192|110050364 hsa-miR-8485 0 1 0
chr2:96860205|96860393 hsa-miR-8485 0 1 0
chr12:122061199|122061341 hsa-miR-8485 0 1 0
chr7:135675751|135675921 hsa-miR-8485 0 1 0
chr4:158833556|158833854 hsa-miR-8485 0 1 0
chr16:89638286|89638400 hsa-miR-8485 0 1 0
chr16:67883592|67883664 hsa-miR-8485 0 1 0
chr12:89521918|89522067 hsa-miR-8485 0 1 0
chr12:10851413|10851651 hsa-miR-8485 0 1 0
chr2:105893768|105893996 hsa-miR-8485 0 1 0
chr6:30897117|30897469 hsa-miR-8485 0 1 0
chr17:4164749|4164891 hsa-miR-8485 0 1 0
chr6:15520672|15520807 hsa-miR-8485 1 0 0
chr19:41207247|41207408 hsa-miR-8485 1 0 0
chr2:85344299|85344659 hsa-miR-8485 1 0 0
chr4:121127239|121127384 hsa-miR-8485 1 0 0
chr12:38652567|38652810 hsa-miR-8485 1 0 0
chr1:26854817|26854993 hsa-miR-8485 1 0 0
chr6:15520613|15520807 hsa-miR-8485 1 0 0
chr2:241745876|241746037 hsa-miR-8485 1 0 0
chr17:8160598|8160790 hsa-miR-8485 1 0 0
chr10:112446208|112446340 hsa-miR-8485 1 0 0
chr10:70879329|70879492 hsa-miR-8485 1 0 0
chr11:57407405|57407769 hsa-miR-8485 1 0 0
chrX:68841242|68841524 hsa-miR-8485 1 0 0
chr20:36607797|36607931 hsa-miR-8485 1 0 0
chr1:43704712|43704917 hsa-miR-8485 1 0 0
chr14:104889565|104892991 hsa-miR-8485 1 0 0
chr11:1753339|1753479 hsa-miR-8485 1 0 0
chr5:126777216|126777421 hsa-miR-8485 1 0 0
chr9:35104471|35104628 hsa-miR-8485 1 0 0
chr12:117208269|117208626 hsa-miR-8485 1 0 0
chr6:15520611|15520807 hsa-miR-8485 1 0 0
chr16:79598232|79598438 hsa-miR-8485 1 0 0
chr9:123103934|123104067 hsa-miR-8485 1 0 0
chr17:78972672|78973037 hsa-miR-8485 1 0 0
chr15:89834422|89834591 hsa-miR-8485 1 0 0
chr5:97030440|97030714 hsa-miR-8485 1 0 0
chr17:43015302|43015444 hsa-miR-8485 1 0 0
chr16:30084257|30084370 hsa-miR-8485 1 0 0
chr6:143060977|143061295 hsa-miR-8485 1 0 0
chr3:128813336|128813721 hsa-miR-8485 1 0 0
chr16:81711260|81711520 hsa-miR-8485 1 0 0
chr16:67438444|67438563 hsa-miR-8485 1 0 0
chr3:143122506|143122639 hsa-miR-8485 1 0 0
chr22:37772849|37773136 hsa-miR-8485 1 0 0
chr11:59637884|59638056 hsa-miR-8485 1 0 0
chr19:35123275|35123594 hsa-miR-8485 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-8485 TARDBP TAR DNA binding protein HGNC:11571 details
hsa-miR-8485 SERINC1 serine incorporator 1 HGNC:13464 details
hsa-miR-8485 FLCN folliculin HGNC:27310 details
hsa-miR-8485 SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-8485 NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-8485 CANX calnexin HGNC:1473 details
hsa-miR-8485 C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-8485 FAM177A1 family with sequence similarity 177 member A1 HGNC:19829 details
hsa-miR-8485 ALPK3 alpha kinase 3 HGNC:17574 details
hsa-miR-8485 SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-8485 PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-8485 CTBP2 C-terminal binding protein 2 HGNC:2495 details
hsa-miR-8485 PPTC7 protein phosphatase targeting COQ7 HGNC:30695 details
hsa-miR-8485 MMAB metabolism of cobalamin associated B HGNC:19331 details
hsa-miR-8485 TIGIT T cell immunoreceptor with Ig and ITIM domains HGNC:26838 details
hsa-miR-8485 ZNF780A zinc finger protein 780A HGNC:27603 details
hsa-miR-8485 ATP6V0D1 ATPase H+ transporting V0 subunit d1 HGNC:13724 details
hsa-miR-8485 RAB11FIP5 RAB11 family interacting protein 5 HGNC:24845 details
hsa-miR-8485 TBPL1 TATA-box binding protein like 1 HGNC:11589 details
hsa-miR-8485 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-8485 LPAR3 lysophosphatidic acid receptor 3 HGNC:14298 details
hsa-miR-8485 RTL6 retrotransposon Gag like 6 HGNC:13343 details
hsa-miR-8485 KCTD11 potassium channel tetramerization domain containing 11 HGNC:21302 details
hsa-miR-8485 CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-8485 TSPAN2 tetraspanin 2 HGNC:20659 details
hsa-miR-8485 KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-8485 TMEM132B transmembrane protein 132B HGNC:29397 details
hsa-miR-8485 CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-8485 HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-8485 AGPS alkylglycerone phosphate synthase HGNC:327 details
hsa-miR-8485 STARD8 StAR related lipid transfer domain containing 8 HGNC:19161 details
hsa-miR-8485 CSTF1 cleavage stimulation factor subunit 1 HGNC:2483 details
hsa-miR-8485 ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-8485 KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-8485 KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-8485 HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-8485 DIRAS2 DIRAS family GTPase 2 HGNC:19323 details
hsa-miR-8485 CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-8485 RHOQ ras homolog family member Q HGNC:17736 details
hsa-miR-8485 LRRC63 leucine rich repeat containing 63 HGNC:34296 details
hsa-miR-8485 SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-8485 WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-8485 CCT4 chaperonin containing TCP1 subunit 4 HGNC:1617 details
hsa-miR-8485 WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-8485 TECRL trans-2,3-enoyl-CoA reductase like HGNC:27365 details
hsa-miR-8485 AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-8485 AR androgen receptor HGNC:644 details
hsa-miR-8485 DBT dihydrolipoamide branched chain transacylase E2 HGNC:2698 details
hsa-miR-8485 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-8485 VENTX VENT homeobox HGNC:13639 details
hsa-miR-8485 SCIN scinderin HGNC:21695 details
hsa-miR-8485 COL8A1 collagen type VIII alpha 1 chain HGNC:2215 details
hsa-miR-8485 CD180 CD180 molecule HGNC:6726 details
hsa-miR-8485 ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-8485 ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-8485 UCHL3 ubiquitin C-terminal hydrolase L3 HGNC:12515 details
hsa-miR-8485 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-8485 PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-8485 PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-8485 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-8485 PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-8485 PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-8485 PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-8485 MSL1 MSL complex subunit 1 HGNC:27905 details
hsa-miR-8485 MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-8485 NEXMIF neurite extension and migration factor HGNC:29433 details
hsa-miR-8485 IPO5 importin 5 HGNC:6402 details
hsa-miR-8485 INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-8485 IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-8485 IL1RAPL1 interleukin 1 receptor accessory protein like 1 HGNC:5996 details
hsa-miR-8485 FBXO9 F-box protein 9 HGNC:13588 details
hsa-miR-8485 EIF5 eukaryotic translation initiation factor 5 HGNC:3299 details
hsa-miR-8485 CFL2 cofilin 2 HGNC:1875 details
hsa-miR-8485 BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-8485 BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-8485 BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-8485 ANKRD44 ankyrin repeat domain 44 HGNC:25259 details
hsa-miR-8485 AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-8485 AFF1 AF4/FMR2 family member 1 HGNC:7135 details
hsa-miR-8485 DROSHA drosha ribonuclease III HGNC:17904 details
hsa-miR-8485 CCDC169 coiled-coil domain containing 169 HGNC:34361 details
hsa-miR-8485 POU5F1B POU class 5 homeobox 1B HGNC:9223 details
hsa-miR-8485 IL5RA interleukin 5 receptor subunit alpha HGNC:6017 details
hsa-miR-8485 HAT1 histone acetyltransferase 1 HGNC:4821 details
hsa-miR-8485 LRRC38 leucine rich repeat containing 38 HGNC:27005 details
hsa-miR-8485 CNTF ciliary neurotrophic factor HGNC:2169 details
hsa-miR-8485 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 HGNC:29286 details
hsa-miR-8485 XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-8485 ADAM33 ADAM metallopeptidase domain 33 HGNC:15478 details
hsa-miR-8485 IGBP1 immunoglobulin binding protein 1 HGNC:5461 details
hsa-miR-8485 MPO myeloperoxidase HGNC:7218 details
hsa-miR-8485 WAPL WAPL cohesin release factor HGNC:23293 details
hsa-miR-8485 VANGL1 VANGL planar cell polarity protein 1 HGNC:15512 details
hsa-miR-8485 TATDN2 TatD DNase domain containing 2 HGNC:28988 details
hsa-miR-8485 ESYT2 extended synaptotagmin 2 HGNC:22211 details
hsa-miR-8485 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-8485 details
hsa-miR-8485 ARID3A AT-rich interaction domain 3A HGNC:3031 details
hsa-miR-8485 ZNF556 zinc finger protein 556 HGNC:25669 details
hsa-miR-8485 CD19 CD19 molecule HGNC:1633 details
hsa-miR-8485 PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-8485 EID1 EP300 interacting inhibitor of differentiation 1 HGNC:1191 details
hsa-miR-8485 KIAA0408 KIAA0408 HGNC:21636 details
hsa-miR-8485 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 HGNC:7688 details
hsa-miR-8485 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-8485 MTA3 metastasis associated 1 family member 3 HGNC:23784 details
hsa-miR-8485 LILRB2 leukocyte immunoglobulin like receptor B2 HGNC:6606 details
hsa-miR-8485 ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-8485 AFF2 AF4/FMR2 family member 2 HGNC:3776 details
hsa-miR-8485 GSTM4 glutathione S-transferase mu 4 HGNC:4636 details
hsa-miR-8485 SH3PXD2A SH3 and PX domains 2A HGNC:23664 details
hsa-miR-8485 details
hsa-miR-8485 ATAT1 alpha tubulin acetyltransferase 1 HGNC:21186 details
hsa-miR-8485 OCLN occludin HGNC:8104 details
hsa-miR-8485 ZC3H6 zinc finger CCCH-type containing 6 HGNC:24762 details
hsa-miR-8485 MC2R melanocortin 2 receptor HGNC:6930 details
hsa-miR-8485 MLLT6 MLLT6, PHD finger containing HGNC:7138 details
hsa-miR-8485 ZMAT4 zinc finger matrin-type 4 HGNC:25844 details
hsa-miR-8485 DMXL1 Dmx like 1 HGNC:2937 details
hsa-miR-8485 NLRP8 NLR family pyrin domain containing 8 HGNC:22940 details
hsa-miR-8485 LHFPL3 LHFPL tetraspan subfamily member 3 HGNC:6589 details
hsa-miR-8485 ATG10 autophagy related 10 HGNC:20315 details
hsa-miR-8485 STRN striatin HGNC:11424 details
hsa-miR-8485 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 HGNC:25248 details
hsa-miR-8485 RALGPS1 Ral GEF with PH domain and SH3 binding motif 1 HGNC:16851 details
hsa-miR-8485 TBRG4 transforming growth factor beta regulator 4 HGNC:17443 details
hsa-miR-8485 PDZD2 PDZ domain containing 2 HGNC:18486 details
hsa-miR-8485 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 HGNC:10871 details
hsa-miR-8485 STRBP spermatid perinuclear RNA binding protein HGNC:16462 details
hsa-miR-8485 SOGA3 SOGA family member 3 HGNC:21494 details
hsa-miR-8485 MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-8485 KCNJ12 potassium inwardly rectifying channel subfamily J member 12 HGNC:6258 details
hsa-miR-8485 FRMD3 FERM domain containing 3 HGNC:24125 details
hsa-miR-8485 ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-8485 ARF3 ADP ribosylation factor 3 HGNC:654 details
hsa-miR-8485 SYT5 synaptotagmin 5 HGNC:11513 details
hsa-miR-8485 PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-8485 details
hsa-miR-8485 CCDC160 coiled-coil domain containing 160 HGNC:37286 details
hsa-miR-8485 PLCL1 phospholipase C like 1 (inactive) HGNC:9063 details
hsa-miR-8485 KIAA0232 KIAA0232 HGNC:28992 details
hsa-miR-8485 MGAT5 alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase HGNC:7049 details
hsa-miR-8485 SLC16A9 solute carrier family 16 member 9 HGNC:23520 details
hsa-miR-8485 NBPF10 NBPF member 10 HGNC:31992 details
hsa-miR-8485 FAM180B family with sequence similarity 180 member B HGNC:34451 details
hsa-miR-8485 ASS1 argininosuccinate synthase 1 HGNC:758 details
hsa-miR-8485 KCNK10 potassium two pore domain channel subfamily K member 10 HGNC:6273 details
hsa-miR-8485 REXO2 RNA exonuclease 2 HGNC:17851 details
hsa-miR-8485 NPTXR neuronal pentraxin receptor HGNC:7954 details
hsa-miR-8485 EPHB3 EPH receptor B3 HGNC:3394 details
hsa-miR-8485 EGR3 early growth response 3 HGNC:3240 details
hsa-miR-8485 CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-8485 IRS1 insulin receptor substrate 1 HGNC:6125 details
hsa-miR-8485 VAC14 VAC14 component of PIKFYVE complex HGNC:25507 details
hsa-miR-8485 TFCP2 transcription factor CP2 HGNC:11748 details
hsa-miR-8485 ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-8485 details
hsa-miR-8485 SLC6A6 solute carrier family 6 member 6 HGNC:11052 details
hsa-miR-8485 PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-8485 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-8485 KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-8485 CYLD CYLD lysine 63 deubiquitinase HGNC:2584 details
hsa-miR-8485 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 HGNC:15606 details
hsa-miR-8485 UGT2B4 UDP glucuronosyltransferase family 2 member B4 HGNC:12553 details
hsa-miR-8485 ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-8485 SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-8485 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 HGNC:7707 details
hsa-miR-8485 TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-8485 HOXA5 homeobox A5 HGNC:5106 details
hsa-miR-8485 ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-8485 ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-8485 NUP37 nucleoporin 37 HGNC:29929 details
hsa-miR-8485 RHCG Rh family C glycoprotein HGNC:18140 details
hsa-miR-8485 CLEC12A C-type lectin domain family 12 member A HGNC:31713 details
hsa-miR-8485 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 HGNC:23148 details
hsa-miR-8485 OPN5 opsin 5 HGNC:19992 details
hsa-miR-8485 POT1 protection of telomeres 1 HGNC:17284 details
hsa-miR-8485 UBTF upstream binding transcription factor HGNC:12511 details
hsa-miR-8485 RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-8485 MESD mesoderm development LRP chaperone HGNC:13520 details
hsa-miR-8485 ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-8485 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-8485 TRAF5 TNF receptor associated factor 5 HGNC:12035 details
hsa-miR-8485 TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-8485 TIMM10 translocase of inner mitochondrial membrane 10 HGNC:11814 details
hsa-miR-8485 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein HGNC:16918 details
hsa-miR-8485 SV2B synaptic vesicle glycoprotein 2B HGNC:16874 details
hsa-miR-8485 details
hsa-miR-8485 KCNJ3 potassium inwardly rectifying channel subfamily J member 3 HGNC:6264 details
hsa-miR-8485 FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-8485 DDX5 DEAD-box helicase 5 HGNC:2746 details
hsa-miR-8485 BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-8485 RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-8485 CBX2 chromobox 2 HGNC:1552 details
hsa-miR-8485 PAGR1 PAXIP1 associated glutamate rich protein 1 HGNC:28707 details
hsa-miR-8485 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-8485 WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-8485 KCNC4 potassium voltage-gated channel subfamily C member 4 HGNC:6236 details
hsa-miR-8485 GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-8485 PPM1B protein phosphatase, Mg2+/Mn2+ dependent 1B HGNC:9276 details
hsa-miR-8485 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 HGNC:29290 details
hsa-miR-8485 PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-8485 details
hsa-miR-8485 TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-8485 PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-8485 AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-8485 EVI2A ecotropic viral integration site 2A HGNC:3499 details
hsa-miR-8485 DONSON DNA replication fork stabilization factor DONSON HGNC:2993 details
hsa-miR-8485 PHKA1 phosphorylase kinase regulatory subunit alpha 1 HGNC:8925 details
hsa-miR-8485 KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-8485 SGIP1 SH3GL interacting endocytic adaptor 1 HGNC:25412 details
hsa-miR-8485 SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-8485 SLC25A44 solute carrier family 25 member 44 HGNC:29036 details
hsa-miR-8485 details
hsa-miR-8485 TPGS2 tubulin polyglutamylase complex subunit 2 HGNC:24561 details
hsa-miR-8485 P2RY1 purinergic receptor P2Y1 HGNC:8539 details
hsa-miR-8485 TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-8485 ETS1 ETS proto-oncogene 1, transcription factor HGNC:3488 details
hsa-miR-8485 SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-8485 SYT2 synaptotagmin 2 HGNC:11510 details
hsa-miR-8485 TMEM30B transmembrane protein 30B HGNC:27254 details
hsa-miR-8485 MYSM1 Myb like, SWIRM and MPN domains 1 HGNC:29401 details
hsa-miR-8485 PIWIL2 piwi like RNA-mediated gene silencing 2 HGNC:17644 details
hsa-miR-8485 PRKX protein kinase X-linked HGNC:9441 details
hsa-miR-8485 CD36 CD36 molecule HGNC:1663 details
hsa-miR-8485 ABCF3 ATP binding cassette subfamily F member 3 HGNC:72 details
hsa-miR-8485 BNC2 basonuclin 2 HGNC:30988 details
hsa-miR-8485 COPS7B COP9 signalosome subunit 7B HGNC:16760 details
hsa-miR-8485 MCTS1 MCTS1 re-initiation and release factor HGNC:23357 details
hsa-miR-8485 CACUL1 CDK2 associated cullin domain 1 HGNC:23727 details
hsa-miR-8485 ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-8485 UNC5B unc-5 netrin receptor B HGNC:12568 details
hsa-miR-8485 details
hsa-miR-8485 ZDHHC22 zinc finger DHHC-type palmitoyltransferase 22 HGNC:20106 details
hsa-miR-8485 RNF152 ring finger protein 152 HGNC:26811 details
hsa-miR-8485 STAT5B signal transducer and activator of transcription 5B HGNC:11367 details
hsa-miR-8485 FLT1 fms related receptor tyrosine kinase 1 HGNC:3763 details
hsa-miR-8485 EPG5 ectopic P-granules autophagy protein 5 homolog HGNC:29331 details
hsa-miR-8485 NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-8485 TMEM178B transmembrane protein 178B HGNC:44112 details
hsa-miR-8485 TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-8485 CLASP1 cytoplasmic linker associated protein 1 HGNC:17088 details
hsa-miR-8485 HPS4 HPS4 biogenesis of lysosomal organelles complex 3 subunit 2 HGNC:15844 details
hsa-miR-8485 details
hsa-miR-8485 ANKLE1 ankyrin repeat and LEM domain containing 1 HGNC:26812 details
hsa-miR-8485 NMRK1 nicotinamide riboside kinase 1 HGNC:26057 details
hsa-miR-8485 MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-8485 CCDC9 coiled-coil domain containing 9 HGNC:24560 details
hsa-miR-8485 KIF5C kinesin family member 5C HGNC:6325 details
hsa-miR-8485 ABLIM1 actin binding LIM protein 1 HGNC:78 details
hsa-miR-8485 CHRDL1 chordin like 1 HGNC:29861 details
hsa-miR-8485 KCNJ10 potassium inwardly rectifying channel subfamily J member 10 HGNC:6256 details
hsa-miR-8485 details
hsa-miR-8485 NANOS1 nanos C2HC-type zinc finger 1 HGNC:23044 details
hsa-miR-8485 SLFN5 schlafen family member 5 HGNC:28286 details
hsa-miR-8485 DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-8485 GTPBP1 GTP binding protein 1 HGNC:4669 details
hsa-miR-8485 MOBP myelin associated oligodendrocyte basic protein HGNC:7189 details
hsa-miR-8485 HRK harakiri, BCL2 interacting protein HGNC:5185 details
hsa-miR-8485 MUC15 mucin 15, cell surface associated HGNC:14956 details
hsa-miR-8485 ASAH2 N-acylsphingosine amidohydrolase 2 HGNC:18860 details
hsa-miR-8485 PTPN3 protein tyrosine phosphatase non-receptor type 3 HGNC:9655 details
hsa-miR-8485 REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-8485 RAPGEFL1 Rap guanine nucleotide exchange factor like 1 HGNC:17428 details
hsa-miR-8485 PAK6 p21 (RAC1) activated kinase 6 HGNC:16061 details
hsa-miR-8485 MED28 mediator complex subunit 28 HGNC:24628 details
hsa-miR-8485 LNPEP leucyl and cystinyl aminopeptidase HGNC:6656 details
hsa-miR-8485 MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-8485 FAM216B family with sequence similarity 216 member B HGNC:26883 details
hsa-miR-8485 PARN poly(A)-specific ribonuclease HGNC:8609 details
hsa-miR-8485 PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-8485 SLC30A3 solute carrier family 30 member 3 HGNC:11014 details
hsa-miR-8485 GLCCI1 glucocorticoid induced 1 HGNC:18713 details
hsa-miR-8485 ATP9A ATPase phospholipid transporting 9A (putative) HGNC:13540 details
hsa-miR-8485 PIGS phosphatidylinositol glycan anchor biosynthesis class S HGNC:14937 details
hsa-miR-8485 NLRP11 NLR family pyrin domain containing 11 HGNC:22945 details
hsa-miR-8485 SMCO4 single-pass membrane protein with coiled-coil domains 4 HGNC:24810 details
hsa-miR-8485 ASAH2B N-acylsphingosine amidohydrolase 2B HGNC:23456 details
hsa-miR-8485 details
hsa-miR-8485 details
hsa-miR-8485 WNT7A Wnt family member 7A HGNC:12786 details
hsa-miR-8485 PRSS23 serine protease 23 HGNC:14370 details
hsa-miR-8485 FIG4 FIG4 phosphoinositide 5-phosphatase HGNC:16873 details
hsa-miR-8485 TNIP3 TNFAIP3 interacting protein 3 HGNC:19315 details
hsa-miR-8485 FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-8485 CPEB3 cytoplasmic polyadenylation element binding protein 3 HGNC:21746 details
hsa-miR-8485 SYT17 synaptotagmin 17 HGNC:24119 details
hsa-miR-8485 WSCD2 WSC domain containing 2 HGNC:29117 details
hsa-miR-8485 TMEM79 transmembrane protein 79 HGNC:28196 details
hsa-miR-8485 PKNOX1 PBX/knotted 1 homeobox 1 HGNC:9022 details
hsa-miR-8485 WNT9A Wnt family member 9A HGNC:12778 details
hsa-miR-8485 ITGBL1 integrin subunit beta like 1 HGNC:6164 details
hsa-miR-8485 GADL1 glutamate decarboxylase like 1 HGNC:27949 details
hsa-miR-8485 KIFC1 kinesin family member C1 HGNC:6389 details
hsa-miR-8485 KIAA2026 KIAA2026 HGNC:23378 details
hsa-miR-8485 PLCE1 phospholipase C epsilon 1 HGNC:17175 details
hsa-miR-8485 IGF2R insulin like growth factor 2 receptor HGNC:5467 details
hsa-miR-8485 SEMA6D semaphorin 6D HGNC:16770 details
hsa-miR-8485 BGN biglycan HGNC:1044 details
hsa-miR-8485 WDR37 WD repeat domain 37 HGNC:31406 details
hsa-miR-8485 FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-8485 CHEK1 checkpoint kinase 1 HGNC:1925 details
hsa-miR-8485 NECAB1 N-terminal EF-hand calcium binding protein 1 HGNC:20983 details
hsa-miR-8485 TBX4 T-box transcription factor 4 HGNC:11603 details
hsa-miR-8485 RASSF4 Ras association domain family member 4 HGNC:20793 details
hsa-miR-8485 details
hsa-miR-8485 FNBP1 formin binding protein 1 HGNC:17069 details
hsa-miR-8485 CLEC14A C-type lectin domain containing 14A HGNC:19832 details
hsa-miR-8485 NFAM1 NFAT activating protein with ITAM motif 1 HGNC:29872 details
hsa-miR-8485 NSUN3 NOP2/Sun RNA methyltransferase 3 HGNC:26208 details
hsa-miR-8485 CAVIN4 caveolae associated protein 4 HGNC:33742 details
hsa-miR-8485 RAB3C RAB3C, member RAS oncogene family HGNC:30269 details
hsa-miR-8485 GPRC5A G protein-coupled receptor class C group 5 member A HGNC:9836 details
hsa-miR-8485 DNAL1 dynein axonemal light chain 1 HGNC:23247 details
hsa-miR-8485 SLC22A18AS solute carrier family 22 member 18 antisense HGNC:10965 details
hsa-miR-8485 CADPS calcium dependent secretion activator HGNC:1426 details
hsa-miR-8485 LY6G6E lymphocyte antigen 6 family member G6E HGNC:13934 details
hsa-miR-8485 FGF9 fibroblast growth factor 9 HGNC:3687 details
hsa-miR-8485 MATN1 matrilin 1 HGNC:6907 details
hsa-miR-8485 TIPRL TOR signaling pathway regulator HGNC:30231 details
hsa-miR-8485 ZNF670 zinc finger protein 670 HGNC:28167 details
hsa-miR-8485 HMGN5 high mobility group nucleosome binding domain 5 HGNC:8013 details
hsa-miR-8485 WDR3 WD repeat domain 3 HGNC:12755 details
hsa-miR-8485 ZBTB42 zinc finger and BTB domain containing 42 HGNC:32550 details
hsa-miR-8485 UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-8485 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 HGNC:16064 details
hsa-miR-8485 PPIC peptidylprolyl isomerase C HGNC:9256 details
hsa-miR-8485 DYNC1LI1 dynein cytoplasmic 1 light intermediate chain 1 HGNC:18745 details
hsa-miR-8485 EHD2 EH domain containing 2 HGNC:3243 details
hsa-miR-8485 BHLHE40 basic helix-loop-helix family member e40 HGNC:1046 details
hsa-miR-8485 NKTR natural killer cell triggering receptor HGNC:7833 details
hsa-miR-8485 STX1B syntaxin 1B HGNC:18539 details
hsa-miR-8485 ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-8485 MBOAT2 membrane bound O-acyltransferase domain containing 2 HGNC:25193 details
hsa-miR-8485 CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-8485 CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-8485 SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-8485 SYT1 synaptotagmin 1 HGNC:11509 details
hsa-miR-8485 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A HGNC:27989 details
hsa-miR-8485 PTGES prostaglandin E synthase HGNC:9599 details
hsa-miR-8485 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase HGNC:5006 details
hsa-miR-8485 BACH2 BTB domain and CNC homolog 2 HGNC:14078 details
hsa-miR-8485 SMIM15 small integral membrane protein 15 HGNC:33861 details
hsa-miR-8485 NUDT3 nudix hydrolase 3 HGNC:8050 details
hsa-miR-8485 ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-8485 ZNF610 zinc finger protein 610 HGNC:26687 details
hsa-miR-8485 PNMA8B PNMA family member 8B HGNC:29206 details
hsa-miR-8485 DPY19L3 dpy-19 like C-mannosyltransferase 3 HGNC:27120 details
hsa-miR-8485 GOSR2 golgi SNAP receptor complex member 2 HGNC:4431 details
hsa-miR-8485 PAPOLA poly(A) polymerase alpha HGNC:14981 details
hsa-miR-8485 RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-8485 LIN52 lin-52 DREAM MuvB core complex component HGNC:19856 details
hsa-miR-8485 ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-8485 FXYD6 FXYD domain containing ion transport regulator 6 HGNC:4030 details
hsa-miR-8485 TAS2R30 taste 2 receptor member 30 HGNC:19112 details
hsa-miR-8485 details
hsa-miR-8485 DAAM2 dishevelled associated activator of morphogenesis 2 HGNC:18143 details
hsa-miR-8485 ACOT2 acyl-CoA thioesterase 2 HGNC:18431 details
hsa-miR-8485 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-8485 MTX3 metaxin 3 HGNC:24812 details
hsa-miR-8485 USP27X ubiquitin specific peptidase 27 X-linked HGNC:13486 details
hsa-miR-8485 CCDC149 coiled-coil domain containing 149 HGNC:25405 details
hsa-miR-8485 ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-8485 DNAJC19 DnaJ heat shock protein family (Hsp40) member C19 HGNC:30528 details
hsa-miR-8485 GJD2 gap junction protein delta 2 HGNC:19154 details
hsa-miR-8485 TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-8485 PLEKHA8 pleckstrin homology domain containing A8 HGNC:30037 details
hsa-miR-8485 AMPD3 adenosine monophosphate deaminase 3 HGNC:470 details
hsa-miR-8485 CTDSPL CTD small phosphatase like HGNC:16890 details
hsa-miR-8485 CPSF6 cleavage and polyadenylation specific factor 6 HGNC:13871 details
hsa-miR-8485 MLXIPL MLX interacting protein like HGNC:12744 details
hsa-miR-8485 details
hsa-miR-8485 TSPAN14 tetraspanin 14 HGNC:23303 details
hsa-miR-8485 SLBP stem-loop binding protein HGNC:10904 details
hsa-miR-8485 PINX1 PIN2 (TERF1) interacting telomerase inhibitor 1 HGNC:30046 details
hsa-miR-8485 ZDHHC17 zinc finger DHHC-type palmitoyltransferase 17 HGNC:18412 details
hsa-miR-8485 PLEKHA2 pleckstrin homology domain containing A2 HGNC:14336 details
hsa-miR-8485 ZNF557 zinc finger protein 557 HGNC:28632 details
hsa-miR-8485 RAD54L2 RAD54 like 2 HGNC:29123 details
hsa-miR-8485 C21orf91 chromosome 21 open reading frame 91 HGNC:16459 details
hsa-miR-8485 MACC1 MET transcriptional regulator MACC1 HGNC:30215 details
hsa-miR-8485 SEL1L3 SEL1L family member 3 HGNC:29108 details
hsa-miR-8485 SPTLC3 serine palmitoyltransferase long chain base subunit 3 HGNC:16253 details
hsa-miR-8485 MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-8485 MYCBP MYC binding protein HGNC:7554 details
hsa-miR-8485 SLC23A3 solute carrier family 23 member 3 HGNC:20601 details
hsa-miR-8485 LILRB1 leukocyte immunoglobulin like receptor B1 HGNC:6605 details
hsa-miR-8485 MED24 mediator complex subunit 24 HGNC:22963 details
hsa-miR-8485 RNF121 ring finger protein 121 HGNC:21070 details
hsa-miR-8485 LONRF2 LON peptidase N-terminal domain and ring finger 2 HGNC:24788 details
hsa-miR-8485 CNOT6 CCR4-NOT transcription complex subunit 6 HGNC:14099 details
hsa-miR-8485 CRLF1 cytokine receptor like factor 1 HGNC:2364 details
hsa-miR-8485 CSNK1D casein kinase 1 delta HGNC:2452 details
hsa-miR-8485 KRTAP4-9 keratin associated protein 4-9 HGNC:18910 details
hsa-miR-8485 ARL4C ADP ribosylation factor like GTPase 4C HGNC:698 details
hsa-miR-8485 FOXI2 forkhead box I2 HGNC:32448 details
hsa-miR-8485 DOK6 docking protein 6 HGNC:28301 details
hsa-miR-8485 PRMT8 protein arginine methyltransferase 8 HGNC:5188 details
hsa-miR-8485 FBXL18 F-box and leucine rich repeat protein 18 HGNC:21874 details
hsa-miR-8485 SPATA13 spermatogenesis associated 13 HGNC:23222 details
hsa-miR-8485 details
hsa-miR-8485 CD99 CD99 molecule (Xg blood group) HGNC:7082 details
hsa-miR-8485 ZDHHC21 zinc finger DHHC-type palmitoyltransferase 21 HGNC:20750 details
hsa-miR-8485 HDAC9 histone deacetylase 9 HGNC:14065 details
hsa-miR-8485 PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-8485 ACOT9 acyl-CoA thioesterase 9 HGNC:17152 details
hsa-miR-8485 WT1 WT1 transcription factor HGNC:12796 details
hsa-miR-8485 details
hsa-miR-8485 PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-8485 CBY3 chibby family member 3 HGNC:33278 details
hsa-miR-8485 GRIPAP1 GRIP1 associated protein 1 HGNC:18706 details
hsa-miR-8485 details
hsa-miR-8485 TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-8485 details
hsa-miR-8485 AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-8485 CSMD2 CUB and Sushi multiple domains 2 HGNC:19290 details
hsa-miR-8485 SGPL1 sphingosine-1-phosphate lyase 1 HGNC:10817 details
hsa-miR-8485 FOXP4 forkhead box P4 HGNC:20842 details
hsa-miR-8485 MTF1 metal regulatory transcription factor 1 HGNC:7428 details
hsa-miR-8485 TAF8 TATA-box binding protein associated factor 8 HGNC:17300 details
hsa-miR-8485 SYNPO2L synaptopodin 2 like HGNC:23532 details
hsa-miR-8485 BMP5 bone morphogenetic protein 5 HGNC:1072 details
hsa-miR-8485 GPC4 glypican 4 HGNC:4452 details
hsa-miR-8485 PRRG3 proline rich and Gla domain 3 HGNC:30798 details
hsa-miR-8485 GSTM5 glutathione S-transferase mu 5 HGNC:4637 details
hsa-miR-8485 WNT2B Wnt family member 2B HGNC:12781 details
hsa-miR-8485 NBPF14 NBPF member 14 HGNC:25232 details
hsa-miR-8485 details
hsa-miR-8485 details
hsa-miR-8485 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-8485 SPTA1 spectrin alpha, erythrocytic 1 HGNC:11272 details
hsa-miR-8485 CADM3 cell adhesion molecule 3 HGNC:17601 details
hsa-miR-8485 details
hsa-miR-8485 ZNF548 zinc finger protein 548 HGNC:26561 details
hsa-miR-8485 GPX6 glutathione peroxidase 6 HGNC:4558 details
hsa-miR-8485 LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-8485 NUDT16 nudix hydrolase 16 HGNC:26442 details
hsa-miR-8485 KCNK5 potassium two pore domain channel subfamily K member 5 HGNC:6280 details
hsa-miR-8485 ARNT aryl hydrocarbon receptor nuclear translocator HGNC:700 details
hsa-miR-8485 COL9A1 collagen type IX alpha 1 chain HGNC:2217 details
hsa-miR-8485 ZNF585A zinc finger protein 585A HGNC:26305 details
hsa-miR-8485 SCN8A sodium voltage-gated channel alpha subunit 8 HGNC:10596 details
hsa-miR-8485 GNAI1 G protein subunit alpha i1 HGNC:4384 details
hsa-miR-8485 FCN2 ficolin 2 HGNC:3624 details
hsa-miR-8485 NF2 neurofibromin 2 HGNC:7773 details
hsa-miR-8485 CHST15 carbohydrate sulfotransferase 15 HGNC:18137 details
hsa-miR-8485 STAT5A signal transducer and activator of transcription 5A HGNC:11366 details
hsa-miR-8485 ADRB3 adrenoceptor beta 3 HGNC:288 details
hsa-miR-8485 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 HGNC:33829 details
hsa-miR-8485 CXCL12 C-X-C motif chemokine ligand 12 HGNC:10672 details
hsa-miR-8485 RDX radixin HGNC:9944 details
hsa-miR-8485 GNA14 G protein subunit alpha 14 HGNC:4382 details
hsa-miR-8485 FGFR3 fibroblast growth factor receptor 3 HGNC:3690 details
hsa-miR-8485 FASLG Fas ligand HGNC:11936 details
hsa-miR-8485 ZNF621 zinc finger protein 621 HGNC:24787 details
hsa-miR-8485 PHF8 PHD finger protein 8 HGNC:20672 details
hsa-miR-8485 STARD7 StAR related lipid transfer domain containing 7 HGNC:18063 details
hsa-miR-8485 BTLA B and T lymphocyte associated HGNC:21087 details
hsa-miR-8485 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 HGNC:17882 details
hsa-miR-8485 GPR173 G protein-coupled receptor 173 HGNC:18186 details
hsa-miR-8485 NPBWR1 neuropeptides B and W receptor 1 HGNC:4522 details
hsa-miR-8485 CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-8485 FAM174B family with sequence similarity 174 member B HGNC:34339 details
hsa-miR-8485 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 HGNC:16469 details
hsa-miR-8485 TMEM78 transmembrane protein 78 HGNC:32307 details
hsa-miR-8485 EHD3 EH domain containing 3 HGNC:3244 details
hsa-miR-8485 MOB3C MOB kinase activator 3C HGNC:29800 details
hsa-miR-8485 CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-8485 USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-8485 FZD2 frizzled class receptor 2 HGNC:4040 details
hsa-miR-8485 PNMA8A PNMA family member 8A HGNC:25578 details
hsa-miR-8485 PEAK1 pseudopodium enriched atypical kinase 1 HGNC:29431 details
hsa-miR-8485 ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-8485 C11orf45 chromosome 11 open reading frame 45 HGNC:28584 details
hsa-miR-8485 details
hsa-miR-8485 LRP8 LDL receptor related protein 8 HGNC:6700 details
hsa-miR-8485 HSPA4 heat shock protein family A (Hsp70) member 4 HGNC:5237 details
hsa-miR-8485 OR1L3 olfactory receptor family 1 subfamily L member 3 HGNC:8215 details
hsa-miR-8485 ADCYAP1R1 ADCYAP receptor type I HGNC:242 details
hsa-miR-8485 DDB1 damage specific DNA binding protein 1 HGNC:2717 details
hsa-miR-8485 ZNF428 zinc finger protein 428 HGNC:20804 details
hsa-miR-8485 NAT16 N-acetyltransferase 16 (putative) HGNC:22030 details
hsa-miR-8485 CLEC4D C-type lectin domain family 4 member D HGNC:14554 details
hsa-miR-8485 JAKMIP3 Janus kinase and microtubule interacting protein 3 HGNC:23523 details
hsa-miR-8485 AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-8485 SLFN13 schlafen family member 13 HGNC:26481 details
hsa-miR-8485 CACNA1B calcium voltage-gated channel subunit alpha1 B HGNC:1389 details
hsa-miR-8485 PLA2G7 phospholipase A2 group VII HGNC:9040 details
hsa-miR-8485 TBCK TBC1 domain containing kinase HGNC:28261 details
hsa-miR-8485 ABCG8 ATP binding cassette subfamily G member 8 HGNC:13887 details
hsa-miR-8485 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 HGNC:13628 details
hsa-miR-8485 MED16 mediator complex subunit 16 HGNC:17556 details
hsa-miR-8485 TCF12 transcription factor 12 HGNC:11623 details
hsa-miR-8485 ICAM1 intercellular adhesion molecule 1 HGNC:5344 details
hsa-miR-8485 NNT nicotinamide nucleotide transhydrogenase HGNC:7863 details
hsa-miR-8485 GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-8485 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 HGNC:17063 details
hsa-miR-8485 SLC5A7 solute carrier family 5 member 7 HGNC:14025 details
hsa-miR-8485 PKD1 polycystin 1, transient receptor potential channel interacting HGNC:9008 details
hsa-miR-8485 ZNF175 zinc finger protein 175 HGNC:12964 details
hsa-miR-8485 FOXF2 forkhead box F2 HGNC:3810 details
hsa-miR-8485 HEMGN hemogen HGNC:17509 details
hsa-miR-8485 NDRG4 NDRG family member 4 HGNC:14466 details
hsa-miR-8485 CEP135 centrosomal protein 135 HGNC:29086 details
hsa-miR-8485 ZNF764 zinc finger protein 764 HGNC:28200 details
hsa-miR-8485 CLN6 CLN6 transmembrane ER protein HGNC:2077 details
hsa-miR-8485 TCF15 transcription factor 15 HGNC:11627 details
hsa-miR-8485 TWIST1 twist family bHLH transcription factor 1 HGNC:12428 details
hsa-miR-8485 CCDC77 coiled-coil domain containing 77 HGNC:28203 details
hsa-miR-8485 UMPS uridine monophosphate synthetase HGNC:12563 details
hsa-miR-8485 details
hsa-miR-8485 ABCC6 ATP binding cassette subfamily C member 6 HGNC:57 details
hsa-miR-8485 PDZD4 PDZ domain containing 4 HGNC:21167 details
hsa-miR-8485 ZNF226 zinc finger protein 226 HGNC:13019 details
hsa-miR-8485 ZFX zinc finger protein X-linked HGNC:12869 details
hsa-miR-8485 ZFP14 ZFP14 zinc finger protein HGNC:29312 details
hsa-miR-8485 UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-8485 TNRC6C trinucleotide repeat containing adaptor 6C HGNC:29318 details
hsa-miR-8485 TNPO1 transportin 1 HGNC:6401 details
hsa-miR-8485 TMOD2 tropomodulin 2 HGNC:11872 details
hsa-miR-8485 TCTE1 t-complex-associated-testis-expressed 1 HGNC:11693 details
hsa-miR-8485 STX7 syntaxin 7 HGNC:11442 details
hsa-miR-8485 SPAG7 sperm associated antigen 7 HGNC:11216 details
hsa-miR-8485 SOX9 SRY-box transcription factor 9 HGNC:11204 details
hsa-miR-8485 SMAD2 SMAD family member 2 HGNC:6768 details
hsa-miR-8485 SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-8485 SAMD4A sterile alpha motif domain containing 4A HGNC:23023 details
hsa-miR-8485 RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-8485 RUNX1 RUNX family transcription factor 1 HGNC:10471 details
hsa-miR-8485 RPAP2 RNA polymerase II associated protein 2 HGNC:25791 details
hsa-miR-8485 RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-8485 RABL3 RAB, member of RAS oncogene family like 3 HGNC:18072 details
hsa-miR-8485 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A HGNC:9275 details
hsa-miR-8485 PPARGC1B PPARG coactivator 1 beta HGNC:30022 details
hsa-miR-8485 PLXNA4 plexin A4 HGNC:9102 details
hsa-miR-8485 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-8485 NRG2 neuregulin 2 HGNC:7998 details
hsa-miR-8485 NR2F2 nuclear receptor subfamily 2 group F member 2 HGNC:7976 details
hsa-miR-8485 TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-8485 NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-8485 MLXIP MLX interacting protein HGNC:17055 details
hsa-miR-8485 MAPKAPK2 MAPK activated protein kinase 2 HGNC:6887 details
hsa-miR-8485 MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-8485 LSM14A LSM14A mRNA processing body assembly factor HGNC:24489 details
hsa-miR-8485 LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-8485 LMX1A LIM homeobox transcription factor 1 alpha HGNC:6653 details
hsa-miR-8485 KLHL3 kelch like family member 3 HGNC:6354 details
hsa-miR-8485 JAZF1 JAZF zinc finger 1 HGNC:28917 details
hsa-miR-8485 ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-8485 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 HGNC:28866 details
hsa-miR-8485 IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-8485 HLF HLF transcription factor, PAR bZIP family member HGNC:4977 details
hsa-miR-8485 HIF1AN hypoxia inducible factor 1 subunit alpha inhibitor HGNC:17113 details
hsa-miR-8485 GTDC1 glycosyltransferase like domain containing 1 HGNC:20887 details
hsa-miR-8485 GPRIN3 GPRIN family member 3 HGNC:27733 details
hsa-miR-8485 GCK glucokinase HGNC:4195 details
hsa-miR-8485 GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-8485 GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-8485 GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-8485 FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-8485 FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-8485 TOGARAM2 TOG array regulator of axonemal microtubules 2 HGNC:33715 details
hsa-miR-8485 SRCAP Snf2 related CREBBP activator protein HGNC:16974 details
hsa-miR-8485 DUSP6 dual specificity phosphatase 6 HGNC:3072 details
hsa-miR-8485 DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-8485 DENND2C DENN domain containing 2C HGNC:24748 details
hsa-miR-8485 CRY2 cryptochrome circadian regulator 2 HGNC:2385 details
hsa-miR-8485 CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-8485 CREB5 cAMP responsive element binding protein 5 HGNC:16844 details
hsa-miR-8485 KALRN kalirin RhoGEF kinase HGNC:4814 details
hsa-miR-8485 CACFD1 calcium channel flower domain containing 1 HGNC:1365 details
hsa-miR-8485 C2orf72 chromosome 2 open reading frame 72 HGNC:27418 details
hsa-miR-8485 BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-8485 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 HGNC:24048 details
hsa-miR-8485 ARL5C ADP ribosylation factor like GTPase 5C HGNC:31111 details
hsa-miR-8485 ANTXR2 ANTXR cell adhesion molecule 2 HGNC:21732 details
hsa-miR-8485 ALX1 ALX homeobox 1 HGNC:1494 details
hsa-miR-8485 AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-8485 GRK3 G protein-coupled receptor kinase 3 HGNC:290 details
hsa-miR-8485 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-8485 ACVR1B activin A receptor type 1B HGNC:172 details
hsa-miR-8485 AAK1 AP2 associated kinase 1 HGNC:19679 details
hsa-miR-8485 LYRM7 LYR motif containing 7 HGNC:28072 details
hsa-miR-8485 VAPB VAMP associated protein B and C HGNC:12649 details
hsa-miR-8485 MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-8485 CEP72 centrosomal protein 72 HGNC:25547 details
hsa-miR-8485 PTCH1 patched 1 HGNC:9585 details
hsa-miR-8485 PPP1R1C protein phosphatase 1 regulatory inhibitor subunit 1C HGNC:14940 details
hsa-miR-8485 HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-8485 DUSP18 dual specificity phosphatase 18 HGNC:18484 details
hsa-miR-8485 IKBKG inhibitor of nuclear factor kappa B kinase regulatory subunit gamma HGNC:5961 details
hsa-miR-8485 MTPN myotrophin HGNC:15667 details
hsa-miR-8485 LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-8485 COBLL1 cordon-bleu WH2 repeat protein like 1 HGNC:23571 details
hsa-miR-8485 details
hsa-miR-8485 CRB2 crumbs cell polarity complex component 2 HGNC:18688 details
hsa-miR-8485 MDN1 midasin AAA ATPase 1 HGNC:18302 details
hsa-miR-8485 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 HGNC:7708 details
hsa-miR-8485 IBA57 iron-sulfur cluster assembly factor IBA57 HGNC:27302 details
hsa-miR-8485 TCF20 transcription factor 20 HGNC:11631 details
hsa-miR-8485 QSOX2 quiescin sulfhydryl oxidase 2 HGNC:30249 details
hsa-miR-8485 TUBD1 tubulin delta 1 HGNC:16811 details
hsa-miR-8485 GALNT17 polypeptide N-acetylgalactosaminyltransferase 17 HGNC:16347 details
hsa-miR-8485 NPAP1 nuclear pore associated protein 1 HGNC:1190 details
hsa-miR-8485 ING5 inhibitor of growth family member 5 HGNC:19421 details
hsa-miR-8485 FGFBP3 fibroblast growth factor binding protein 3 HGNC:23428 details
hsa-miR-8485 TNS3 tensin 3 HGNC:21616 details
hsa-miR-8485 details
hsa-miR-8485 PTPN9 protein tyrosine phosphatase non-receptor type 9 HGNC:9661 details
hsa-miR-8485 STK36 serine/threonine kinase 36 HGNC:17209 details
hsa-miR-8485 ANK3 ankyrin 3 HGNC:494 details
hsa-miR-8485 MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-8485 C1orf216 chromosome 1 open reading frame 216 HGNC:26800 details
hsa-miR-8485 RHBDL3 rhomboid like 3 HGNC:16502 details
hsa-miR-8485 METTL16 methyltransferase 16, N6-methyladenosine HGNC:28484 details
hsa-miR-8485 SLCO1B3 solute carrier organic anion transporter family member 1B3 HGNC:10961 details
hsa-miR-8485 TOR1B torsin family 1 member B HGNC:11995 details
hsa-miR-8485 ELOF1 elongation factor 1 HGNC:28691 details
hsa-miR-8485 SLC1A4 solute carrier family 1 member 4 HGNC:10942 details
hsa-miR-8485 SPINT3 serine peptidase inhibitor, Kunitz type 3 HGNC:11248 details
hsa-miR-8485 CYP24A1 cytochrome P450 family 24 subfamily A member 1 HGNC:2602 details
hsa-miR-8485 SLC22A4 solute carrier family 22 member 4 HGNC:10968 details
hsa-miR-8485 STYK1 serine/threonine/tyrosine kinase 1 HGNC:18889 details
hsa-miR-8485 TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-8485 SOCS7 suppressor of cytokine signaling 7 HGNC:29846 details
hsa-miR-8485 SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-8485 SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-8485 SLC41A2 solute carrier family 41 member 2 HGNC:31045 details
hsa-miR-8485 SEMA4C semaphorin 4C HGNC:10731 details
hsa-miR-8485 RAPGEF1 Rap guanine nucleotide exchange factor 1 HGNC:4568 details
hsa-miR-8485 PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-8485 PARD3B par-3 family cell polarity regulator beta HGNC:14446 details
hsa-miR-8485 NAV1 neuron navigator 1 HGNC:15989 details
hsa-miR-8485 KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-8485 GRIK3 glutamate ionotropic receptor kainate type subunit 3 HGNC:4581 details
hsa-miR-8485 DGKG diacylglycerol kinase gamma HGNC:2853 details
hsa-miR-8485 DCAF12 DDB1 and CUL4 associated factor 12 HGNC:19911 details
hsa-miR-8485 B4GALT5 beta-1,4-galactosyltransferase 5 HGNC:928 details
hsa-miR-8485 ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-8485 ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-8485 B3GALT5 beta-1,3-galactosyltransferase 5 HGNC:920 details
hsa-miR-8485 MPP2 membrane palmitoylated protein 2 HGNC:7220 details
hsa-miR-8485 GOLGA7B golgin A7 family member B HGNC:31668 details
hsa-miR-8485 F11R F11 receptor HGNC:14685 details
hsa-miR-8485 TNFSF4 TNF superfamily member 4 HGNC:11934 details
hsa-miR-8485 MYO16 myosin XVI HGNC:29822 details
hsa-miR-8485 ASCC1 activating signal cointegrator 1 complex subunit 1 HGNC:24268 details
hsa-miR-8485 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 HGNC:29090 details
hsa-miR-8485 ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-8485 AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-8485 MEF2D myocyte enhancer factor 2D HGNC:6997 details
hsa-miR-8485 LONRF1 LON peptidase N-terminal domain and ring finger 1 HGNC:26302 details
hsa-miR-8485 ZNF280B zinc finger protein 280B HGNC:23022 details
hsa-miR-8485 LARP4B La ribonucleoprotein 4B HGNC:28987 details
hsa-miR-8485 KYNU kynureninase HGNC:6469 details
hsa-miR-8485 DSG2 desmoglein 2 HGNC:3049 details
hsa-miR-8485 SYTL4 synaptotagmin like 4 HGNC:15588 details
hsa-miR-8485 ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-8485 details
hsa-miR-8485 TRAPPC6A trafficking protein particle complex subunit 6A HGNC:23069 details
hsa-miR-8485 AKAIN1 A-kinase anchor inhibitor 1 HGNC:28285 details
hsa-miR-8485 GREM1 gremlin 1, DAN family BMP antagonist HGNC:2001 details
hsa-miR-8485 SPATS2 spermatogenesis associated serine rich 2 HGNC:18650 details
hsa-miR-8485 MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-8485 details
hsa-miR-8485 TANK TRAF family member associated NFKB activator HGNC:11562 details
hsa-miR-8485 CLCN7 chloride voltage-gated channel 7 HGNC:2025 details
hsa-miR-8485 details
hsa-miR-8485 GABARAPL3 GABA type A receptor associated protein like 3 pseudogene HGNC:4069 details
hsa-miR-8485 ARPC4 actin related protein 2/3 complex subunit 4 HGNC:707 details
hsa-miR-8485 IL21R interleukin 21 receptor HGNC:6006 details
hsa-miR-8485 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-8485 SIGLEC15 sialic acid binding Ig like lectin 15 HGNC:27596 details
hsa-miR-8485 CCDC174 coiled-coil domain containing 174 HGNC:28033 details
hsa-miR-8485 STAG1 stromal antigen 1 HGNC:11354 details
hsa-miR-8485 GPR78 G protein-coupled receptor 78 HGNC:4528 details
hsa-miR-8485 KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-8485 HS6ST3 heparan sulfate 6-O-sulfotransferase 3 HGNC:19134 details
hsa-miR-8485 JPH2 junctophilin 2 HGNC:14202 details
hsa-miR-8485 KIRREL1 kirre like nephrin family adhesion molecule 1 HGNC:15734 details
hsa-miR-8485 NOS1AP nitric oxide synthase 1 adaptor protein HGNC:16859 details
hsa-miR-8485 RASSF9 Ras association domain family member 9 HGNC:15739 details
hsa-miR-8485 C6 complement C6 HGNC:1339 details
hsa-miR-8485 HLCS holocarboxylase synthetase HGNC:4976 details
hsa-miR-8485 C10orf67 chromosome 10 open reading frame 67 HGNC:28716 details
hsa-miR-8485 PACS1 phosphofurin acidic cluster sorting protein 1 HGNC:30032 details
hsa-miR-8485 MYO1H myosin IH HGNC:13879 details
hsa-miR-8485 MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-8485 CLSTN3 calsyntenin 3 HGNC:18371 details
hsa-miR-8485 FLVCR2 FLVCR heme transporter 2 HGNC:20105 details
hsa-miR-8485 ZBTB7C zinc finger and BTB domain containing 7C HGNC:31700 details
hsa-miR-8485 WTIP WT1 interacting protein HGNC:20964 details
hsa-miR-8485 USH1G USH1 protein network component sans HGNC:16356 details
hsa-miR-8485 TCF7L2 transcription factor 7 like 2 HGNC:11641 details
hsa-miR-8485 SS18 SS18 subunit of BAF chromatin remodeling complex HGNC:11340 details
hsa-miR-8485 SRRM4 serine/arginine repetitive matrix 4 HGNC:29389 details
hsa-miR-8485 SPOPL speckle type BTB/POZ protein like HGNC:27934 details
hsa-miR-8485 SPOCK2 SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2 HGNC:13564 details
hsa-miR-8485 SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-8485 SLC36A1 solute carrier family 36 member 1 HGNC:18761 details
hsa-miR-8485 RNF213 ring finger protein 213 HGNC:14539 details
hsa-miR-8485 PLXNC1 plexin C1 HGNC:9106 details
hsa-miR-8485 PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-8485 PAX3 paired box 3 HGNC:8617 details
hsa-miR-8485 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 HGNC:30043 details
hsa-miR-8485 NFATC2 nuclear factor of activated T cells 2 HGNC:7776 details
hsa-miR-8485 NEURL1B neuralized E3 ubiquitin protein ligase 1B HGNC:35422 details
hsa-miR-8485 MYORG myogenesis regulating glycosidase (putative) HGNC:19918 details
hsa-miR-8485 JAK2 Janus kinase 2 HGNC:6192 details
hsa-miR-8485 ITPKB inositol-trisphosphate 3-kinase B HGNC:6179 details
hsa-miR-8485 GRID1 glutamate ionotropic receptor delta type subunit 1 HGNC:4575 details
hsa-miR-8485 FBXO45 F-box protein 45 HGNC:29148 details
hsa-miR-8485 CTTNBP2NL CTTNBP2 N-terminal like HGNC:25330 details
hsa-miR-8485 COL12A1 collagen type XII alpha 1 chain HGNC:2188 details
hsa-miR-8485 CBX8 chromobox 8 HGNC:15962 details
hsa-miR-8485 BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-8485 ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-8485 ARMC10 armadillo repeat containing 10 HGNC:21706 details
hsa-miR-8485 AP5M1 adaptor related protein complex 5 subunit mu 1 HGNC:20192 details
hsa-miR-8485 ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-8485 CCDC91 coiled-coil domain containing 91 HGNC:24855 details
hsa-miR-8485 MTO1 mitochondrial tRNA translation optimization 1 HGNC:19261 details
hsa-miR-8485 CPA4 carboxypeptidase A4 HGNC:15740 details
hsa-miR-8485 SHROOM1 shroom family member 1 HGNC:24084 details
hsa-miR-8485 PADI2 peptidyl arginine deiminase 2 HGNC:18341 details
hsa-miR-8485 TMEM35A transmembrane protein 35A HGNC:25864 details
hsa-miR-8485 LAMP2 lysosomal associated membrane protein 2 HGNC:6501 details
hsa-miR-8485 PKP1 plakophilin 1 HGNC:9023 details
hsa-miR-8485 ATP1A3 ATPase Na+/K+ transporting subunit alpha 3 HGNC:801 details
hsa-miR-8485 TXNL4B thioredoxin like 4B HGNC:26041 details
hsa-miR-8485 IL18RAP interleukin 18 receptor accessory protein HGNC:5989 details
hsa-miR-8485 CEP162 centrosomal protein 162 HGNC:21107 details
hsa-miR-8485 GRN granulin precursor HGNC:4601 details
hsa-miR-8485 GLYR1 glyoxylate reductase 1 homolog HGNC:24434 details
hsa-miR-8485 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion HGNC:15781 details
hsa-miR-8485 BSN bassoon presynaptic cytomatrix protein HGNC:1117 details
hsa-miR-8485 ETFDH electron transfer flavoprotein dehydrogenase HGNC:3483 details
hsa-miR-8485 SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-8485 GPR21 G protein-coupled receptor 21 HGNC:4476 details
hsa-miR-8485 MVB12B multivesicular body subunit 12B HGNC:23368 details
hsa-miR-8485 IQSEC3 IQ motif and Sec7 domain ArfGEF 3 HGNC:29193 details
hsa-miR-8485 SLC5A8 solute carrier family 5 member 8 HGNC:19119 details
hsa-miR-8485 CRLS1 cardiolipin synthase 1 HGNC:16148 details
hsa-miR-8485 GSN gelsolin HGNC:4620 details
hsa-miR-8485 CISD2 CDGSH iron sulfur domain 2 HGNC:24212 details
hsa-miR-8485 GTPBP8 GTP binding protein 8 (putative) HGNC:25007 details
hsa-miR-8485 details
hsa-miR-8485 TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-8485 details
hsa-miR-8485 ELK1 ETS transcription factor ELK1 HGNC:3321 details
hsa-miR-8485 HUNK hormonally up-regulated Neu-associated kinase HGNC:13326 details
hsa-miR-8485 GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-8485 ZNF730 zinc finger protein 730 HGNC:32470 details
hsa-miR-8485 CBX3 chromobox 3 HGNC:1553 details
hsa-miR-8485 FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-8485 VPS13D vacuolar protein sorting 13 homolog D HGNC:23595 details
hsa-miR-8485 FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-8485 ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-8485 RAET1E retinoic acid early transcript 1E HGNC:16793 details
hsa-miR-8485 RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-8485 BMP10 bone morphogenetic protein 10 HGNC:20869 details
hsa-miR-8485 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone HGNC:16987 details
hsa-miR-8485 BHLHB9 basic helix-loop-helix family member b9 HGNC:29353 details
hsa-miR-8485 EML4 EMAP like 4 HGNC:1316 details
hsa-miR-8485 SLCO5A1 solute carrier organic anion transporter family member 5A1 HGNC:19046 details
hsa-miR-8485 NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-8485 EMC10 ER membrane protein complex subunit 10 HGNC:27609 details
hsa-miR-8485 FAM169B family with sequence similarity 169 member B HGNC:26835 details
hsa-miR-8485 TBC1D2B TBC1 domain family member 2B HGNC:29183 details
hsa-miR-8485 MIOX myo-inositol oxygenase HGNC:14522 details
hsa-miR-8485 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 HGNC:13854 details
hsa-miR-8485 STOML1 stomatin like 1 HGNC:14560 details
hsa-miR-8485 SMNDC1 survival motor neuron domain containing 1 HGNC:16900 details
hsa-miR-8485 NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-8485 GDPGP1 GDP-D-glucose phosphorylase 1 HGNC:34360 details
hsa-miR-8485 ZFP1 ZFP1 zinc finger protein HGNC:23328 details
hsa-miR-8485 PRSS21 serine protease 21 HGNC:9485 details
hsa-miR-8485 WWC2 WW and C2 domain containing 2 HGNC:24148 details
hsa-miR-8485 BEX4 brain expressed X-linked 4 HGNC:25475 details
hsa-miR-8485 GOT1 glutamic-oxaloacetic transaminase 1 HGNC:4432 details
hsa-miR-8485 DNAH8 dynein axonemal heavy chain 8 HGNC:2952 details
hsa-miR-8485 details
hsa-miR-8485 SPNS2 sphingolipid transporter 2 HGNC:26992 details
hsa-miR-8485 PARL presenilin associated rhomboid like HGNC:18253 details
hsa-miR-8485 PLIN1 perilipin 1 HGNC:9076 details
hsa-miR-8485 ITPKC inositol-trisphosphate 3-kinase C HGNC:14897 details
hsa-miR-8485 FHOD1 formin homology 2 domain containing 1 HGNC:17905 details
hsa-miR-8485 CLNK cytokine dependent hematopoietic cell linker HGNC:17438 details
hsa-miR-8485 SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-8485 MAP3K21 mitogen-activated protein kinase kinase kinase 21 HGNC:29798 details
hsa-miR-8485 KCNA4 potassium voltage-gated channel subfamily A member 4 HGNC:6222 details
hsa-miR-8485 FAM107B family with sequence similarity 107 member B HGNC:23726 details
hsa-miR-8485 DTNA dystrobrevin alpha HGNC:3057 details
hsa-miR-8485 DENND5B DENN domain containing 5B HGNC:28338 details
hsa-miR-8485 CDH2 cadherin 2 HGNC:1759 details
hsa-miR-8485 BRD4 bromodomain containing 4 HGNC:13575 details
hsa-miR-8485 RPL18A ribosomal protein L18a HGNC:10311 details
hsa-miR-8485 PSD4 pleckstrin and Sec7 domain containing 4 HGNC:19096 details
hsa-miR-8485 IFNAR2 interferon alpha and beta receptor subunit 2 HGNC:5433 details
hsa-miR-8485 IGSF9 immunoglobulin superfamily member 9 HGNC:18132 details
hsa-miR-8485 ASTN2 astrotactin 2 HGNC:17021 details
hsa-miR-8485 TBC1D22A TBC1 domain family member 22A HGNC:1309 details
hsa-miR-8485 WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-8485 VAPA VAMP associated protein A HGNC:12648 details
hsa-miR-8485 TAL1 TAL bHLH transcription factor 1, erythroid differentiation factor HGNC:11556 details
hsa-miR-8485 RIMS3 regulating synaptic membrane exocytosis 3 HGNC:21292 details
hsa-miR-8485 PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-8485 PCNX1 pecanex 1 HGNC:19740 details
hsa-miR-8485 CPE carboxypeptidase E HGNC:2303 details
hsa-miR-8485 NPTX1 neuronal pentraxin 1 HGNC:7952 details
hsa-miR-8485 TMC7 transmembrane channel like 7 HGNC:23000 details
hsa-miR-8485 C1orf116 chromosome 1 open reading frame 116 HGNC:28667 details
hsa-miR-8485 LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-8485 CDH7 cadherin 7 HGNC:1766 details
hsa-miR-8485 PCDH7 protocadherin 7 HGNC:8659 details
hsa-miR-8485 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 HGNC:19267 details
hsa-miR-8485 F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-8485 NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-8485 details
hsa-miR-8485 ALDH1A3 aldehyde dehydrogenase 1 family member A3 HGNC:409 details
hsa-miR-8485 LYPD3 LY6/PLAUR domain containing 3 HGNC:24880 details
hsa-miR-8485 CPNE8 copine 8 HGNC:23498 details
hsa-miR-8485 BAZ2A bromodomain adjacent to zinc finger domain 2A HGNC:962 details
hsa-miR-8485 STAM signal transducing adaptor molecule HGNC:11357 details
hsa-miR-8485 SIK3 SIK family kinase 3 HGNC:29165 details
hsa-miR-8485 CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-8485 WDTC1 WD and tetratricopeptide repeats 1 HGNC:29175 details
hsa-miR-8485 CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-8485 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-8485 details
hsa-miR-8485 FAM47E-STBD1 FAM47E-STBD1 readthrough HGNC:44667 details
hsa-miR-8485 ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-8485 ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-8485 STYX serine/threonine/tyrosine interacting protein HGNC:11447 details
hsa-miR-8485 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 HGNC:19751 details
hsa-miR-8485 SNRK SNF related kinase HGNC:30598 details
hsa-miR-8485 PAPPA pappalysin 1 HGNC:8602 details
hsa-miR-8485 NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-8485 GREB1L GREB1 like retinoic acid receptor coactivator HGNC:31042 details
hsa-miR-8485 details
hsa-miR-8485 C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-8485 B4GALT6 beta-1,4-galactosyltransferase 6 HGNC:929 details
hsa-miR-8485 TRERF1 transcriptional regulating factor 1 HGNC:18273 details
hsa-miR-8485 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 HGNC:17877 details
hsa-miR-8485 FRMPD3 FERM and PDZ domain containing 3 HGNC:29382 details
hsa-miR-8485 SPCS2 signal peptidase complex subunit 2 HGNC:28962 details
hsa-miR-8485 PET117 PET117 cytochrome c oxidase chaperone HGNC:40045 details
hsa-miR-8485 TMED9 transmembrane p24 trafficking protein 9 HGNC:24878 details
hsa-miR-8485 SORBS3 sorbin and SH3 domain containing 3 HGNC:30907 details
hsa-miR-8485 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A HGNC:4585 details
hsa-miR-8485 RIOX2 ribosomal oxygenase 2 HGNC:19441 details
hsa-miR-8485 TRAPPC6B trafficking protein particle complex subunit 6B HGNC:23066 details
hsa-miR-8485 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-8485 RASSF2 Ras association domain family member 2 HGNC:9883 details
hsa-miR-8485 RBM41 RNA binding motif protein 41 HGNC:25617 details
hsa-miR-8485 MPEG1 macrophage expressed 1 HGNC:29619 details
hsa-miR-8485 OVOL1 ovo like transcriptional repressor 1 HGNC:8525 details
hsa-miR-8485 NUP205 nucleoporin 205 HGNC:18658 details
hsa-miR-8485 GDF11 growth differentiation factor 11 HGNC:4216 details
hsa-miR-8485 SYNRG synergin gamma HGNC:557 details
hsa-miR-8485 PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-8485 CBX6 chromobox 6 HGNC:1556 details
hsa-miR-8485 CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-8485 DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-8485 G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-8485 GDI1 GDP dissociation inhibitor 1 HGNC:4226 details
hsa-miR-8485 MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-8485 SBF1 SET binding factor 1 HGNC:10542 details
hsa-miR-8485 SF1 splicing factor 1 HGNC:12950 details
hsa-miR-8485 details
hsa-miR-8485 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase HGNC:77 details
hsa-miR-8485 EIF4H eukaryotic translation initiation factor 4H HGNC:12741 details
hsa-miR-8485 TMEM184B transmembrane protein 184B HGNC:1310 details
hsa-miR-8485 TRMT112 tRNA methyltransferase activator subunit 11-2 HGNC:26940 details
hsa-miR-8485 EAF1 ELL associated factor 1 HGNC:20907 details
hsa-miR-8485 FOXL2NB FOXL2 neighbor HGNC:34428 details
hsa-miR-8485 LHFPL4 LHFPL tetraspan subfamily member 4 HGNC:29568 details
hsa-miR-8485 NOS1 nitric oxide synthase 1 HGNC:7872 details
hsa-miR-8485 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 HGNC:8988 details
hsa-miR-8485 SFN stratifin HGNC:10773 details
hsa-miR-8485 TAT tyrosine aminotransferase HGNC:11573 details