miRNA Card

miRNA General Information
miRNA ID hsa-miR-92a-3p
Description Homo sapiens miR-92a-1 stem-loop
Comment Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MIR:MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7].
Experiment cloned [1,3,5-8], Northern [4]
Sequence UAUUGCACUUGUCCCGGCCUGU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:2307653|2307785 hsa-miR-92a-3p 1 1 0
chr14:21019132|21019742 hsa-miR-92a-3p 1 1 0
chr14:21019132|21019736 hsa-miR-92a-3p 1 1 0
chr2:113203543|113203646 hsa-miR-92a-3p 1 1 0
chr14:77508062|77508289 hsa-miR-92a-3p 1 1 0
chr14:21019138|21019706 hsa-miR-92a-3p 1 1 0
chr15:93045115|93045305 hsa-miR-92a-3p 1 1 0
chr14:21019132|21019738 hsa-miR-92a-3p 1 1 0
chrX:10134031|10134183 hsa-miR-92a-3p 1 1 0
chr2:69994616|69994737 hsa-miR-92a-3p 1 1 0
chr16:2767010|2767118 hsa-miR-92a-3p 1 1 0
chr14:105249851|105250006 hsa-miR-92a-3p 1 1 0
chr1:58576788|58577063 hsa-miR-92a-3p 1 1 0
chr1:245827345|245827453 hsa-miR-92a-3p 1 1 0
chr14:56347958|56348164 hsa-miR-92a-3p 1 1 0
chr2:223829607|223829772 hsa-miR-92a-3p 1 1 0
chr19:37328169|37328262 hsa-miR-92a-3p 1 1 0
chr1:12201498|12201624 hsa-miR-92a-3p 1 1 0
chr14:56347964|56348164 hsa-miR-92a-3p 1 1 0
chr2:28412824|28413114 hsa-miR-92a-3p 1 1 0
chr14:105249855|105250006 hsa-miR-92a-3p 1 1 0
chr18:45849020|45849144 hsa-miR-92a-3p 1 1 0
chr6:70861669|70861829 hsa-miR-92a-3p 1 1 0
chr2:85662036|85663427 hsa-miR-92a-3p 1 1 0
chr16:29912408|29912515 hsa-miR-92a-3p 1 1 0
chr19:16519109|16519266 hsa-miR-92a-3p 1 1 0
chr2:85661479|85663481 hsa-miR-92a-3p 1 1 0
chr16:23573670|23573853 hsa-miR-92a-3p 1 1 0
chr14:21019138|21019738 hsa-miR-92a-3p 1 1 0
chr22:38215068|38215378 hsa-miR-92a-3p 1 1 0
chr16:2767010|2767183 hsa-miR-92a-3p 1 1 0
chr5:146237304|146237390 hsa-miR-92a-3p 1 1 0
chr16:23573670|23573842 hsa-miR-92a-3p 1 1 0
chrX:71110615|71110990 hsa-miR-92a-3p 1 1 0
chr16:23573678|23573865 hsa-miR-92a-3p 1 1 0
chr2:28412853|28413040 hsa-miR-92a-3p 1 1 0
chr14:81472929|81473088 hsa-miR-92a-3p 1 1 0
chrX:2220980|2221091 hsa-miR-92a-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:152645180|152645322 hsa-miR-92a-3p 1 0 0
chr17:39658739|39659106 hsa-miR-92a-3p 1 0 0
chr1:150629414|150629557 hsa-miR-92a-3p 1 0 0
chr11:57741695|57741926 hsa-miR-92a-3p 1 0 0
chr12:132726707|132726847 hsa-miR-92a-3p 1 0 0
chr15:39589823|39589960 hsa-miR-92a-3p 1 0 0
chr12:120563530|120563913 hsa-miR-92a-3p 1 0 0
chr8:144522937|144523141 hsa-miR-92a-3p 1 0 0
chr20:46062168|46062314 hsa-miR-92a-3p 1 0 0
chr15:51939121|51939246 hsa-miR-92a-3p 1 0 0
chr5:168556068|168556443 hsa-miR-92a-3p 1 0 0
chr12:54257537|54257636 hsa-miR-92a-3p 1 0 0
chr1:22639105|22639303 hsa-miR-92a-3p 1 0 0
chr15:64155929|64156055 hsa-miR-92a-3p 1 0 0
chr2:183607586|183607746 hsa-miR-92a-3p 1 0 0
chr11:57741695|57741890 hsa-miR-92a-3p 1 0 0
chr12:57177205|57177555 hsa-miR-92a-3p 1 0 0
chr12:96286122|96286761 hsa-miR-92a-3p 1 0 0
chr2:215394528|215394719 hsa-miR-92a-3p 1 0 0
chr6:152099747|152099890 hsa-miR-92a-3p 1 0 0
chr1:27154589|27154695 hsa-miR-92a-3p 1 0 0
chr9:126667906|126668086 hsa-miR-92a-3p 1 0 0
chr17:17818408|17818520 hsa-miR-92a-3p 1 0 0
chrX:48560532|48560666 hsa-miR-92a-3p 1 0 0
chr7:74122311|74122432 hsa-miR-92a-3p 1 0 0
chr22:20499351|20499537 hsa-miR-92a-3p 0 1 0
chr19:3630532|3630732 hsa-miR-92a-3p 0 1 0
chr9:97680114|97680290 hsa-miR-92a-3p 0 1 0
chr9:128257641|128257845 hsa-miR-92a-3p 0 1 0
chr15:99728899|99729018 hsa-miR-92a-3p 0 1 0
chr2:98520014|98520141 hsa-miR-92a-3p 0 1 0
chrX:47209103|47209267 hsa-miR-92a-3p 0 1 0
chr12:108590592|108590766 hsa-miR-92a-3p 0 1 0
chr1:150647440|150647614 hsa-miR-92a-3p 0 1 0
chr5:138468844|138468955 hsa-miR-92a-3p 0 1 0
chr9:128257641|128257862 hsa-miR-92a-3p 0 1 0
chr15:40420012|40420172 hsa-miR-92a-3p 0 1 0
chr17:68421630|68421785 hsa-miR-92a-3p 0 1 0
chr4:6617801|6617929 hsa-miR-92a-3p 0 1 0
chr2:27239170|27239450 hsa-miR-92a-3p 0 1 0
chr8:140506588|140506747 hsa-miR-92a-3p 0 1 0
chr15:40419040|40419246 hsa-miR-92a-3p 0 1 0
chr2:64633698|64633835 hsa-miR-92a-3p 0 1 0
chr12:106821683|106821740 hsa-miR-92a-3p 0 1 0
chrX:47209138|47209267 hsa-miR-92a-3p 0 1 0
chr2:216672822|216672972 hsa-miR-92a-3p 0 1 0
chr12:7094790|7094917 hsa-miR-92a-3p 0 1 0
chr1:26781473|26781696 hsa-miR-92a-3p 0 1 0
chr12:7070146|7070316 hsa-miR-92a-3p 0 1 0
chrX:30630370|30630684 hsa-miR-92a-3p 0 1 0
chr1:228494293|228494460 hsa-miR-92a-3p 0 1 0
chr3:33142631|33142774 hsa-miR-92a-3p 0 1 0
chr12:108590618|108590717 hsa-miR-92a-3p 0 1 0
chr2:148761815|148761930 hsa-miR-92a-3p 0 1 0
chr7:99567995|99568306 hsa-miR-92a-3p 0 1 0
chr3:127606640|127606765 hsa-miR-92a-3p 0 1 0
chr12:54009492|54009622 hsa-miR-92a-3p 0 1 0
chr11:124146570|124146741 hsa-miR-92a-3p 0 1 0
chr5:115840290|115840363 hsa-miR-92a-3p 0 1 0
chr3:184195129|184195294 hsa-miR-92a-3p 0 1 0
chr6:349690|349862 hsa-miR-92a-3p 0 1 0
chr2:173918603|173918687 hsa-miR-92a-3p 0 1 0
chr11:46857101|46857199 hsa-miR-92a-3p 0 1 0
chr2:173918603|173918671 hsa-miR-92a-3p 0 1 0
chr15:29766358|29766487 hsa-miR-92a-3p 1 0 0
chr1:22638989|22639266 hsa-miR-92a-3p 1 0 0
chr17:4936707|4936973 hsa-miR-92a-3p 1 0 0
chr6:26598080|26598348 hsa-miR-92a-3p 1 0 0
chr15:39589831|39589920 hsa-miR-92a-3p 1 0 0
chr17:8047005|8047138 hsa-miR-92a-3p 1 0 0
chr14:75437898|75438121 hsa-miR-92a-3p 1 0 0
chr5:177502478|177502603 hsa-miR-92a-3p 1 0 0
chr12:6537971|6538220 hsa-miR-92a-3p 1 0 0
chr19:55669519|55669629 hsa-miR-92a-3p 1 0 0
chr19:54123768|54123922 hsa-miR-92a-3p 1 0 0
chr3:52406864|52407221 hsa-miR-92a-3p 1 0 0
chr13:95794664|95794766 hsa-miR-92a-3p 1 0 0
chr20:35280697|35280805 hsa-miR-92a-3p 1 0 0
chr5:180791754|180791840 hsa-miR-92a-3p 1 0 0
chr1:150266271|150266393 hsa-miR-92a-3p 1 0 0
chr5:198587|198766 hsa-miR-92a-3p 1 0 0
chr13:95794666|95794766 hsa-miR-92a-3p 1 0 0
chr19:11132148|11132274 hsa-miR-92a-3p 1 0 0
chr2:84906400|84906605 hsa-miR-92a-3p 1 0 0
chr19:54123768|54123918 hsa-miR-92a-3p 1 0 0
chr2:84906403|84906605 hsa-miR-92a-3p 1 0 0
chr12:120563530|120563867 hsa-miR-92a-3p 1 0 0
chr16:2767049|2767158 hsa-miR-92a-3p 1 0 0
chr12:120516633|120516788 hsa-miR-92a-3p 1 0 0
chr3:142505193|142505278 hsa-miR-92a-3p 1 0 0
chr20:63743171|63743306 hsa-miR-92a-3p 1 0 0
chr14:22813309|22813429 hsa-miR-92a-3p 1 0 0
chrX:10143368|10143496 hsa-miR-92a-3p 1 0 0
chr2:216694799|216694911 hsa-miR-92a-3p 1 0 0
chr17:19336420|19336619 hsa-miR-92a-3p 1 0 0
chr7:66740468|66740617 hsa-miR-92a-3p 1 0 0
chr2:74365165|74365558 hsa-miR-92a-3p 1 0 0
chr1:22638989|22639215 hsa-miR-92a-3p 1 0 0
chr15:39589831|39589968 hsa-miR-92a-3p 1 0 0
chr22:46013718|46013823 hsa-miR-92a-3p 1 0 0
chr17:79794940|79795069 hsa-miR-92a-3p 1 0 0
chr12:52169926|52170056 hsa-miR-92a-3p 1 0 0
chr12:6537974|6538220 hsa-miR-92a-3p 1 0 0
chr16:71732739|71732932 hsa-miR-92a-3p 1 0 0
chr20:38091629|38091836 hsa-miR-92a-3p 1 0 0
chr19:54123786|54123918 hsa-miR-92a-3p 1 0 0
chrX:77828514|77828643 hsa-miR-92a-3p 1 0 0
chr17:19336420|19336706 hsa-miR-92a-3p 1 0 0
chr1:150629414|150629569 hsa-miR-92a-3p 1 0 0
chr14:21019132|21019946 hsa-miR-92a-3p 1 0 0
chr14:21019132|21019969 hsa-miR-92a-3p 1 0 0
chr19:19653784|19654064 hsa-miR-92a-3p 1 0 0
chr19:55669546|55669629 hsa-miR-92a-3p 1 0 0
chr8:27598197|27598518 hsa-miR-92a-3p 1 0 0
chr20:63743171|63743289 hsa-miR-92a-3p 1 0 0
chr1:150629414|150629554 hsa-miR-92a-3p 1 0 0
chr17:61643930|61644049 hsa-miR-92a-3p 1 0 0
chr6:26597994|26598348 hsa-miR-92a-3p 1 0 0
chr2:74365165|74365543 hsa-miR-92a-3p 1 0 0
chr4:77159367|77159504 hsa-miR-92a-3p 1 0 0
chr17:18018475|18018609 hsa-miR-92a-3p 1 0 0
chr9:130233844|130234100 hsa-miR-92a-3p 1 0 0
chr1:212799844|212800067 hsa-miR-92a-3p 0 1 0
chr11:103066275|103066482 hsa-miR-92a-3p 0 1 0
chr14:75646575|75646768 hsa-miR-92a-3p 0 1 0
chr5:126497129|126497356 hsa-miR-92a-3p 0 1 0
chr12:108590592|108590784 hsa-miR-92a-3p 0 1 0
chr1:32231434|32231549 hsa-miR-92a-3p 0 1 0
chr19:17504869|17504963 hsa-miR-92a-3p 0 1 0
chr2:203431421|203431584 hsa-miR-92a-3p 0 1 0
chr1:180203014|180203199 hsa-miR-92a-3p 0 1 0
chr16:15703568|15703824 hsa-miR-92a-3p 0 1 0
chr3:47851551|47851655 hsa-miR-92a-3p 0 1 0
chr1:2383113|2383262 hsa-miR-92a-3p 0 1 0
chr14:94465524|94465641 hsa-miR-92a-3p 0 1 0
chr8:142785278|142785404 hsa-miR-92a-3p 0 1 0
chr11:64257528|64257694 hsa-miR-92a-3p 0 1 0
chr3:160431689|160431812 hsa-miR-92a-3p 0 1 0
chr4:48420258|48420433 hsa-miR-92a-3p 0 1 0
chr2:54630883|54631089 hsa-miR-92a-3p 0 1 0
chr3:47084100|47084207 hsa-miR-92a-3p 0 1 0
chr3:30692049|30692272 hsa-miR-92a-3p 0 1 0
chr4:127878513|127878688 hsa-miR-92a-3p 0 1 0
chr1:228494360|228494468 hsa-miR-92a-3p 0 1 0
chr1:109627850|109628214 hsa-miR-92a-3p 0 1 0
chr18:76360138|76360255 hsa-miR-92a-3p 0 1 0
chr7:66611894|66612106 hsa-miR-92a-3p 0 1 0
chr6:75919023|75919241 hsa-miR-92a-3p 0 1 0
chr11:129949870|129949998 hsa-miR-92a-3p 0 1 0
chr17:42569560|42569807 hsa-miR-92a-3p 0 1 0
chr19:2838367|2838494 hsa-miR-92a-3p 0 1 0
chr14:73963503|73963739 hsa-miR-92a-3p 0 1 0
chr12:14499754|14499990 hsa-miR-92a-3p 0 1 0
chr8:22593949|22594178 hsa-miR-92a-3p 0 1 0
chr11:18406504|18406800 hsa-miR-92a-3p 0 1 0
chr11:124146570|124146779 hsa-miR-92a-3p 0 1 0
chr3:33142493|33142774 hsa-miR-92a-3p 0 1 0
chr16:3727701|3727877 hsa-miR-92a-3p 0 1 0
chr15:43184850|43185054 hsa-miR-92a-3p 0 1 0
chr1:114706686|114706867 hsa-miR-92a-3p 0 1 0
chr18:76360152|76360272 hsa-miR-92a-3p 0 1 0
chr1:11055064|11056071 hsa-miR-92a-3p 0 1 0
chr17:42315243|42315386 hsa-miR-92a-3p 0 1 0
chr7:1283016|1283153 hsa-miR-92a-3p 0 1 0
chr1:228494360|228494460 hsa-miR-92a-3p 0 1 0
chr1:156728698|156728898 hsa-miR-92a-3p 0 1 0
chr1:150809848|150809978 hsa-miR-92a-3p 0 1 0
chr7:152309438~152309630 hsa-miR-92a-3p 0 1 0
chr2:237576864~237577031 hsa-miR-92a-3p 0 1 0
chr21:34669040~34669221 hsa-miR-92a-3p 0 1 0
chr22:39132841~39133075 hsa-miR-92a-3p 0 1 0
chr14:75437898~75438121 hsa-miR-92a-3p 0 1 0
chrX:154410169~154410292 hsa-miR-92a-3p 0 1 0
chr10:43487415~43487563 hsa-miR-92a-3p 0 1 0
chr4:775212~775347 hsa-miR-92a-3p 0 1 0
chr16:2767049~2767158 hsa-miR-92a-3p 0 1 0
chr17:1675227~1675328 hsa-miR-92a-3p 0 1 0
chr22:49992337~49992586 hsa-miR-92a-3p 0 1 0
chrX:30630297~30630684 hsa-miR-92a-3p 0 1 0
chr3:142505193~142505278 hsa-miR-92a-3p 0 1 0
chr16:2767010~2767118 hsa-miR-92a-3p 0 1 0
chr1:230873897|230874018 hsa-miR-92a-3p 0 1 0
chr1:2307653~2307785 hsa-miR-92a-3p 0 1 0
chr13:110893214~110893316 hsa-miR-92a-3p 0 1 0
chr6:138338659~138338776 hsa-miR-92a-3p 0 1 0
chr16:2767063~2767170 hsa-miR-92a-3p 0 1 0
chr14:73963503~73963739 hsa-miR-92a-3p 0 1 0
chr1:117096149~117097378 hsa-miR-92a-3p 0 1 0
chr12:103973064~103973172 hsa-miR-92a-3p 0 1 0
chr14:21019132~21019969 hsa-miR-92a-3p 0 1 0
chr14:21019132~21019946 hsa-miR-92a-3p 0 1 0
chr19:6712331~6712553 hsa-miR-92a-3p 0 1 0
chr11:68049989~68050220 hsa-miR-92a-3p 0 1 0
chr16:68833942~68834070 hsa-miR-92a-3p 0 1 0
chr19:9646094~9646234 hsa-miR-92a-3p 0 1 0
chr14:90871991~90872199 hsa-miR-92a-3p 0 1 0
chr10:74105119|74105350 hsa-miR-92a-3p 0 1 0
chr10:11217425|11249193 hsa-miR-92a-3p 1 0 0
chr17:40171358|40171516 hsa-miR-92a-3p 1 0 0
chr14:73719900|73720040 hsa-miR-92a-3p 1 0 0
chr7:66169615|66169774 hsa-miR-92a-3p 1 0 0
chr19:56110418|56110602 hsa-miR-92a-3p 1 0 0
chr2:27026826|27026969 hsa-miR-92a-3p 1 0 0
chr22:50456182|50456308 hsa-miR-92a-3p 1 0 0
chr10:7257937|7258045 hsa-miR-92a-3p 0 1 0
chr5:44808977|44809067 hsa-miR-92a-3p 0 1 0
chr6:6615626|6615795 hsa-miR-92a-3p 0 1 0
chr18:12032553|12032720 hsa-miR-92a-3p 0 1 0
chr22:37699536|37699700 hsa-miR-92a-3p 0 1 0
chr4:39714893|39715021 hsa-miR-92a-3p 0 1 0
chr13:113222710|113222932 hsa-miR-92a-3p 0 1 0
chr6:17691624|17691855 hsa-miR-92a-3p 0 1 0
chr5:7792330|7792501 hsa-miR-92a-3p 0 1 0
chr19:53492049|53492288 hsa-miR-92a-3p 0 1 0
chr16:16174709|16174810 hsa-miR-92a-3p 0 1 0
chr16:23508032|23508139 hsa-miR-92a-3p 0 1 0
chr2:27041016|27041200 hsa-miR-92a-3p 0 1 0
chr12:119713053|119713178 hsa-miR-92a-3p 0 1 0
chrY:18955412|18955531 hsa-miR-92a-3p 0 1 0
chr1:89845718|89845863 hsa-miR-92a-3p 0 1 0
chr19:55621227|55621374 hsa-miR-92a-3p 0 1 0
chr11:47469617|47469840 hsa-miR-92a-3p 0 1 0
chr11:68028057|68028235 hsa-miR-92a-3p 0 1 0
chr14:67119698|67119902 hsa-miR-92a-3p 0 1 0
chr1:150577287|150577458 hsa-miR-92a-3p 0 1 0
chr7:102157716|102157835 hsa-miR-92a-3p 0 1 0
chr1:203308718|203308871 hsa-miR-92a-3p 0 1 0
chr17:8268552|8268697 hsa-miR-92a-3p 0 1 0
chr14:100850529|100850656 hsa-miR-92a-3p 0 1 0
chr16:46910547|46910701 hsa-miR-92a-3p 0 1 0
chr19:45472131|45472419 hsa-miR-92a-3p 0 1 0
chr11:34305680|34305762 hsa-miR-92a-3p 0 1 0
chr17:1729927|1730085 hsa-miR-92a-3p 0 1 0
chr22:37225822|37226018 hsa-miR-92a-3p 0 1 0
chr11:5243299|5243627 hsa-miR-92a-3p 1 0 0
chr19:14395285|14395495 hsa-miR-92a-3p 1 0 0
chr15:84639673|84639796 hsa-miR-92a-3p 1 0 0
chr15:84798803|84799154 hsa-miR-92a-3p 1 0 0
chr12:98549440|98549561 hsa-miR-92a-3p 1 0 0
chr19:58545670|58545839 hsa-miR-92a-3p 1 0 0
chr1:26759486|26759642 hsa-miR-92a-3p 1 0 0
chr9:35706834|35707148 hsa-miR-92a-3p 0 1 0
chr7:99503901|99503998 hsa-miR-92a-3p 0 1 0
chr19:10743891|10744093 hsa-miR-92a-3p 0 1 0
chr13:45117761|45117869 hsa-miR-92a-3p 0 1 0
chr3:9418733|9418882 hsa-miR-92a-3p 0 1 0
chr1:40413142|40413264 hsa-miR-92a-3p 0 1 0
chr16:29669780|29669978 hsa-miR-92a-3p 0 1 0
chr1:35304407|35304571 hsa-miR-92a-3p 0 1 0
chr7:45030960|45031106 hsa-miR-92a-3p 0 1 0
chr10:69382279|69382405 hsa-miR-92a-3p 0 1 0
chr19:53408644|53408811 hsa-miR-92a-3p 0 1 0
chr2:63180191|63180294 hsa-miR-92a-3p 0 1 0
chr11:9223444|9223622 hsa-miR-92a-3p 0 1 0
chr2:178653238|178663902 hsa-miR-92a-3p 0 1 0
chr16:85624240|85624328 hsa-miR-92a-3p 0 1 0
chr2:46800955|46801085 hsa-miR-92a-3p 0 1 0
chr9:27050344|27050478 hsa-miR-92a-3p 0 1 0
chr2:108789502|108789718 hsa-miR-92a-3p 0 1 0
chr12:109970056|109970233 hsa-miR-92a-3p 0 1 0
chr7:5320318|5320588 hsa-miR-92a-3p 0 1 0
chr11:116938942|116939229 hsa-miR-92a-3p 0 1 0
chr2:27239059|27239232 hsa-miR-92a-3p 0 1 0
chr6:5660546|5660693 hsa-miR-92a-3p 0 1 0
chr10:75871195|75871450 hsa-miR-92a-3p 0 1 0
chr3:160225225|160225384 hsa-miR-92a-3p 0 1 0
chr22:37225818|37225987 hsa-miR-92a-3p 0 1 0
chr2:10426754|10426961 hsa-miR-92a-3p 0 1 0
chr17:80337689|80337916 hsa-miR-92a-3p 1 0 0
chr2:215394586|215394672 hsa-miR-92a-3p 1 0 0
chr1:9368353|9368479 hsa-miR-92a-3p 1 0 0
chr1:150629414|150629549 hsa-miR-92a-3p 1 0 0
chr5:132866654|132866928 hsa-miR-92a-3p 1 0 0
chr11:76661218|76661412 hsa-miR-92a-3p 1 0 0
chr9:35740560|35740867 hsa-miR-92a-3p 1 0 0
chr3:130746618|130746769 hsa-miR-92a-3p 1 0 0
chr8:144418658|144418763 hsa-miR-92a-3p 1 0 0
chr12:6537971|6538331 hsa-miR-92a-3p 1 0 0
chr2:74365165|74365546 hsa-miR-92a-3p 1 0 0
chr10:79613910|79614304 hsa-miR-92a-3p 1 0 0
chr1:22639016|22639194 hsa-miR-92a-3p 1 0 0
chr2:219567086|219567441 hsa-miR-92a-3p 1 0 0
chr12:7137811|7138067 hsa-miR-92a-3p 1 0 0
chr1:22639000|22639269 hsa-miR-92a-3p 1 0 0
chr1:22639105|22639311 hsa-miR-92a-3p 1 0 0
chr2:27443204|27443470 hsa-miR-92a-3p 1 0 0
chr10:79614003|79614173 hsa-miR-92a-3p 1 0 0
chr19:896633|896865 hsa-miR-92a-3p 1 0 0
chr20:63743171|63743352 hsa-miR-92a-3p 1 0 0
chr11:18407339|18407579 hsa-miR-92a-3p 1 0 0
chr16:89694218|89694342 hsa-miR-92a-3p 1 0 0
chrX:71300593|71300725 hsa-miR-92a-3p 1 0 0
chr11:57741695|57742184 hsa-miR-92a-3p 1 0 0
chr15:64155929|64156130 hsa-miR-92a-3p 1 0 0
chr17:76007595|76007735 hsa-miR-92a-3p 1 0 0
chr1:22639000|22639303 hsa-miR-92a-3p 1 0 0
chr1:192809739|192809833 hsa-miR-92a-3p 1 0 0
chr6:26598074|26598348 hsa-miR-92a-3p 1 0 0
chr1:151408122|151408473 hsa-miR-92a-3p 1 0 0
chr19:58545508|58547396 hsa-miR-92a-3p 1 0 0
chr5:177502481|177502603 hsa-miR-92a-3p 1 0 0
chr19:54123765|54123918 hsa-miR-92a-3p 1 0 0
chr1:22639011|22639303 hsa-miR-92a-3p 1 0 0
chr10:11217425|11217507 hsa-miR-92a-3p 1 0 0
chr11:59598581|59598671 hsa-miR-92a-3p 1 0 0
chr7:100431247|100431386 hsa-miR-92a-3p 1 0 0
chr11:64796809|64797021 hsa-miR-92a-3p 1 0 0
chr22:17734870|17735001 hsa-miR-92a-3p 1 0 0
chrX:77828519|77828643 hsa-miR-92a-3p 1 0 0
chr17:28714483|28714605 hsa-miR-92a-3p 1 0 0
chr11:35229337|35229633 hsa-miR-92a-3p 1 0 0
chr6:12163527|12163664 hsa-miR-92a-3p 1 0 0
chr10:79557118|79557329 hsa-miR-92a-3p 1 0 0
chr11:66565831|66566162 hsa-miR-92a-3p 1 0 0
chr3:47413190|47413363 hsa-miR-92a-3p 1 0 0
chr7:100494359|100494483 hsa-miR-92a-3p 1 0 0
chr19:7112482|7112610 hsa-miR-92a-3p 1 0 0
chr8:42175751|42175903 hsa-miR-92a-3p 1 0 0
chr19:55669461|55669629 hsa-miR-92a-3p 1 0 0
chr16:10690474|10690618 hsa-miR-92a-3p 1 0 0
chr12:12915389|12915683 hsa-miR-92a-3p 1 0 0
chr8:29062603|29062740 hsa-miR-92a-3p 1 0 0
chr14:23307947|23308154 hsa-miR-92a-3p 1 0 0
chr3:4984196|4984451 hsa-miR-92a-3p 1 0 0
chr16:89694206|89694342 hsa-miR-92a-3p 1 0 0
chr16:13950800|13950952 hsa-miR-92a-3p 0 1 0
chr16:68833815|68834070 hsa-miR-92a-3p 0 1 0
chr5:138468760|138468913 hsa-miR-92a-3p 0 1 0
chr19:53456181|53456516 hsa-miR-92a-3p 0 1 0
chr16:86487180|86487332 hsa-miR-92a-3p 0 1 0
chr11:32856820|32856945 hsa-miR-92a-3p 0 1 0
chr1:43281629|43281791 hsa-miR-92a-3p 0 1 0
chr3:49423754|49423969 hsa-miR-92a-3p 0 1 0
chr12:51053430|51053744 hsa-miR-92a-3p 0 1 0
chr22:38491064|38491229 hsa-miR-92a-3p 0 1 0
chr3:182919338|182919481 hsa-miR-92a-3p 0 1 0
chr2:225657133|225657272 hsa-miR-92a-3p 0 1 0
chrX:119243799|119244087 hsa-miR-92a-3p 0 1 0
chr17:81894535|81894831 hsa-miR-92a-3p 0 1 0
chr14:52720150|52720303 hsa-miR-92a-3p 0 1 0
chr14:52720127|52720297 hsa-miR-92a-3p 0 1 0
chr9:113292117|113292497 hsa-miR-92a-3p 0 1 0
chr1:15934712|15934851 hsa-miR-92a-3p 0 1 0
chr8:22594057|22594189 hsa-miR-92a-3p 0 1 0
chr20:62398774|62399060 hsa-miR-92a-3p 0 1 0
chr11:561762|562130 hsa-miR-92a-3p 0 1 0
chr2:157673495|157673729 hsa-miR-92a-3p 0 1 0
chr22:27922993|27923141 hsa-miR-92a-3p 0 1 0
chr8:38944474|38944584 hsa-miR-92a-3p 0 1 0
chr1:15934412|15934655 hsa-miR-92a-3p 0 1 0
chr10:49500538|49506012 hsa-miR-92a-3p 0 1 0
chr1:24156884|24157175 hsa-miR-92a-3p 0 1 0
chr17:42128261|42128335 hsa-miR-92a-3p 0 1 0
chr16:29988556|29988800 hsa-miR-92a-3p 0 1 0
chr1:202347739|202347958 hsa-miR-92a-3p 0 1 0
chr6:31778785|31778936 hsa-miR-92a-3p 0 1 0
chr1:203308700|203308847 hsa-miR-92a-3p 0 1 0
chr17:8475244|8475351 hsa-miR-92a-3p 0 1 0
chr3:160431674|160431812 hsa-miR-92a-3p 0 1 0
chr14:50921324|50921489 hsa-miR-92a-3p 0 1 0
chr8:26505895|26506118 hsa-miR-92a-3p 0 1 0
chr17:61481790|61481929 hsa-miR-92a-3p 0 1 0
chr11:66474763|66474929 hsa-miR-92a-3p 0 1 0
chr4:86802933|86803073 hsa-miR-92a-3p 0 1 0
chr3:52522911|52523115 hsa-miR-92a-3p 0 1 0
chr3:113810001|113810113 hsa-miR-92a-3p 0 1 0
chr9:128257641|128257868 hsa-miR-92a-3p 0 1 0
chr5:151268119|151268317 hsa-miR-92a-3p 0 1 0
chr1:172899884|172900012 hsa-miR-92a-3p 0 1 0
chr3:188888165|188888358 hsa-miR-92a-3p 0 1 0
chr9:113597409|113597562 hsa-miR-92a-3p 0 1 0
chr19:21059182|21059284 hsa-miR-92a-3p 0 1 0
chr21:36115502|36115649 hsa-miR-92a-3p 0 1 0
chr3:177180645|177180824 hsa-miR-92a-3p 0 1 0
chr13:113260486|113260606 hsa-miR-92a-3p 0 1 0
chr21:33263237|33263391 hsa-miR-92a-3p 0 1 0
chr2:148761782|148765146 hsa-miR-92a-3p 0 1 0
chr1:26446316|26447660 hsa-miR-92a-3p 0 1 0
chr1:224365879|224377177 hsa-miR-92a-3p 0 1 0
chr21:43769977|43770187 hsa-miR-92a-3p 0 1 0
chr2:202563114|202563323 hsa-miR-92a-3p 0 1 0
chr5:10509792|10509886 hsa-miR-92a-3p 0 1 0
chr22:31126942|31127037 hsa-miR-92a-3p 0 1 0
chr19:13751610|13751800 hsa-miR-92a-3p 0 1 0
chr3:119415658|119416006 hsa-miR-92a-3p 0 1 0
chr1:9268175|9268308 hsa-miR-92a-3p 0 1 0
chr14:24318371|24318499 hsa-miR-92a-3p 0 1 0
chr10:863743|885760 hsa-miR-92a-3p 0 1 0
chr5:36872545|36872751 hsa-miR-92a-3p 0 1 0
chr18:3484425|3484544 hsa-miR-92a-3p 0 1 0
chr12:21654543|21654656 hsa-miR-92a-3p 0 1 0
chr22:41830811|41830999 hsa-miR-92a-3p 0 1 0
chr22:21620233|21620354 hsa-miR-92a-3p 0 1 0
chr3:42658935|42659121 hsa-miR-92a-3p 0 1 0
chr11:561802|562130 hsa-miR-92a-3p 0 1 0
chr5:157757070|157757242 hsa-miR-92a-3p 0 1 0
chr15:40419999|40420172 hsa-miR-92a-3p 0 1 0
chrX:16712519|16712625 hsa-miR-92a-3p 0 1 0
chr17:29831568|29831653 hsa-miR-92a-3p 0 1 0
chr16:88805596|88805807 hsa-miR-92a-3p 0 1 0
chrX:10109872|10110020 hsa-miR-92a-3p 0 1 0
chr7:92457063|92457257 hsa-miR-92a-3p 0 1 0
chr13:113214452|113214661 hsa-miR-92a-3p 0 1 0
chr1:230277537|230277638 hsa-miR-92a-3p 0 1 0
chr5:151268109|151268317 hsa-miR-92a-3p 0 1 0
chr21:41422899|41423164 hsa-miR-92a-3p 0 1 0
chr22:27923049|27923190 hsa-miR-92a-3p 0 1 0
chr5:91375580|91376712 hsa-miR-92a-3p 0 1 0
chr11:68049971|68050190 hsa-miR-92a-3p 0 1 0
chr11:68050038|68050151 hsa-miR-92a-3p 0 1 0
chr3:47083932|47084194 hsa-miR-92a-3p 0 1 0
chrX:47226330|47226629 hsa-miR-92a-3p 0 1 0
chr2:27239140|27239450 hsa-miR-92a-3p 0 1 0
chr17:45268955|45269130 hsa-miR-92a-3p 0 1 0
chr2:236124603|236124773 hsa-miR-92a-3p 0 1 0
chr6:160106083|160106189 hsa-miR-92a-3p 0 1 0
chr6:26096090|26096204 hsa-miR-92a-3p 0 1 0
chr2:173918603|173918694 hsa-miR-92a-3p 0 1 0
chr12:49644375|49644499 hsa-miR-92a-3p 0 1 0
chr17:81914922|81915142 hsa-miR-92a-3p 0 1 0
chr7:100803347|100803480 hsa-miR-92a-3p 0 1 0
chr16:2767063|2767170 hsa-miR-92a-3p 0 1 0
chr16:2767033|2767170 hsa-miR-92a-3p -16 1 0
chr12:49273992|49274145 hsa-miR-92a-3p -14 1 0
chr2:85662036|85663392 hsa-miR-92a-3p -18 1 0
chr16:23573638|23573853 hsa-miR-92a-3p -17 1 0
chr12:48222616|48222800 hsa-miR-92a-3p -4 1 0
chr2:42057831|42058051 hsa-miR-92a-3p 0 1 0
chr19:54123789|54123918 hsa-miR-92a-3p 1 0 0
chr16:71732739|71732929 hsa-miR-92a-3p 1 0 0
chr3:58171685|58171910 hsa-miR-92a-3p 1 0 0
chr1:955541|955678 hsa-miR-92a-3p 1 0 0
chr14:53951853|53951933 hsa-miR-92a-3p 1 0 0
chr13:95794484|95794766 hsa-miR-92a-3p 1 0 0
chrX:77828514|77828602 hsa-miR-92a-3p 1 0 0
chr11:72229165|72229558 hsa-miR-92a-3p 1 0 0
chr12:132553572|132553762 hsa-miR-92a-3p 1 0 0
chr20:31945120|31945355 hsa-miR-92a-3p 1 0 0
chr15:29766358|29766511 hsa-miR-92a-3p 1 0 0
chr12:12915474|12915683 hsa-miR-92a-3p 1 0 0
chrX:38688021|38688171 hsa-miR-92a-3p 1 0 0
chr2:218274324|218274482 hsa-miR-92a-3p 1 0 0
chr2:215394528|215394634 hsa-miR-92a-3p 1 0 0
chr5:140706189|140706322 hsa-miR-92a-3p 1 0 0
chr1:6185549|6185762 hsa-miR-92a-3p 1 0 0
chr19:11132150|11132274 hsa-miR-92a-3p 1 0 0
chr1:8353580|8353806 hsa-miR-92a-3p 1 0 0
chr5:107671953|107672217 hsa-miR-92a-3p 1 0 0
chr5:119121023|119121139 hsa-miR-92a-3p 1 0 0
chr19:11132143|11132274 hsa-miR-92a-3p 1 0 0
chrX:101401233|101401342 hsa-miR-92a-3p 1 0 0
chr2:218274324|218274463 hsa-miR-92a-3p 1 0 0
chr3:184572737|184572851 hsa-miR-92a-3p 1 0 0
chr19:39980167|39980263 hsa-miR-92a-3p 1 0 0
chr13:95794594|95794781 hsa-miR-92a-3p 1 0 0
chr20:63743171|63743304 hsa-miR-92a-3p 1 0 0
chr5:180791754|180791847 hsa-miR-92a-3p 1 0 0
chr1:9613892|9614094 hsa-miR-92a-3p 1 0 0
chr17:4006562|4006810 hsa-miR-92a-3p 1 0 0
chr15:64155929|64156028 hsa-miR-92a-3p 1 0 0
chr11:64219311|64219396 hsa-miR-92a-3p 1 0 0
chr7:101004527|101004775 hsa-miR-92a-3p 1 0 0
chr2:219182819|219182955 hsa-miR-92a-3p 1 0 0
chr11:805505|805696 hsa-miR-92a-3p 1 0 0
chr21:26837104|26837241 hsa-miR-92a-3p 1 0 0
chr14:24304104|24304259 hsa-miR-92a-3p 1 0 0
chr4:55109073|55109164 hsa-miR-92a-3p 1 0 0
chr22:50596493|50596620 hsa-miR-92a-3p 0 1 0
chr1:114706682|114706821 hsa-miR-92a-3p 0 1 0
chr12:50930502|50930665 hsa-miR-92a-3p 0 1 0
chr13:110893204|110893322 hsa-miR-92a-3p 0 1 0
chr15:43184869|43185011 hsa-miR-92a-3p 0 1 0
chr16:67175836|67175937 hsa-miR-92a-3p 0 1 0
chr1:145992974|145993372 hsa-miR-92a-3p 0 1 0
chr16:1325478|1325666 hsa-miR-92a-3p 0 1 0
chr1:207884017|207884155 hsa-miR-92a-3p 0 1 0
chr5:133974857|133974995 hsa-miR-92a-3p 0 1 0
chr1:1760918|1761064 hsa-miR-92a-3p 0 1 0
chr6:1357488|1357644 hsa-miR-92a-3p 0 1 0
chr10:113075389|113075522 hsa-miR-92a-3p 0 1 0
chr1:201967987|201968133 hsa-miR-92a-3p 0 1 0
chr1:235551479|235551596 hsa-miR-92a-3p 0 1 0
chr19:10112208|10112356 hsa-miR-92a-3p 0 1 0
chr2:96272574|96272805 hsa-miR-92a-3p 0 1 0
chr14:24189622|24189756 hsa-miR-92a-3p 0 1 0
chr8:96340314|96340420 hsa-miR-92a-3p 0 1 0
chr11:561796|562130 hsa-miR-92a-3p 0 1 0
chr16:46930516|46930765 hsa-miR-92a-3p 0 1 0
chr7:101193455|101193575 hsa-miR-92a-3p 0 1 0
chr4:68945306|68945454 hsa-miR-92a-3p 0 1 0
chr21:33534607|33534739 hsa-miR-92a-3p 0 1 0
chr3:44918412|44918539 hsa-miR-92a-3p 0 1 0
chr7:100803248|100803483 hsa-miR-92a-3p 0 1 0
chr6:158632967|158633065 hsa-miR-92a-3p 0 1 0
chr11:108508083|108508264 hsa-miR-92a-3p 0 1 0
chrX:47209108|47209267 hsa-miR-92a-3p 0 1 0
chr10:84203306|84203485 hsa-miR-92a-3p 0 1 0
chr2:27239151|27239450 hsa-miR-92a-3p 0 1 0
chr3:47816343|47816471 hsa-miR-92a-3p 0 1 0
chr4:775172|775302 hsa-miR-92a-3p 0 1 0
chr3:109151613|109151888 hsa-miR-92a-3p 0 1 0
chr11:71478490|71478635 hsa-miR-92a-3p 0 1 0
chr3:40526997|40527137 hsa-miR-92a-3p 0 1 0
chr11:68049989|68050186 hsa-miR-92a-3p 0 1 0
chr6:75919017|75919167 hsa-miR-92a-3p 0 1 0
chr11:65667068|65667192 hsa-miR-92a-3p 0 1 0
chr17:75101607|75101748 hsa-miR-92a-3p 0 1 0
chr22:26839758|26840142 hsa-miR-92a-3p 0 1 0
chr19:44095854|44095973 hsa-miR-92a-3p 0 1 0
chrX:14920633|14920758 hsa-miR-92a-3p 0 1 0
chr20:32115731|32115879 hsa-miR-92a-3p 0 1 0
chr16:68833942|68834070 hsa-miR-92a-3p 0 1 0
chr20:31597810|31597924 hsa-miR-92a-3p 0 1 0
chr2:158673699|158674000 hsa-miR-92a-3p 0 1 0
chr22:20956666|20956872 hsa-miR-92a-3p 0 1 0
chr2:36549938|36550118 hsa-miR-92a-3p 0 1 0
chr15:80596321|80596484 hsa-miR-92a-3p 0 1 0
chr22:45620114|45620274 hsa-miR-92a-3p 0 1 0
chr17:75876466|75877894 hsa-miR-92a-3p 0 1 0
chr1:248916678|248916783 hsa-miR-92a-3p 0 1 0
chr12:68745481|68745615 hsa-miR-92a-3p 0 1 0
chr12:50930567|50930665 hsa-miR-92a-3p 0 1 0
chrX:106928414|106928615 hsa-miR-92a-3p 0 1 0
chr6:31464584|31464785 hsa-miR-92a-3p 0 1 0
chr5:34905868|34906063 hsa-miR-92a-3p 0 1 0
chr7:44578770|44578943 hsa-miR-92a-3p 0 1 0
chr15:72199077|72199182 hsa-miR-92a-3p 0 1 0
chr7:38726001|38726284 hsa-miR-92a-3p 0 1 0
chr7:22150121|22150205 hsa-miR-92a-3p 0 1 0
chr1:180178207|180178353 hsa-miR-92a-3p 0 1 0
chr11:57741692|57742184 hsa-miR-92a-3p 1 0 0
chr20:63743162|63743281 hsa-miR-92a-3p 1 0 0
chr14:77469250|77469395 hsa-miR-92a-3p 1 0 0
chr21:45513954|45514161 hsa-miR-92a-3p 1 0 0
chr5:103276262|103276429 hsa-miR-92a-3p 1 0 0
chr13:52414336|52414425 hsa-miR-92a-3p 1 0 0
chr12:643718|644072 hsa-miR-92a-3p 1 0 0
chr17:18018475|18018668 hsa-miR-92a-3p 1 0 0
chrX:123886197|123886335 hsa-miR-92a-3p 1 0 0
chr11:35229316|35229591 hsa-miR-92a-3p 1 0 0
chr2:218274324|218274637 hsa-miR-92a-3p 1 0 0
chr13:41236073|41236179 hsa-miR-92a-3p 1 0 0
chr14:22876021|22876243 hsa-miR-92a-3p 1 0 0
chr2:219611344|219611473 hsa-miR-92a-3p 1 0 0
chr11:63976311|63976416 hsa-miR-92a-3p 1 0 0
chr20:63743207|63743354 hsa-miR-92a-3p 1 0 0
chr13:95794664|95794781 hsa-miR-92a-3p 1 0 0
chr16:29900561|29900708 hsa-miR-92a-3p 1 0 0
chrX:46598024|46598215 hsa-miR-92a-3p 1 0 0
chr11:119661922|119662061 hsa-miR-92a-3p 1 0 0
chr17:76713871|76714080 hsa-miR-92a-3p 1 0 0
chr11:75204925|75205004 hsa-miR-92a-3p 1 0 0
chr22:38221039|38221137 hsa-miR-92a-3p 1 0 0
chr4:99062197|99062455 hsa-miR-92a-3p 1 0 0
chr3:184576888|184576995 hsa-miR-92a-3p 1 0 0
chr10:79613978|79614160 hsa-miR-92a-3p 1 0 0
chr2:223054213|223054407 hsa-miR-92a-3p 1 0 0
chr15:66490082|66490361 hsa-miR-92a-3p 1 0 0
chr9:128120717|128120858 hsa-miR-92a-3p 1 0 0
chr13:95794594|95794766 hsa-miR-92a-3p 1 0 0
chr6:111025764|111025935 hsa-miR-92a-3p 1 0 0
chr12:51922898|51923220 hsa-miR-92a-3p 1 0 0
chr2:99405928|99406063 hsa-miR-92a-3p 1 0 0
chr19:896668|896852 hsa-miR-92a-3p 1 0 0
chr6:32182617|32182947 hsa-miR-92a-3p 1 0 0
chr14:94051133|94051350 hsa-miR-92a-3p 1 0 0
chr19:38308992|38309277 hsa-miR-92a-3p 1 0 0
chr3:147393571|147393695 hsa-miR-92a-3p 1 0 0
chr17:50186886|50187088 hsa-miR-92a-3p 1 0 0
chr2:219182873|219183141 hsa-miR-92a-3p 1 0 0
chr7:128457785|128458009 hsa-miR-92a-3p 1 0 0
chr1:22639094|22639303 hsa-miR-92a-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-92a-3p ITGA5 integrin subunit alpha 5 HGNC:6141 details
hsa-miR-92a-3p ARID4B AT-rich interaction domain 4B HGNC:15550 details
hsa-miR-92a-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-92a-3p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-92a-3p TP63 tumor protein p63 HGNC:15979 details
hsa-miR-92a-3p KAT2B lysine acetyltransferase 2B HGNC:8638 details
hsa-miR-92a-3p ESR2 estrogen receptor 2 HGNC:3468 details
hsa-miR-92a-3p TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-92a-3p BMPR2 bone morphogenetic protein receptor type 2 HGNC:1078 details
hsa-miR-92a-3p CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-92a-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-92a-3p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-92a-3p CDH1 cadherin 1 HGNC:1748 details
hsa-miR-92a-3p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-92a-3p KLF2 Kruppel like factor 2 HGNC:6347 details
hsa-miR-92a-3p TPD52L3 TPD52 like 3 HGNC:23382 details
hsa-miR-92a-3p TXLNA taxilin alpha HGNC:30685 details
hsa-miR-92a-3p NDST1 N-deacetylase and N-sulfotransferase 1 HGNC:7680 details
hsa-miR-92a-3p EFNB1 ephrin B1 HGNC:3226 details
hsa-miR-92a-3p RPL39 ribosomal protein L39 HGNC:10350 details
hsa-miR-92a-3p TMF1 TATA element modulatory factor 1 HGNC:11870 details
hsa-miR-92a-3p KCTD7 potassium channel tetramerization domain containing 7 HGNC:21957 details
hsa-miR-92a-3p VBP1 VHL binding protein 1 HGNC:12662 details
hsa-miR-92a-3p TPT1 tumor protein, translationally-controlled 1 HGNC:12022 details
hsa-miR-92a-3p TRAPPC13 trafficking protein particle complex subunit 13 HGNC:25828 details
hsa-miR-92a-3p NEK2 NIMA related kinase 2 HGNC:7745 details
hsa-miR-92a-3p CYP7A1 cytochrome P450 family 7 subfamily A member 1 HGNC:2651 details
hsa-miR-92a-3p SLC25A3 solute carrier family 25 member 3 HGNC:10989 details
hsa-miR-92a-3p UCHL1 ubiquitin C-terminal hydrolase L1 HGNC:12513 details
hsa-miR-92a-3p RPS24 ribosomal protein S24 HGNC:10411 details
hsa-miR-92a-3p FAM83G family with sequence similarity 83 member G HGNC:32554 details
hsa-miR-92a-3p BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone HGNC:1020 details
hsa-miR-92a-3p DTWD2 DTW domain containing 2 HGNC:19334 details
hsa-miR-92a-3p SLC20A1 solute carrier family 20 member 1 HGNC:10946 details
hsa-miR-92a-3p C1orf174 chromosome 1 open reading frame 174 HGNC:27915 details
hsa-miR-92a-3p CUX1 cut like homeobox 1 HGNC:2557 details
hsa-miR-92a-3p DDX23 DEAD-box helicase 23 HGNC:17347 details
hsa-miR-92a-3p PON2 paraoxonase 2 HGNC:9205 details
hsa-miR-92a-3p STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-92a-3p CHST9 carbohydrate sulfotransferase 9 HGNC:19898 details
hsa-miR-92a-3p SHISA5 shisa family member 5 HGNC:30376 details
hsa-miR-92a-3p details
hsa-miR-92a-3p GCHFR GTP cyclohydrolase I feedback regulator HGNC:4194 details
hsa-miR-92a-3p DHX30 DExH-box helicase 30 HGNC:16716 details
hsa-miR-92a-3p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-92a-3p IPO4 importin 4 HGNC:19426 details
hsa-miR-92a-3p POLE DNA polymerase epsilon, catalytic subunit HGNC:9177 details
hsa-miR-92a-3p SETDB1 SET domain bifurcated histone lysine methyltransferase 1 HGNC:10761 details
hsa-miR-92a-3p GABPA GA binding protein transcription factor subunit alpha HGNC:4071 details
hsa-miR-92a-3p ATAD3A ATPase family AAA domain containing 3A HGNC:25567 details
hsa-miR-92a-3p HSD17B10 hydroxysteroid 17-beta dehydrogenase 10 HGNC:4800 details
hsa-miR-92a-3p TYMP thymidine phosphorylase HGNC:3148 details
hsa-miR-92a-3p CIT citron rho-interacting serine/threonine kinase HGNC:1985 details
hsa-miR-92a-3p IK IK cytokine HGNC:5958 details
hsa-miR-92a-3p TFPI tissue factor pathway inhibitor HGNC:11760 details
hsa-miR-92a-3p CAMKV CaM kinase like vesicle associated HGNC:28788 details
hsa-miR-92a-3p QTRT1 queuine tRNA-ribosyltransferase catalytic subunit 1 HGNC:23797 details
hsa-miR-92a-3p ASAH1 N-acylsphingosine amidohydrolase 1 HGNC:735 details
hsa-miR-92a-3p SAP30BP SAP30 binding protein HGNC:30785 details
hsa-miR-92a-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-92a-3p ELAC2 elaC ribonuclease Z 2 HGNC:14198 details
hsa-miR-92a-3p HNRNPLL heterogeneous nuclear ribonucleoprotein L like HGNC:25127 details
hsa-miR-92a-3p ETV6 ETS variant transcription factor 6 HGNC:3495 details
hsa-miR-92a-3p PRRC2B proline rich coiled-coil 2B HGNC:28121 details
hsa-miR-92a-3p LY6G5B lymphocyte antigen 6 family member G5B HGNC:13931 details
hsa-miR-92a-3p ALKBH4 alkB homolog 4, lysine demethylase HGNC:21900 details
hsa-miR-92a-3p DAZAP1 DAZ associated protein 1 HGNC:2683 details
hsa-miR-92a-3p IPO7 importin 7 HGNC:9852 details
hsa-miR-92a-3p CTC1 CST telomere replication complex component 1 HGNC:26169 details
hsa-miR-92a-3p CHCHD10 coiled-coil-helix-coiled-coil-helix domain containing 10 HGNC:15559 details
hsa-miR-92a-3p BSG basigin (Ok blood group) HGNC:1116 details
hsa-miR-92a-3p RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-92a-3p NMD3 NMD3 ribosome export adaptor HGNC:24250 details
hsa-miR-92a-3p MRPL32 mitochondrial ribosomal protein L32 HGNC:14035 details
hsa-miR-92a-3p RPL11 ribosomal protein L11 HGNC:10301 details
hsa-miR-92a-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-92a-3p BAK1 BCL2 antagonist/killer 1 HGNC:949 details
hsa-miR-92a-3p MYH2 myosin heavy chain 2 HGNC:7572 details
hsa-miR-92a-3p INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-92a-3p GARNL3 GTPase activating Rap/RanGAP domain like 3 HGNC:25425 details
hsa-miR-92a-3p HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase HGNC:5006 details
hsa-miR-92a-3p TUBB2B tubulin beta 2B class IIb HGNC:30829 details
hsa-miR-92a-3p RPL24 ribosomal protein L24 HGNC:10325 details
hsa-miR-92a-3p HELQ helicase, POLQ like HGNC:18536 details
hsa-miR-92a-3p MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like HGNC:19840 details
hsa-miR-92a-3p PLA2G4F phospholipase A2 group IVF HGNC:27396 details
hsa-miR-92a-3p HERC1 HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 HGNC:4867 details
hsa-miR-92a-3p RASAL2 RAS protein activator like 2 HGNC:9874 details
hsa-miR-92a-3p RAD23B RAD23 homolog B, nucleotide excision repair protein HGNC:9813 details
hsa-miR-92a-3p PSMD11 proteasome 26S subunit, non-ATPase 11 HGNC:9556 details
hsa-miR-92a-3p TALDO1 transaldolase 1 HGNC:11559 details
hsa-miR-92a-3p CCDC6 coiled-coil domain containing 6 HGNC:18782 details
hsa-miR-92a-3p RNF128 ring finger protein 128 HGNC:21153 details
hsa-miR-92a-3p CLNS1A chloride nucleotide-sensitive channel 1A HGNC:2080 details
hsa-miR-92a-3p NUCB1 nucleobindin 1 HGNC:8043 details
hsa-miR-92a-3p POTEG POTE ankyrin domain family member G HGNC:33896 details
hsa-miR-92a-3p DCAF12 DDB1 and CUL4 associated factor 12 HGNC:19911 details
hsa-miR-92a-3p USP9X ubiquitin specific peptidase 9 X-linked HGNC:12632 details
hsa-miR-92a-3p BLMH bleomycin hydrolase HGNC:1059 details
hsa-miR-92a-3p DCP2 decapping mRNA 2 HGNC:24452 details
hsa-miR-92a-3p SEC14L1 SEC14 like lipid binding 1 HGNC:10698 details
hsa-miR-92a-3p EIF3I eukaryotic translation initiation factor 3 subunit I HGNC:3272 details
hsa-miR-92a-3p NCL nucleolin HGNC:7667 details
hsa-miR-92a-3p MAP1B microtubule associated protein 1B HGNC:6836 details
hsa-miR-92a-3p GOLIM4 golgi integral membrane protein 4 HGNC:15448 details
hsa-miR-92a-3p EEF2 eukaryotic translation elongation factor 2 HGNC:3214 details
hsa-miR-92a-3p RASA1 RAS p21 protein activator 1 HGNC:9871 details
hsa-miR-92a-3p PLEKHB1 pleckstrin homology domain containing B1 HGNC:19079 details
hsa-miR-92a-3p CCNI cyclin I HGNC:1595 details
hsa-miR-92a-3p RPS25 ribosomal protein S25 HGNC:10413 details
hsa-miR-92a-3p FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-92a-3p AHCYL2 adenosylhomocysteinase like 2 HGNC:22204 details
hsa-miR-92a-3p ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase HGNC:77 details
hsa-miR-92a-3p GANAB glucosidase II alpha subunit HGNC:4138 details
hsa-miR-92a-3p CRBN cereblon HGNC:30185 details
hsa-miR-92a-3p MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-92a-3p LPIN1 lipin 1 HGNC:13345 details
hsa-miR-92a-3p KDM6B lysine demethylase 6B HGNC:29012 details
hsa-miR-92a-3p GPR89A G protein-coupled receptor 89A HGNC:31984 details
hsa-miR-92a-3p CBX6 chromobox 6 HGNC:1556 details
hsa-miR-92a-3p ANKLE2 ankyrin repeat and LEM domain containing 2 HGNC:29101 details
hsa-miR-92a-3p SCD5 stearoyl-CoA desaturase 5 HGNC:21088 details
hsa-miR-92a-3p NUDCD3 NudC domain containing 3 HGNC:22208 details
hsa-miR-92a-3p AGO1 argonaute RISC component 1 HGNC:3262 details
hsa-miR-92a-3p PKM pyruvate kinase M1/2 HGNC:9021 details
hsa-miR-92a-3p NUP205 nucleoporin 205 HGNC:18658 details
hsa-miR-92a-3p RASA3 RAS p21 protein activator 3 HGNC:20331 details
hsa-miR-92a-3p EIF3C eukaryotic translation initiation factor 3 subunit C HGNC:3279 details
hsa-miR-92a-3p HADHA hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha HGNC:4801 details
hsa-miR-92a-3p GHITM growth hormone inducible transmembrane protein HGNC:17281 details
hsa-miR-92a-3p PLEKHH3 pleckstrin homology, MyTH4 and FERM domain containing H3 HGNC:26105 details
hsa-miR-92a-3p RCAN1 regulator of calcineurin 1 HGNC:3040 details
hsa-miR-92a-3p UBE2H ubiquitin conjugating enzyme E2 H HGNC:12484 details
hsa-miR-92a-3p CCSAP centriole, cilia and spindle associated protein HGNC:29578 details
hsa-miR-92a-3p DHTKD1 dehydrogenase E1 and transketolase domain containing 1 HGNC:23537 details
hsa-miR-92a-3p IER3IP1 immediate early response 3 interacting protein 1 HGNC:18550 details
hsa-miR-92a-3p SLAIN1 SLAIN motif family member 1 HGNC:26387 details
hsa-miR-92a-3p NPLOC4 NPL4 homolog, ubiquitin recognition factor HGNC:18261 details
hsa-miR-92a-3p DOT1L DOT1 like histone lysine methyltransferase HGNC:24948 details
hsa-miR-92a-3p TPRN taperin HGNC:26894 details
hsa-miR-92a-3p RPL27 ribosomal protein L27 HGNC:10328 details
hsa-miR-92a-3p ELOVL6 ELOVL fatty acid elongase 6 HGNC:15829 details
hsa-miR-92a-3p DHRS3 dehydrogenase/reductase 3 HGNC:17693 details
hsa-miR-92a-3p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ZNF785 zinc finger protein 785 HGNC:26496 details
hsa-miR-92a-3p ACAT2 acetyl-CoA acetyltransferase 2 HGNC:94 details
hsa-miR-92a-3p ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 HGNC:217 details
hsa-miR-92a-3p SPEN spen family transcriptional repressor HGNC:17575 details
hsa-miR-92a-3p TAOK2 TAO kinase 2 HGNC:16835 details
hsa-miR-92a-3p POLRMT RNA polymerase mitochondrial HGNC:9200 details
hsa-miR-92a-3p EFNA5 ephrin A5 HGNC:3225 details
hsa-miR-92a-3p SHC3 SHC adaptor protein 3 HGNC:18181 details
hsa-miR-92a-3p POLI DNA polymerase iota HGNC:9182 details
hsa-miR-92a-3p CDK11A cyclin dependent kinase 11A HGNC:1730 details
hsa-miR-92a-3p MAML1 mastermind like transcriptional coactivator 1 HGNC:13632 details
hsa-miR-92a-3p TUBB3 tubulin beta 3 class III HGNC:20772 details
hsa-miR-92a-3p CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-92a-3p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-92a-3p FAF1 Fas associated factor 1 HGNC:3578 details
hsa-miR-92a-3p RPL7A ribosomal protein L7a HGNC:10364 details
hsa-miR-92a-3p EIF2B2 eukaryotic translation initiation factor 2B subunit beta HGNC:3258 details
hsa-miR-92a-3p DNM2 dynamin 2 HGNC:2974 details
hsa-miR-92a-3p ACADS acyl-CoA dehydrogenase short chain HGNC:90 details
hsa-miR-92a-3p EIF3B eukaryotic translation initiation factor 3 subunit B HGNC:3280 details
hsa-miR-92a-3p CPSF6 cleavage and polyadenylation specific factor 6 HGNC:13871 details
hsa-miR-92a-3p PSMB1 proteasome 20S subunit beta 1 HGNC:9537 details
hsa-miR-92a-3p PDE4DIP phosphodiesterase 4D interacting protein HGNC:15580 details
hsa-miR-92a-3p BTRC beta-transducin repeat containing E3 ubiquitin protein ligase HGNC:1144 details
hsa-miR-92a-3p TRIP12 thyroid hormone receptor interactor 12 HGNC:12306 details
hsa-miR-92a-3p TRAF4 TNF receptor associated factor 4 HGNC:12034 details
hsa-miR-92a-3p SLC25A38 solute carrier family 25 member 38 HGNC:26054 details
hsa-miR-92a-3p CEP85 centrosomal protein 85 HGNC:25309 details
hsa-miR-92a-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-92a-3p RPA2 replication protein A2 HGNC:10290 details
hsa-miR-92a-3p B4GALT2 beta-1,4-galactosyltransferase 2 HGNC:925 details
hsa-miR-92a-3p MLX MAX dimerization protein MLX HGNC:11645 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p KDM3B lysine demethylase 3B HGNC:1337 details
hsa-miR-92a-3p USP10 ubiquitin specific peptidase 10 HGNC:12608 details
hsa-miR-92a-3p TRMT61A tRNA methyltransferase 61A HGNC:23790 details
hsa-miR-92a-3p ENO1 enolase 1 HGNC:3350 details
hsa-miR-92a-3p PPP1R3G protein phosphatase 1 regulatory subunit 3G HGNC:14945 details
hsa-miR-92a-3p SNF8 SNF8 subunit of ESCRT-II HGNC:17028 details
hsa-miR-92a-3p EBP EBP cholestenol delta-isomerase HGNC:3133 details
hsa-miR-92a-3p NTPCR nucleoside-triphosphatase, cancer-related HGNC:28204 details
hsa-miR-92a-3p LRRC37A2 leucine rich repeat containing 37 member A2 HGNC:32404 details
hsa-miR-92a-3p TNRC18 trinucleotide repeat containing 18 HGNC:11962 details
hsa-miR-92a-3p SRPRB SRP receptor subunit beta HGNC:24085 details
hsa-miR-92a-3p RCC1 regulator of chromosome condensation 1 HGNC:1913 details
hsa-miR-92a-3p PFDN6 prefoldin subunit 6 HGNC:4926 details
hsa-miR-92a-3p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-92a-3p PBX2 PBX homeobox 2 HGNC:8633 details
hsa-miR-92a-3p MRPL9 mitochondrial ribosomal protein L9 HGNC:14277 details
hsa-miR-92a-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-92a-3p RPS15 ribosomal protein S15 HGNC:10388 details
hsa-miR-92a-3p SPTLC1 serine palmitoyltransferase long chain base subunit 1 HGNC:11277 details
hsa-miR-92a-3p HDAC1 histone deacetylase 1 HGNC:4852 details
hsa-miR-92a-3p MINK1 misshapen like kinase 1 HGNC:17565 details
hsa-miR-92a-3p HSP90B1 heat shock protein 90 beta family member 1 HGNC:12028 details
hsa-miR-92a-3p SKI SKI proto-oncogene HGNC:10896 details
hsa-miR-92a-3p NXN nucleoredoxin HGNC:18008 details
hsa-miR-92a-3p SACM1L SAC1 like phosphatidylinositide phosphatase HGNC:17059 details
hsa-miR-92a-3p TCOF1 treacle ribosome biogenesis factor 1 HGNC:11654 details
hsa-miR-92a-3p NFKB1 nuclear factor kappa B subunit 1 HGNC:7794 details
hsa-miR-92a-3p DDX17 DEAD-box helicase 17 HGNC:2740 details
hsa-miR-92a-3p PSMC3 proteasome 26S subunit, ATPase 3 HGNC:9549 details
hsa-miR-92a-3p HIP1R huntingtin interacting protein 1 related HGNC:18415 details
hsa-miR-92a-3p CCAR1 cell division cycle and apoptosis regulator 1 HGNC:24236 details
hsa-miR-92a-3p TUBA1C tubulin alpha 1c HGNC:20768 details
hsa-miR-92a-3p SNX9 sorting nexin 9 HGNC:14973 details
hsa-miR-92a-3p KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-92a-3p CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-92a-3p YBX3 Y-box binding protein 3 HGNC:2428 details
hsa-miR-92a-3p CHAF1A chromatin assembly factor 1 subunit A HGNC:1910 details
hsa-miR-92a-3p APOLD1 apolipoprotein L domain containing 1 HGNC:25268 details
hsa-miR-92a-3p PDIK1L PDLIM1 interacting kinase 1 like HGNC:18981 details
hsa-miR-92a-3p C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-92a-3p RANBP2 RAN binding protein 2 HGNC:9848 details
hsa-miR-92a-3p CDC25A cell division cycle 25A HGNC:1725 details
hsa-miR-92a-3p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-92a-3p TRIM28 tripartite motif containing 28 HGNC:16384 details
hsa-miR-92a-3p RPL3 ribosomal protein L3 HGNC:10332 details
hsa-miR-92a-3p CKB creatine kinase B HGNC:1991 details
hsa-miR-92a-3p SSX2IP SSX family member 2 interacting protein HGNC:16509 details
hsa-miR-92a-3p PDS5B PDS5 cohesin associated factor B HGNC:20418 details
hsa-miR-92a-3p WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-92a-3p CC2D2A coiled-coil and C2 domain containing 2A HGNC:29253 details
hsa-miR-92a-3p DHCR24 24-dehydrocholesterol reductase HGNC:2859 details
hsa-miR-92a-3p POR cytochrome p450 oxidoreductase HGNC:9208 details
hsa-miR-92a-3p EEF1A1 eukaryotic translation elongation factor 1 alpha 1 HGNC:3189 details
hsa-miR-92a-3p TANC2 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 HGNC:30212 details
hsa-miR-92a-3p AURKB aurora kinase B HGNC:11390 details
hsa-miR-92a-3p AIDA axin interactor, dorsalization associated HGNC:25761 details
hsa-miR-92a-3p DNAJA3 DnaJ heat shock protein family (Hsp40) member A3 HGNC:11808 details
hsa-miR-92a-3p PXN paxillin HGNC:9718 details
hsa-miR-92a-3p PARK7 Parkinsonism associated deglycase HGNC:16369 details
hsa-miR-92a-3p HDGF heparin binding growth factor HGNC:4856 details
hsa-miR-92a-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-92a-3p PTGFRN prostaglandin F2 receptor inhibitor HGNC:9601 details
hsa-miR-92a-3p COX18 cytochrome c oxidase assembly factor COX18 HGNC:26801 details
hsa-miR-92a-3p MYO19 myosin XIX HGNC:26234 details
hsa-miR-92a-3p ZNF276 zinc finger protein 276 HGNC:23330 details
hsa-miR-92a-3p AARS2 alanyl-tRNA synthetase 2, mitochondrial HGNC:21022 details
hsa-miR-92a-3p ETFA electron transfer flavoprotein subunit alpha HGNC:3481 details
hsa-miR-92a-3p SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-92a-3p TEX10 testis expressed 10 HGNC:25988 details
hsa-miR-92a-3p PFN1 profilin 1 HGNC:8881 details
hsa-miR-92a-3p EPHA7 EPH receptor A7 HGNC:3390 details
hsa-miR-92a-3p WDR6 WD repeat domain 6 HGNC:12758 details
hsa-miR-92a-3p UBAP2L ubiquitin associated protein 2 like HGNC:29877 details
hsa-miR-92a-3p TESK1 testis associated actin remodelling kinase 1 HGNC:11731 details
hsa-miR-92a-3p ZNF503 zinc finger protein 503 HGNC:23589 details
hsa-miR-92a-3p DENND5A DENN domain containing 5A HGNC:19344 details
hsa-miR-92a-3p PRR12 proline rich 12 HGNC:29217 details
hsa-miR-92a-3p BTAF1 B-TFIID TATA-box binding protein associated factor 1 HGNC:17307 details
hsa-miR-92a-3p details
hsa-miR-92a-3p MYO5C myosin VC HGNC:7604 details
hsa-miR-92a-3p MRPL3 mitochondrial ribosomal protein L3 HGNC:10379 details
hsa-miR-92a-3p CDKN3 cyclin dependent kinase inhibitor 3 HGNC:1791 details
hsa-miR-92a-3p RBBP7 RB binding protein 7, chromatin remodeling factor HGNC:9890 details
hsa-miR-92a-3p PHACTR4 phosphatase and actin regulator 4 HGNC:25793 details
hsa-miR-92a-3p NPM1 nucleophosmin 1 HGNC:7910 details
hsa-miR-92a-3p KMT2D lysine methyltransferase 2D HGNC:7133 details
hsa-miR-92a-3p PKN1 protein kinase N1 HGNC:9405 details
hsa-miR-92a-3p MDN1 midasin AAA ATPase 1 HGNC:18302 details
hsa-miR-92a-3p RPL18A ribosomal protein L18a HGNC:10311 details
hsa-miR-92a-3p ISM2 isthmin 2 HGNC:23176 details
hsa-miR-92a-3p QSOX2 quiescin sulfhydryl oxidase 2 HGNC:30249 details
hsa-miR-92a-3p SHMT2 serine hydroxymethyltransferase 2 HGNC:10852 details
hsa-miR-92a-3p RIOK1 RIO kinase 1 HGNC:18656 details
hsa-miR-92a-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-92a-3p IGSF1 immunoglobulin superfamily member 1 HGNC:5948 details
hsa-miR-92a-3p PPIB peptidylprolyl isomerase B HGNC:9255 details
hsa-miR-92a-3p PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-92a-3p CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 HGNC:21645 details
hsa-miR-92a-3p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-92a-3p STARD7 StAR related lipid transfer domain containing 7 HGNC:18063 details
hsa-miR-92a-3p DYNC1H1 dynein cytoplasmic 1 heavy chain 1 HGNC:2961 details
hsa-miR-92a-3p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-92a-3p SRSF5 serine and arginine rich splicing factor 5 HGNC:10787 details
hsa-miR-92a-3p KIFC1 kinesin family member C1 HGNC:6389 details
hsa-miR-92a-3p EARS2 glutamyl-tRNA synthetase 2, mitochondrial HGNC:29419 details
hsa-miR-92a-3p MCM3 minichromosome maintenance complex component 3 HGNC:6945 details
hsa-miR-92a-3p TUSC2 tumor suppressor 2, mitochondrial calcium regulator HGNC:17034 details
hsa-miR-92a-3p CLDND1 claudin domain containing 1 HGNC:1322 details
hsa-miR-92a-3p BRCC3 BRCA1/BRCA2-containing complex subunit 3 HGNC:24185 details
hsa-miR-92a-3p ACTR1A actin related protein 1A HGNC:167 details
hsa-miR-92a-3p DHX16 DEAH-box helicase 16 HGNC:2739 details
hsa-miR-92a-3p KIAA0100 KIAA0100 HGNC:28960 details
hsa-miR-92a-3p DUSP11 dual specificity phosphatase 11 HGNC:3066 details
hsa-miR-92a-3p ARRB1 arrestin beta 1 HGNC:711 details
hsa-miR-92a-3p ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 HGNC:799 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ITPR3 inositol 1,4,5-trisphosphate receptor type 3 HGNC:6182 details
hsa-miR-92a-3p AXIN1 axin 1 HGNC:903 details
hsa-miR-92a-3p RPL13A ribosomal protein L13a HGNC:10304 details
hsa-miR-92a-3p STX3 syntaxin 3 HGNC:11438 details
hsa-miR-92a-3p GLOD4 glyoxalase domain containing 4 HGNC:14111 details
hsa-miR-92a-3p U2AF2 U2 small nuclear RNA auxiliary factor 2 HGNC:23156 details
hsa-miR-92a-3p KCTD5 potassium channel tetramerization domain containing 5 HGNC:21423 details
hsa-miR-92a-3p GSTP1 glutathione S-transferase pi 1 HGNC:4638 details
hsa-miR-92a-3p GOT2 glutamic-oxaloacetic transaminase 2 HGNC:4433 details
hsa-miR-92a-3p COL18A1 collagen type XVIII alpha 1 chain HGNC:2195 details
hsa-miR-92a-3p NOC2L NOC2 like nucleolar associated transcriptional repressor HGNC:24517 details
hsa-miR-92a-3p USP31 ubiquitin specific peptidase 31 HGNC:20060 details
hsa-miR-92a-3p RBX1 ring-box 1 HGNC:9928 details
hsa-miR-92a-3p SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-92a-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-92a-3p CCDC86 coiled-coil domain containing 86 HGNC:28359 details
hsa-miR-92a-3p P4HB prolyl 4-hydroxylase subunit beta HGNC:8548 details
hsa-miR-92a-3p LMBR1L limb development membrane protein 1 like HGNC:18268 details
hsa-miR-92a-3p CDK9 cyclin dependent kinase 9 HGNC:1780 details
hsa-miR-92a-3p BCL9L BCL9 like HGNC:23688 details
hsa-miR-92a-3p TUFM Tu translation elongation factor, mitochondrial HGNC:12420 details
hsa-miR-92a-3p RPL15 ribosomal protein L15 HGNC:10306 details
hsa-miR-92a-3p ALMS1 ALMS1 centrosome and basal body associated protein HGNC:428 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CUL5 cullin 5 HGNC:2556 details
hsa-miR-92a-3p KPNB1 karyopherin subunit beta 1 HGNC:6400 details
hsa-miR-92a-3p MYO1C myosin IC HGNC:7597 details
hsa-miR-92a-3p TLR10 toll like receptor 10 HGNC:15634 details
hsa-miR-92a-3p COX4I1 cytochrome c oxidase subunit 4I1 HGNC:2265 details
hsa-miR-92a-3p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-92a-3p CTNNBL1 catenin beta like 1 HGNC:15879 details
hsa-miR-92a-3p YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta HGNC:12854 details
hsa-miR-92a-3p BRD2 bromodomain containing 2 HGNC:1103 details
hsa-miR-92a-3p PFKM phosphofructokinase, muscle HGNC:8877 details
hsa-miR-92a-3p PPP6C protein phosphatase 6 catalytic subunit HGNC:9323 details
hsa-miR-92a-3p NFE2L1 nuclear factor, erythroid 2 like 1 HGNC:7781 details
hsa-miR-92a-3p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-92a-3p KIAA1671 KIAA1671 HGNC:29345 details
hsa-miR-92a-3p details
hsa-miR-92a-3p R3HDM4 R3H domain containing 4 HGNC:28270 details
hsa-miR-92a-3p SURF4 surfeit 4 HGNC:11476 details
hsa-miR-92a-3p METTL16 methyltransferase 16, N6-methyladenosine HGNC:28484 details
hsa-miR-92a-3p ZNF420 zinc finger protein 420 HGNC:20649 details
hsa-miR-92a-3p ARPC2 actin related protein 2/3 complex subunit 2 HGNC:705 details
hsa-miR-92a-3p RRP9 ribosomal RNA processing 9, U3 small nucleolar RNA binding protein HGNC:16829 details
hsa-miR-92a-3p HEATR1 HEAT repeat containing 1 HGNC:25517 details
hsa-miR-92a-3p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-92a-3p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-92a-3p MACF1 microtubule actin crosslinking factor 1 HGNC:13664 details
hsa-miR-92a-3p HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-92a-3p VCPIP1 valosin containing protein interacting protein 1 HGNC:30897 details
hsa-miR-92a-3p CORO7 coronin 7 HGNC:26161 details
hsa-miR-92a-3p UNC13B unc-13 homolog B HGNC:12566 details
hsa-miR-92a-3p PSMD3 proteasome 26S subunit, non-ATPase 3 HGNC:9560 details
hsa-miR-92a-3p DDAH1 dimethylarginine dimethylaminohydrolase 1 HGNC:2715 details
hsa-miR-92a-3p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-92a-3p HS3ST3A1 heparan sulfate-glucosamine 3-sulfotransferase 3A1 HGNC:5196 details
hsa-miR-92a-3p ALKBH5 alkB homolog 5, RNA demethylase HGNC:25996 details
hsa-miR-92a-3p TKT transketolase HGNC:11834 details
hsa-miR-92a-3p DLX6 distal-less homeobox 6 HGNC:2919 details
hsa-miR-92a-3p OSBPL2 oxysterol binding protein like 2 HGNC:15761 details
hsa-miR-92a-3p CDC37 cell division cycle 37, HSP90 cochaperone HGNC:1735 details
hsa-miR-92a-3p CLTC clathrin heavy chain HGNC:2092 details
hsa-miR-92a-3p TUT1 terminal uridylyl transferase 1, U6 snRNA-specific HGNC:26184 details
hsa-miR-92a-3p GLO1 glyoxalase I HGNC:4323 details
hsa-miR-92a-3p ZC3H18 zinc finger CCCH-type containing 18 HGNC:25091 details
hsa-miR-92a-3p HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 HGNC:5007 details
hsa-miR-92a-3p EIF3K eukaryotic translation initiation factor 3 subunit K HGNC:24656 details
hsa-miR-92a-3p DCTD dCMP deaminase HGNC:2710 details
hsa-miR-92a-3p MYL6 myosin light chain 6 HGNC:7587 details
hsa-miR-92a-3p FAM135A family with sequence similarity 135 member A HGNC:21084 details
hsa-miR-92a-3p ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-92a-3p EDC4 enhancer of mRNA decapping 4 HGNC:17157 details
hsa-miR-92a-3p SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 HGNC:11107 details
hsa-miR-92a-3p PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-92a-3p ZFHX4 zinc finger homeobox 4 HGNC:30939 details
hsa-miR-92a-3p HOGA1 4-hydroxy-2-oxoglutarate aldolase 1 HGNC:25155 details
hsa-miR-92a-3p IL17RA interleukin 17 receptor A HGNC:5985 details
hsa-miR-92a-3p LXN latexin HGNC:13347 details
hsa-miR-92a-3p PDCD6IP programmed cell death 6 interacting protein HGNC:8766 details
hsa-miR-92a-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-92a-3p RPS14 ribosomal protein S14 HGNC:10387 details
hsa-miR-92a-3p ABCA3 ATP binding cassette subfamily A member 3 HGNC:33 details
hsa-miR-92a-3p HOXA5 homeobox A5 HGNC:5106 details
hsa-miR-92a-3p FBXO45 F-box protein 45 HGNC:29148 details
hsa-miR-92a-3p ILF2 interleukin enhancer binding factor 2 HGNC:6037 details
hsa-miR-92a-3p details
hsa-miR-92a-3p KIF1A kinesin family member 1A HGNC:888 details
hsa-miR-92a-3p HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-92a-3p BAG6 BAG cochaperone 6 HGNC:13919 details
hsa-miR-92a-3p SYNPR synaptoporin HGNC:16507 details
hsa-miR-92a-3p PPIL1 peptidylprolyl isomerase like 1 HGNC:9260 details
hsa-miR-92a-3p PYGL glycogen phosphorylase L HGNC:9725 details
hsa-miR-92a-3p NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-92a-3p HSP90AB1 heat shock protein 90 alpha family class B member 1 HGNC:5258 details
hsa-miR-92a-3p DIDO1 death inducer-obliterator 1 HGNC:2680 details
hsa-miR-92a-3p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-92a-3p PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-92a-3p ANKS1A ankyrin repeat and sterile alpha motif domain containing 1A HGNC:20961 details
hsa-miR-92a-3p CBS cystathionine beta-synthase HGNC:1550 details
hsa-miR-92a-3p DDX5 DEAD-box helicase 5 HGNC:2746 details
hsa-miR-92a-3p SERINC1 serine incorporator 1 HGNC:13464 details
hsa-miR-92a-3p GNG7 G protein subunit gamma 7 HGNC:4410 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ERAP1 endoplasmic reticulum aminopeptidase 1 HGNC:18173 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-92a-3p COL4A2 collagen type IV alpha 2 chain HGNC:2203 details
hsa-miR-92a-3p CBX2 chromobox 2 HGNC:1552 details
hsa-miR-92a-3p EPHA4 EPH receptor A4 HGNC:3388 details
hsa-miR-92a-3p COPG1 COPI coat complex subunit gamma 1 HGNC:2236 details
hsa-miR-92a-3p DHX8 DEAH-box helicase 8 HGNC:2749 details
hsa-miR-92a-3p TUBB4B tubulin beta 4B class IVb HGNC:20771 details
hsa-miR-92a-3p TMEM161A transmembrane protein 161A HGNC:26020 details
hsa-miR-92a-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-92a-3p GOLGA3 golgin A3 HGNC:4426 details
hsa-miR-92a-3p ZNF622 zinc finger protein 622 HGNC:30958 details
hsa-miR-92a-3p FAM168B family with sequence similarity 168 member B HGNC:27016 details
hsa-miR-92a-3p KANK2 KN motif and ankyrin repeat domains 2 HGNC:29300 details
hsa-miR-92a-3p SIN3A SIN3 transcription regulator family member A HGNC:19353 details
hsa-miR-92a-3p MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-92a-3p MAP4 microtubule associated protein 4 HGNC:6862 details
hsa-miR-92a-3p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-92a-3p CBFB core-binding factor subunit beta HGNC:1539 details
hsa-miR-92a-3p CTLA4 cytotoxic T-lymphocyte associated protein 4 HGNC:2505 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SIN3B SIN3 transcription regulator family member B HGNC:19354 details
hsa-miR-92a-3p NPC2 NPC intracellular cholesterol transporter 2 HGNC:14537 details
hsa-miR-92a-3p POLR2I RNA polymerase II subunit I HGNC:9196 details
hsa-miR-92a-3p details
hsa-miR-92a-3p RNF123 ring finger protein 123 HGNC:21148 details
hsa-miR-92a-3p WDR18 WD repeat domain 18 HGNC:17956 details
hsa-miR-92a-3p RPS28 ribosomal protein S28 HGNC:10418 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-92a-3p EPB41L3 erythrocyte membrane protein band 4.1 like 3 HGNC:3380 details
hsa-miR-92a-3p MAPRE1 microtubule associated protein RP/EB family member 1 HGNC:6890 details
hsa-miR-92a-3p NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-92a-3p AHCYL1 adenosylhomocysteinase like 1 HGNC:344 details
hsa-miR-92a-3p KLC2 kinesin light chain 2 HGNC:20716 details
hsa-miR-92a-3p ZBTB22 zinc finger and BTB domain containing 22 HGNC:13085 details
hsa-miR-92a-3p TSR1 TSR1 ribosome maturation factor HGNC:25542 details
hsa-miR-92a-3p NUP155 nucleoporin 155 HGNC:8063 details
hsa-miR-92a-3p details
hsa-miR-92a-3p DDX39A DExD-box helicase 39A HGNC:17821 details
hsa-miR-92a-3p CAMTA2 calmodulin binding transcription activator 2 HGNC:18807 details
hsa-miR-92a-3p RNF40 ring finger protein 40 HGNC:16867 details
hsa-miR-92a-3p NCAPH non-SMC condensin I complex subunit H HGNC:1112 details
hsa-miR-92a-3p MYO1D myosin ID HGNC:7598 details
hsa-miR-92a-3p APOBEC3C apolipoprotein B mRNA editing enzyme catalytic subunit 3C HGNC:17353 details
hsa-miR-92a-3p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-92a-3p SARS2 seryl-tRNA synthetase 2, mitochondrial HGNC:17697 details
hsa-miR-92a-3p details
hsa-miR-92a-3p RAB11A RAB11A, member RAS oncogene family HGNC:9760 details
hsa-miR-92a-3p EIF4B eukaryotic translation initiation factor 4B HGNC:3285 details
hsa-miR-92a-3p OTUD6A OTU deubiquitinase 6A HGNC:32312 details
hsa-miR-92a-3p CERS1 ceramide synthase 1 HGNC:14253 details
hsa-miR-92a-3p ENOPH1 enolase-phosphatase 1 HGNC:24599 details
hsa-miR-92a-3p CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase HGNC:1424 details
hsa-miR-92a-3p KIAA1549 KIAA1549 HGNC:22219 details
hsa-miR-92a-3p CELSR1 cadherin EGF LAG seven-pass G-type receptor 1 HGNC:1850 details
hsa-miR-92a-3p PSMB6 proteasome 20S subunit beta 6 HGNC:9543 details
hsa-miR-92a-3p IRAK1 interleukin 1 receptor associated kinase 1 HGNC:6112 details
hsa-miR-92a-3p ORC5 origin recognition complex subunit 5 HGNC:8491 details
hsa-miR-92a-3p STAT3 signal transducer and activator of transcription 3 HGNC:11364 details
hsa-miR-92a-3p PKDCC protein kinase domain containing, cytoplasmic HGNC:25123 details
hsa-miR-92a-3p HNRNPM heterogeneous nuclear ribonucleoprotein M HGNC:5046 details
hsa-miR-92a-3p AP2B1 adaptor related protein complex 2 subunit beta 1 HGNC:563 details
hsa-miR-92a-3p FASN fatty acid synthase HGNC:3594 details
hsa-miR-92a-3p SMC3 structural maintenance of chromosomes 3 HGNC:2468 details
hsa-miR-92a-3p RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-92a-3p ZNF84 zinc finger protein 84 HGNC:13159 details
hsa-miR-92a-3p CCNE1 cyclin E1 HGNC:1589 details
hsa-miR-92a-3p RTCB RNA 2',3'-cyclic phosphate and 5'-OH ligase HGNC:26935 details
hsa-miR-92a-3p TBL1X transducin beta like 1 X-linked HGNC:11585 details
hsa-miR-92a-3p details
hsa-miR-92a-3p TGFBRAP1 transforming growth factor beta receptor associated protein 1 HGNC:16836 details
hsa-miR-92a-3p TRAP1 TNF receptor associated protein 1 HGNC:16264 details
hsa-miR-92a-3p ACLY ATP citrate lyase HGNC:115 details
hsa-miR-92a-3p GTF3C1 general transcription factor IIIC subunit 1 HGNC:4664 details
hsa-miR-92a-3p SLC25A44 solute carrier family 25 member 44 HGNC:29036 details
hsa-miR-92a-3p SMAP2 small ArfGAP2 HGNC:25082 details
hsa-miR-92a-3p DDX56 DEAD-box helicase 56 HGNC:18193 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CCDC57 coiled-coil domain containing 57 HGNC:27564 details
hsa-miR-92a-3p SLC4A2 solute carrier family 4 member 2 HGNC:11028 details
hsa-miR-92a-3p DYNLL1 dynein light chain LC8-type 1 HGNC:15476 details
hsa-miR-92a-3p STEAP3 STEAP3 metalloreductase HGNC:24592 details
hsa-miR-92a-3p GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 HGNC:16064 details
hsa-miR-92a-3p MYH9 myosin heavy chain 9 HGNC:7579 details
hsa-miR-92a-3p RPLP1 ribosomal protein lateral stalk subunit P1 HGNC:10372 details
hsa-miR-92a-3p AUP1 AUP1 lipid droplet regulating VLDL assembly factor HGNC:891 details
hsa-miR-92a-3p MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-92a-3p PSMG3 proteasome assembly chaperone 3 HGNC:22420 details
hsa-miR-92a-3p CDC20 cell division cycle 20 HGNC:1723 details
hsa-miR-92a-3p AK2 adenylate kinase 2 HGNC:362 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p CKMT1B creatine kinase, mitochondrial 1B HGNC:1995 details
hsa-miR-92a-3p WDR19 WD repeat domain 19 HGNC:18340 details
hsa-miR-92a-3p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-92a-3p TMEM160 transmembrane protein 160 HGNC:26042 details
hsa-miR-92a-3p KPNA3 karyopherin subunit alpha 3 HGNC:6396 details
hsa-miR-92a-3p SCYL2 SCY1 like pseudokinase 2 HGNC:19286 details
hsa-miR-92a-3p ATG16L1 autophagy related 16 like 1 HGNC:21498 details
hsa-miR-92a-3p RABGGTB Rab geranylgeranyltransferase subunit beta HGNC:9796 details
hsa-miR-92a-3p KIF18B kinesin family member 18B HGNC:27102 details
hsa-miR-92a-3p NLE1 notchless homolog 1 HGNC:19889 details
hsa-miR-92a-3p DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 HGNC:27030 details
hsa-miR-92a-3p TUBB tubulin beta class I HGNC:20778 details
hsa-miR-92a-3p ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 HGNC:29205 details
hsa-miR-92a-3p ACTB actin beta HGNC:132 details
hsa-miR-92a-3p ZMYND8 zinc finger MYND-type containing 8 HGNC:9397 details
hsa-miR-92a-3p SLC12A4 solute carrier family 12 member 4 HGNC:10913 details
hsa-miR-92a-3p EIF2S3 eukaryotic translation initiation factor 2 subunit gamma HGNC:3267 details
hsa-miR-92a-3p STAG1 stromal antigen 1 HGNC:11354 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ATP11A ATPase phospholipid transporting 11A HGNC:13552 details
hsa-miR-92a-3p PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-92a-3p CDV3 CDV3 homolog HGNC:26928 details
hsa-miR-92a-3p EIF3G eukaryotic translation initiation factor 3 subunit G HGNC:3274 details
hsa-miR-92a-3p CD276 CD276 molecule HGNC:19137 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-92a-3p EHBP1 EH domain binding protein 1 HGNC:29144 details
hsa-miR-92a-3p GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-92a-3p NSMAF neutral sphingomyelinase activation associated factor HGNC:8017 details
hsa-miR-92a-3p PTPN13 protein tyrosine phosphatase non-receptor type 13 HGNC:9646 details
hsa-miR-92a-3p CBFA2T2 CBFA2/RUNX1 partner transcriptional co-repressor 2 HGNC:1536 details
hsa-miR-92a-3p RPL8 ribosomal protein L8 HGNC:10368 details
hsa-miR-92a-3p POP4 POP4 homolog, ribonuclease P/MRP subunit HGNC:30081 details
hsa-miR-92a-3p FNIP1 folliculin interacting protein 1 HGNC:29418 details
hsa-miR-92a-3p OGT O-linked N-acetylglucosamine (GlcNAc) transferase HGNC:8127 details
hsa-miR-92a-3p TMEM184B transmembrane protein 184B HGNC:1310 details
hsa-miR-92a-3p CLSPN claspin HGNC:19715 details
hsa-miR-92a-3p EGLN2 egl-9 family hypoxia inducible factor 2 HGNC:14660 details
hsa-miR-92a-3p ARHGEF25 Rho guanine nucleotide exchange factor 25 HGNC:30275 details
hsa-miR-92a-3p TTLL7 tubulin tyrosine ligase like 7 HGNC:26242 details
hsa-miR-92a-3p TPM3 tropomyosin 3 HGNC:12012 details
hsa-miR-92a-3p PDLIM1 PDZ and LIM domain 1 HGNC:2067 details
hsa-miR-92a-3p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-92a-3p RHOT2 ras homolog family member T2 HGNC:21169 details
hsa-miR-92a-3p CLIC1 chloride intracellular channel 1 HGNC:2062 details
hsa-miR-92a-3p ARID1B AT-rich interaction domain 1B HGNC:18040 details
hsa-miR-92a-3p details
hsa-miR-92a-3p KANSL3 KAT8 regulatory NSL complex subunit 3 HGNC:25473 details
hsa-miR-92a-3p ATP13A1 ATPase 13A1 HGNC:24215 details
hsa-miR-92a-3p OGFR opioid growth factor receptor HGNC:15768 details
hsa-miR-92a-3p BTF3 basic transcription factor 3 HGNC:1125 details
hsa-miR-92a-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-92a-3p WDR83OS WD repeat domain 83 opposite strand HGNC:30203 details
hsa-miR-92a-3p LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-92a-3p RPS3A ribosomal protein S3A HGNC:10421 details
hsa-miR-92a-3p RRBP1 ribosome binding protein 1 HGNC:10448 details
hsa-miR-92a-3p TAX1BP3 Tax1 binding protein 3 HGNC:30684 details
hsa-miR-92a-3p HIPK1 homeodomain interacting protein kinase 1 HGNC:19006 details
hsa-miR-92a-3p TGFA transforming growth factor alpha HGNC:11765 details
hsa-miR-92a-3p PSMD2 proteasome 26S subunit ubiquitin receptor, non-ATPase 2 HGNC:9559 details
hsa-miR-92a-3p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-92a-3p PEBP1 phosphatidylethanolamine binding protein 1 HGNC:8630 details
hsa-miR-92a-3p MEN1 menin 1 HGNC:7010 details
hsa-miR-92a-3p LTBP1 latent transforming growth factor beta binding protein 1 HGNC:6714 details
hsa-miR-92a-3p GAPDH glyceraldehyde-3-phosphate dehydrogenase HGNC:4141 details
hsa-miR-92a-3p DDRGK1 DDRGK domain containing 1 HGNC:16110 details
hsa-miR-92a-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-92a-3p CRTC2 CREB regulated transcription coactivator 2 HGNC:27301 details
hsa-miR-92a-3p ZFYVE16 zinc finger FYVE-type containing 16 HGNC:20756 details
hsa-miR-92a-3p WDR37 WD repeat domain 37 HGNC:31406 details
hsa-miR-92a-3p HSPH1 heat shock protein family H (Hsp110) member 1 HGNC:16969 details
hsa-miR-92a-3p SUPT5H SPT5 homolog, DSIF elongation factor subunit HGNC:11469 details
hsa-miR-92a-3p PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-92a-3p FAM189B family with sequence similarity 189 member B HGNC:1233 details
hsa-miR-92a-3p ATXN2L ataxin 2 like HGNC:31326 details
hsa-miR-92a-3p RAVER1 ribonucleoprotein, PTB binding 1 HGNC:30296 details
hsa-miR-92a-3p STK25 serine/threonine kinase 25 HGNC:11404 details
hsa-miR-92a-3p FLYWCH1 FLYWCH-type zinc finger 1 HGNC:25404 details
hsa-miR-92a-3p TRAPPC11 trafficking protein particle complex subunit 11 HGNC:25751 details
hsa-miR-92a-3p RRM1 ribonucleotide reductase catalytic subunit M1 HGNC:10451 details
hsa-miR-92a-3p NRXN3 neurexin 3 HGNC:8010 details
hsa-miR-92a-3p PPP6R2 protein phosphatase 6 regulatory subunit 2 HGNC:19253 details
hsa-miR-92a-3p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-92a-3p GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 HGNC:19980 details
hsa-miR-92a-3p CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-92a-3p ACACA acetyl-CoA carboxylase alpha HGNC:84 details
hsa-miR-92a-3p MAP3K6 mitogen-activated protein kinase kinase kinase 6 HGNC:6858 details
hsa-miR-92a-3p MTMR14 myotubularin related protein 14 HGNC:26190 details
hsa-miR-92a-3p RXRB retinoid X receptor beta HGNC:10478 details
hsa-miR-92a-3p RBM10 RNA binding motif protein 10 HGNC:9896 details
hsa-miR-92a-3p COL4A1 collagen type IV alpha 1 chain HGNC:2202 details
hsa-miR-92a-3p KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-92a-3p SETD1B SET domain containing 1B, histone lysine methyltransferase HGNC:29187 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ME2 malic enzyme 2 HGNC:6984 details
hsa-miR-92a-3p PLCG1 phospholipase C gamma 1 HGNC:9065 details
hsa-miR-92a-3p CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 HGNC:17840 details
hsa-miR-92a-3p IPO5 importin 5 HGNC:6402 details
hsa-miR-92a-3p details
hsa-miR-92a-3p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-92a-3p details
hsa-miR-92a-3p HES1 hes family bHLH transcription factor 1 HGNC:5192 details
hsa-miR-92a-3p POLR3A RNA polymerase III subunit A HGNC:30074 details
hsa-miR-92a-3p SV2A synaptic vesicle glycoprotein 2A HGNC:20566 details
hsa-miR-92a-3p SHPRH SNF2 histone linker PHD RING helicase HGNC:19336 details
hsa-miR-92a-3p HSPBP1 HSPA (Hsp70) binding protein 1 HGNC:24989 details
hsa-miR-92a-3p CTTN cortactin HGNC:3338 details
hsa-miR-92a-3p FAM136A family with sequence similarity 136 member A HGNC:25911 details
hsa-miR-92a-3p TTC32 tetratricopeptide repeat domain 32 HGNC:32954 details
hsa-miR-92a-3p NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 HGNC:7691 details
hsa-miR-92a-3p GPX3 glutathione peroxidase 3 HGNC:4555 details
hsa-miR-92a-3p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-92a-3p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-92a-3p GAK cyclin G associated kinase HGNC:4113 details
hsa-miR-92a-3p TTC37 tetratricopeptide repeat domain 37 HGNC:23639 details
hsa-miR-92a-3p SREBF2 sterol regulatory element binding transcription factor 2 HGNC:11290 details
hsa-miR-92a-3p UGDH UDP-glucose 6-dehydrogenase HGNC:12525 details
hsa-miR-92a-3p RPS5 ribosomal protein S5 HGNC:10426 details
hsa-miR-92a-3p SMAD7 SMAD family member 7 HGNC:6773 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SUCLG1 succinate-CoA ligase GDP/ADP-forming subunit alpha HGNC:11449 details
hsa-miR-92a-3p HLA-E major histocompatibility complex, class I, E HGNC:4962 details
hsa-miR-92a-3p JAG2 jagged canonical Notch ligand 2 HGNC:6189 details
hsa-miR-92a-3p SCARB2 scavenger receptor class B member 2 HGNC:1665 details
hsa-miR-92a-3p details
hsa-miR-92a-3p MLF2 myeloid leukemia factor 2 HGNC:7126 details
hsa-miR-92a-3p PDXK pyridoxal kinase HGNC:8819 details
hsa-miR-92a-3p TECPR2 tectonin beta-propeller repeat containing 2 HGNC:19957 details
hsa-miR-92a-3p ADRM1 ADRM1 26S proteasome ubiquitin receptor HGNC:15759 details
hsa-miR-92a-3p TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-92a-3p TUBGCP2 tubulin gamma complex associated protein 2 HGNC:18599 details
hsa-miR-92a-3p CD2BP2 CD2 cytoplasmic tail binding protein 2 HGNC:1656 details
hsa-miR-92a-3p MTHFSD methenyltetrahydrofolate synthetase domain containing HGNC:25778 details
hsa-miR-92a-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-92a-3p NHSL1 NHS like 1 HGNC:21021 details
hsa-miR-92a-3p TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-92a-3p PWP2 PWP2 small subunit processome component HGNC:9711 details
hsa-miR-92a-3p RAB8A RAB8A, member RAS oncogene family HGNC:7007 details
hsa-miR-92a-3p PSMA4 proteasome 20S subunit alpha 4 HGNC:9533 details
hsa-miR-92a-3p FLNB filamin B HGNC:3755 details
hsa-miR-92a-3p PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 HGNC:30483 details
hsa-miR-92a-3p ZNF703 zinc finger protein 703 HGNC:25883 details
hsa-miR-92a-3p ASS1 argininosuccinate synthase 1 HGNC:758 details
hsa-miR-92a-3p CBR1 carbonyl reductase 1 HGNC:1548 details
hsa-miR-92a-3p HEATR6 HEAT repeat containing 6 HGNC:24076 details
hsa-miR-92a-3p DEDD2 death effector domain containing 2 HGNC:24450 details
hsa-miR-92a-3p STMN3 stathmin 3 HGNC:15926 details
hsa-miR-92a-3p KIF20A kinesin family member 20A HGNC:9787 details
hsa-miR-92a-3p TCHP trichoplein keratin filament binding HGNC:28135 details
hsa-miR-92a-3p PTS 6-pyruvoyltetrahydropterin synthase HGNC:9689 details
hsa-miR-92a-3p METTL2A methyltransferase 2A, methylcytidine HGNC:25755 details
hsa-miR-92a-3p NOTCH2 notch receptor 2 HGNC:7882 details
hsa-miR-92a-3p NDRG3 NDRG family member 3 HGNC:14462 details
hsa-miR-92a-3p NTHL1 nth like DNA glycosylase 1 HGNC:8028 details
hsa-miR-92a-3p UBE2R2 ubiquitin conjugating enzyme E2 R2 HGNC:19907 details
hsa-miR-92a-3p METTL2B methyltransferase 2B, methylcytidine HGNC:18272 details
hsa-miR-92a-3p AGO4 argonaute RISC component 4 HGNC:18424 details
hsa-miR-92a-3p TRAF3IP1 TRAF3 interacting protein 1 HGNC:17861 details
hsa-miR-92a-3p NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 HGNC:7719 details
hsa-miR-92a-3p DNPH1 2'-deoxynucleoside 5'-phosphate N-hydrolase 1 HGNC:21218 details
hsa-miR-92a-3p GTF3C2 general transcription factor IIIC subunit 2 HGNC:4665 details
hsa-miR-92a-3p details
hsa-miR-92a-3p EIF6 eukaryotic translation initiation factor 6 HGNC:6159 details
hsa-miR-92a-3p SF3A3 splicing factor 3a subunit 3 HGNC:10767 details
hsa-miR-92a-3p TLE3 TLE family member 3, transcriptional corepressor HGNC:11839 details
hsa-miR-92a-3p IFT172 intraflagellar transport 172 HGNC:30391 details
hsa-miR-92a-3p GATAD2A GATA zinc finger domain containing 2A HGNC:29989 details
hsa-miR-92a-3p FLNA filamin A HGNC:3754 details
hsa-miR-92a-3p MYEF2 myelin expression factor 2 HGNC:17940 details
hsa-miR-92a-3p TTC7B tetratricopeptide repeat domain 7B HGNC:19858 details
hsa-miR-92a-3p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-92a-3p ESD esterase D HGNC:3465 details
hsa-miR-92a-3p GBP4 guanylate binding protein 4 HGNC:20480 details
hsa-miR-92a-3p RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-92a-3p PIGS phosphatidylinositol glycan anchor biosynthesis class S HGNC:14937 details
hsa-miR-92a-3p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-92a-3p SMC1A structural maintenance of chromosomes 1A HGNC:11111 details
hsa-miR-92a-3p ARHGDIA Rho GDP dissociation inhibitor alpha HGNC:678 details
hsa-miR-92a-3p RIC8A RIC8 guanine nucleotide exchange factor A HGNC:29550 details
hsa-miR-92a-3p WDR1 WD repeat domain 1 HGNC:12754 details
hsa-miR-92a-3p BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-92a-3p TONSL tonsoku like, DNA repair protein HGNC:7801 details
hsa-miR-92a-3p HBB hemoglobin subunit beta HGNC:4827 details
hsa-miR-92a-3p FBXL19 F-box and leucine rich repeat protein 19 HGNC:25300 details
hsa-miR-92a-3p CES2 carboxylesterase 2 HGNC:1864 details
hsa-miR-92a-3p IQGAP1 IQ motif containing GTPase activating protein 1 HGNC:6110 details
hsa-miR-92a-3p UBE4B ubiquitination factor E4B HGNC:12500 details
hsa-miR-92a-3p FKBPL FKBP prolyl isomerase like HGNC:13949 details
hsa-miR-92a-3p BAHCC1 BAH domain and coiled-coil containing 1 HGNC:29279 details
hsa-miR-92a-3p MAFG MAF bZIP transcription factor G HGNC:6781 details
hsa-miR-92a-3p SCAF8 SR-related CTD associated factor 8 HGNC:20959 details
hsa-miR-92a-3p FKBP4 FKBP prolyl isomerase 4 HGNC:3720 details
hsa-miR-92a-3p GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 HGNC:28804 details
hsa-miR-92a-3p YIPF5 Yip1 domain family member 5 HGNC:24877 details
hsa-miR-92a-3p SCLY selenocysteine lyase HGNC:18161 details
hsa-miR-92a-3p ARCN1 archain 1 HGNC:649 details
hsa-miR-92a-3p NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 HGNC:7688 details
hsa-miR-92a-3p MPG N-methylpurine DNA glycosylase HGNC:7211 details
hsa-miR-92a-3p SYNJ1 synaptojanin 1 HGNC:11503 details
hsa-miR-92a-3p MCCD1 mitochondrial coiled-coil domain 1 HGNC:20668 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p MYO6 myosin VI HGNC:7605 details
hsa-miR-92a-3p ZNF174 zinc finger protein 174 HGNC:12963 details
hsa-miR-92a-3p SIPA1L1 signal induced proliferation associated 1 like 1 HGNC:20284 details
hsa-miR-92a-3p ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-92a-3p MTFP1 mitochondrial fission process 1 HGNC:26945 details
hsa-miR-92a-3p ZNF629 zinc finger protein 629 HGNC:29008 details
hsa-miR-92a-3p ELF4 E74 like ETS transcription factor 4 HGNC:3319 details
hsa-miR-92a-3p ZC3HAV1 zinc finger CCCH-type containing, antiviral 1 HGNC:23721 details
hsa-miR-92a-3p PITRM1 pitrilysin metallopeptidase 1 HGNC:17663 details
hsa-miR-92a-3p XPO1 exportin 1 HGNC:12825 details
hsa-miR-92a-3p MAU2 MAU2 sister chromatid cohesion factor HGNC:29140 details
hsa-miR-92a-3p RCN3 reticulocalbin 3 HGNC:21145 details
hsa-miR-92a-3p CACFD1 calcium channel flower domain containing 1 HGNC:1365 details
hsa-miR-92a-3p EIF2AK1 eukaryotic translation initiation factor 2 alpha kinase 1 HGNC:24921 details
hsa-miR-92a-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-92a-3p CYB5R3 cytochrome b5 reductase 3 HGNC:2873 details
hsa-miR-92a-3p AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-92a-3p KAT2A lysine acetyltransferase 2A HGNC:4201 details
hsa-miR-92a-3p AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-92a-3p ZNF282 zinc finger protein 282 HGNC:13076 details
hsa-miR-92a-3p RAB36 RAB36, member RAS oncogene family HGNC:9775 details
hsa-miR-92a-3p LSM7 LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated HGNC:20470 details
hsa-miR-92a-3p PSMA7 proteasome 20S subunit alpha 7 HGNC:9536 details
hsa-miR-92a-3p NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 HGNC:7696 details
hsa-miR-92a-3p TMCC3 transmembrane and coiled-coil domain family 3 HGNC:29199 details
hsa-miR-92a-3p C12orf57 chromosome 12 open reading frame 57 HGNC:29521 details
hsa-miR-92a-3p URB2 URB2 ribosome biogenesis homolog HGNC:28967 details
hsa-miR-92a-3p SNRNP70 small nuclear ribonucleoprotein U1 subunit 70 HGNC:11150 details
hsa-miR-92a-3p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-92a-3p SLC3A2 solute carrier family 3 member 2 HGNC:11026 details
hsa-miR-92a-3p details
hsa-miR-92a-3p VANGL2 VANGL planar cell polarity protein 2 HGNC:15511 details
hsa-miR-92a-3p RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase HGNC:24821 details
hsa-miR-92a-3p SNRPE small nuclear ribonucleoprotein polypeptide E HGNC:11161 details
hsa-miR-92a-3p GABARAPL2 GABA type A receptor associated protein like 2 HGNC:13291 details
hsa-miR-92a-3p FKBP8 FKBP prolyl isomerase 8 HGNC:3724 details
hsa-miR-92a-3p TSPAN18 tetraspanin 18 HGNC:20660 details
hsa-miR-92a-3p KCNC1 potassium voltage-gated channel subfamily C member 1 HGNC:6233 details
hsa-miR-92a-3p BRF1 BRF1 RNA polymerase III transcription initiation factor subunit HGNC:11551 details
hsa-miR-92a-3p ATXN7 ataxin 7 HGNC:10560 details
hsa-miR-92a-3p CDC42SE1 CDC42 small effector 1 HGNC:17719 details
hsa-miR-92a-3p PRKCA protein kinase C alpha HGNC:9393 details
hsa-miR-92a-3p RPAIN RPA interacting protein HGNC:28641 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CARM1 coactivator associated arginine methyltransferase 1 HGNC:23393 details
hsa-miR-92a-3p MYBBP1A MYB binding protein 1a HGNC:7546 details
hsa-miR-92a-3p AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-92a-3p SLC7A1 solute carrier family 7 member 1 HGNC:11057 details
hsa-miR-92a-3p TTC5 tetratricopeptide repeat domain 5 HGNC:19274 details
hsa-miR-92a-3p PRC1 protein regulator of cytokinesis 1 HGNC:9341 details
hsa-miR-92a-3p ORC6 origin recognition complex subunit 6 HGNC:17151 details
hsa-miR-92a-3p BTBD7 BTB domain containing 7 HGNC:18269 details
hsa-miR-92a-3p DNAJB12 DnaJ heat shock protein family (Hsp40) member B12 HGNC:14891 details
hsa-miR-92a-3p TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-92a-3p LRIG1 leucine rich repeats and immunoglobulin like domains 1 HGNC:17360 details
hsa-miR-92a-3p KDSR 3-ketodihydrosphingosine reductase HGNC:4021 details
hsa-miR-92a-3p PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 HGNC:26462 details
hsa-miR-92a-3p CHN1 chimerin 1 HGNC:1943 details
hsa-miR-92a-3p PABPN1 poly(A) binding protein nuclear 1 HGNC:8565 details
hsa-miR-92a-3p PRPF8 pre-mRNA processing factor 8 HGNC:17340 details
hsa-miR-92a-3p BID BH3 interacting domain death agonist HGNC:1050 details
hsa-miR-92a-3p TBC1D9B TBC1 domain family member 9B HGNC:29097 details
hsa-miR-92a-3p SLC25A33 solute carrier family 25 member 33 HGNC:29681 details
hsa-miR-92a-3p LAMC1 laminin subunit gamma 1 HGNC:6492 details
hsa-miR-92a-3p RNF121 ring finger protein 121 HGNC:21070 details
hsa-miR-92a-3p PITPNA phosphatidylinositol transfer protein alpha HGNC:9001 details
hsa-miR-92a-3p RANGAP1 Ran GTPase activating protein 1 HGNC:9854 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p ZNF776 zinc finger protein 776 HGNC:26765 details
hsa-miR-92a-3p FTSJ1 FtsJ RNA 2'-O-methyltransferase 1 HGNC:13254 details
hsa-miR-92a-3p MED16 mediator complex subunit 16 HGNC:17556 details
hsa-miR-92a-3p MFSD1 major facilitator superfamily domain containing 1 HGNC:25874 details
hsa-miR-92a-3p details
hsa-miR-92a-3p UBAC2 UBA domain containing 2 HGNC:20486 details
hsa-miR-92a-3p SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-92a-3p BCL9 BCL9 transcription coactivator HGNC:1008 details
hsa-miR-92a-3p IRGQ immunity related GTPase Q HGNC:24868 details
hsa-miR-92a-3p ARL2 ADP ribosylation factor like GTPase 2 HGNC:693 details
hsa-miR-92a-3p USP13 ubiquitin specific peptidase 13 HGNC:12611 details
hsa-miR-92a-3p NADK NAD kinase HGNC:29831 details
hsa-miR-92a-3p COPS6 COP9 signalosome subunit 6 HGNC:21749 details
hsa-miR-92a-3p TLN1 talin 1 HGNC:11845 details
hsa-miR-92a-3p SELENBP1 selenium binding protein 1 HGNC:10719 details
hsa-miR-92a-3p PTK7 protein tyrosine kinase 7 (inactive) HGNC:9618 details
hsa-miR-92a-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-92a-3p TTL tubulin tyrosine ligase HGNC:21586 details
hsa-miR-92a-3p CA5B carbonic anhydrase 5B HGNC:1378 details
hsa-miR-92a-3p MCOLN2 mucolipin TRP cation channel 2 HGNC:13357 details
hsa-miR-92a-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-92a-3p POGZ pogo transposable element derived with ZNF domain HGNC:18801 details
hsa-miR-92a-3p details
hsa-miR-92a-3p FRAT2 FRAT regulator of WNT signaling pathway 2 HGNC:16048 details
hsa-miR-92a-3p DIAPH1 diaphanous related formin 1 HGNC:2876 details
hsa-miR-92a-3p LRRC27 leucine rich repeat containing 27 HGNC:29346 details
hsa-miR-92a-3p KHDRBS1 KH RNA binding domain containing, signal transduction associated 1 HGNC:18116 details
hsa-miR-92a-3p MEF2C myocyte enhancer factor 2C HGNC:6996 details
hsa-miR-92a-3p NAB1 NGFI-A binding protein 1 HGNC:7626 details
hsa-miR-92a-3p PPAN peter pan homolog HGNC:9227 details
hsa-miR-92a-3p DTL denticleless E3 ubiquitin protein ligase homolog HGNC:30288 details
hsa-miR-92a-3p POLR2L RNA polymerase II, I and III subunit L HGNC:9199 details
hsa-miR-92a-3p details
hsa-miR-92a-3p PDAP1 PDGFA associated protein 1 HGNC:14634 details
hsa-miR-92a-3p CYP4V2 cytochrome P450 family 4 subfamily V member 2 HGNC:23198 details
hsa-miR-92a-3p TERF2 telomeric repeat binding factor 2 HGNC:11729 details
hsa-miR-92a-3p details
hsa-miR-92a-3p MYBL2 MYB proto-oncogene like 2 HGNC:7548 details
hsa-miR-92a-3p CTSB cathepsin B HGNC:2527 details
hsa-miR-92a-3p SEC24A SEC24 homolog A, COPII coat complex component HGNC:10703 details
hsa-miR-92a-3p RNPS1 RNA binding protein with serine rich domain 1 HGNC:10080 details
hsa-miR-92a-3p SCARB1 scavenger receptor class B member 1 HGNC:1664 details
hsa-miR-92a-3p OSBPL8 oxysterol binding protein like 8 HGNC:16396 details
hsa-miR-92a-3p CHTOP chromatin target of PRMT1 HGNC:24511 details
hsa-miR-92a-3p HCFC1 host cell factor C1 HGNC:4839 details
hsa-miR-92a-3p ABHD15 abhydrolase domain containing 15 HGNC:26971 details
hsa-miR-92a-3p WNT5A Wnt family member 5A HGNC:12784 details
hsa-miR-92a-3p FAM20C FAM20C golgi associated secretory pathway kinase HGNC:22140 details
hsa-miR-92a-3p RECQL RecQ like helicase HGNC:9948 details
hsa-miR-92a-3p details
hsa-miR-92a-3p MFN2 mitofusin 2 HGNC:16877 details
hsa-miR-92a-3p CRTC3 CREB regulated transcription coactivator 3 HGNC:26148 details
hsa-miR-92a-3p PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-92a-3p MECP2 methyl-CpG binding protein 2 HGNC:6990 details
hsa-miR-92a-3p CYBRD1 cytochrome b reductase 1 HGNC:20797 details
hsa-miR-92a-3p CSPG5 chondroitin sulfate proteoglycan 5 HGNC:2467 details
hsa-miR-92a-3p FAM3A FAM3 metabolism regulating signaling molecule A HGNC:13749 details
hsa-miR-92a-3p HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-92a-3p NEK6 NIMA related kinase 6 HGNC:7749 details
hsa-miR-92a-3p RUVBL2 RuvB like AAA ATPase 2 HGNC:10475 details
hsa-miR-92a-3p RPS23 ribosomal protein S23 HGNC:10410 details
hsa-miR-92a-3p TMED9 transmembrane p24 trafficking protein 9 HGNC:24878 details
hsa-miR-92a-3p XPOT exportin for tRNA HGNC:12826 details
hsa-miR-92a-3p EPHB2 EPH receptor B2 HGNC:3393 details
hsa-miR-92a-3p CCDC181 coiled-coil domain containing 181 HGNC:28051 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SRRT serrate, RNA effector molecule HGNC:24101 details
hsa-miR-92a-3p UBR1 ubiquitin protein ligase E3 component n-recognin 1 HGNC:16808 details
hsa-miR-92a-3p ELOF1 elongation factor 1 HGNC:28691 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-92a-3p TOM1L1 target of myb1 like 1 membrane trafficking protein HGNC:11983 details
hsa-miR-92a-3p DHRS7B dehydrogenase/reductase 7B HGNC:24547 details
hsa-miR-92a-3p PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-92a-3p KLHL3 kelch like family member 3 HGNC:6354 details
hsa-miR-92a-3p PDIA4 protein disulfide isomerase family A member 4 HGNC:30167 details
hsa-miR-92a-3p KLHL36 kelch like family member 36 HGNC:17844 details
hsa-miR-92a-3p details
hsa-miR-92a-3p NCDN neurochondrin HGNC:17597 details
hsa-miR-92a-3p EP300 E1A binding protein p300 HGNC:3373 details
hsa-miR-92a-3p EIF4G2 eukaryotic translation initiation factor 4 gamma 2 HGNC:3297 details
hsa-miR-92a-3p DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-92a-3p DENND6A DENN domain containing 6A HGNC:26635 details
hsa-miR-92a-3p IARS2 isoleucyl-tRNA synthetase 2, mitochondrial HGNC:29685 details
hsa-miR-92a-3p LDLRAP1 low density lipoprotein receptor adaptor protein 1 HGNC:18640 details
hsa-miR-92a-3p PSMF1 proteasome inhibitor subunit 1 HGNC:9571 details
hsa-miR-92a-3p JMJD6 jumonji domain containing 6, arginine demethylase and lysine hydroxylase HGNC:19355 details
hsa-miR-92a-3p XYLT2 xylosyltransferase 2 HGNC:15517 details
hsa-miR-92a-3p IRF2BPL interferon regulatory factor 2 binding protein like HGNC:14282 details
hsa-miR-92a-3p MAPK9 mitogen-activated protein kinase 9 HGNC:6886 details
hsa-miR-92a-3p GATA3 GATA binding protein 3 HGNC:4172 details
hsa-miR-92a-3p EFTUD2 elongation factor Tu GTP binding domain containing 2 HGNC:30858 details
hsa-miR-92a-3p WDR26 WD repeat domain 26 HGNC:21208 details
hsa-miR-92a-3p PANK2 pantothenate kinase 2 HGNC:15894 details
hsa-miR-92a-3p ERH ERH mRNA splicing and mitosis factor HGNC:3447 details
hsa-miR-92a-3p HMGB1 high mobility group box 1 HGNC:4983 details
hsa-miR-92a-3p HAUS1 HAUS augmin like complex subunit 1 HGNC:25174 details
hsa-miR-92a-3p SURF6 surfeit 6 HGNC:11478 details
hsa-miR-92a-3p NUP210 nucleoporin 210 HGNC:30052 details
hsa-miR-92a-3p RPS10 ribosomal protein S10 HGNC:10383 details
hsa-miR-92a-3p CHEK1 checkpoint kinase 1 HGNC:1925 details
hsa-miR-92a-3p PPP2R1A protein phosphatase 2 scaffold subunit Aalpha HGNC:9302 details
hsa-miR-92a-3p MKRN2 makorin ring finger protein 2 HGNC:7113 details
hsa-miR-92a-3p CACUL1 CDK2 associated cullin domain 1 HGNC:23727 details
hsa-miR-92a-3p NSFL1C NSFL1 cofactor HGNC:15912 details
hsa-miR-92a-3p MAP3K4 mitogen-activated protein kinase kinase kinase 4 HGNC:6856 details
hsa-miR-92a-3p MRPL2 mitochondrial ribosomal protein L2 HGNC:14056 details
hsa-miR-92a-3p KHNYN KH and NYN domain containing HGNC:20166 details
hsa-miR-92a-3p MSL3 MSL complex subunit 3 HGNC:7370 details
hsa-miR-92a-3p CDKN2AIPNL CDKN2A interacting protein N-terminal like HGNC:30545 details
hsa-miR-92a-3p DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A HGNC:3091 details
hsa-miR-92a-3p TRAPPC2 trafficking protein particle complex subunit 2 HGNC:23068 details
hsa-miR-92a-3p EXOSC6 exosome component 6 HGNC:19055 details
hsa-miR-92a-3p PPARD peroxisome proliferator activated receptor delta HGNC:9235 details
hsa-miR-92a-3p RHEB Ras homolog, mTORC1 binding HGNC:10011 details
hsa-miR-92a-3p PA2G4 proliferation-associated 2G4 HGNC:8550 details
hsa-miR-92a-3p UFSP2 UFM1 specific peptidase 2 HGNC:25640 details
hsa-miR-92a-3p FAU FAU ubiquitin like and ribosomal protein S30 fusion HGNC:3597 details
hsa-miR-92a-3p details
hsa-miR-92a-3p ANKH ANKH inorganic pyrophosphate transport regulator HGNC:15492 details
hsa-miR-92a-3p POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) HGNC:19139 details
hsa-miR-92a-3p NBR1 NBR1 autophagy cargo receptor HGNC:6746 details
hsa-miR-92a-3p CISD1 CDGSH iron sulfur domain 1 HGNC:30880 details
hsa-miR-92a-3p DENND4B DENN domain containing 4B HGNC:29044 details
hsa-miR-92a-3p RPL22 ribosomal protein L22 HGNC:10315 details
hsa-miR-92a-3p PITX1 paired like homeodomain 1 HGNC:9004 details
hsa-miR-92a-3p DMXL1 Dmx like 1 HGNC:2937 details
hsa-miR-92a-3p FHOD1 formin homology 2 domain containing 1 HGNC:17905 details
hsa-miR-92a-3p PPP4C protein phosphatase 4 catalytic subunit HGNC:9319 details
hsa-miR-92a-3p RNH1 ribonuclease/angiogenin inhibitor 1 HGNC:10074 details
hsa-miR-92a-3p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-92a-3p TMA16 translation machinery associated 16 homolog HGNC:25638 details
hsa-miR-92a-3p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-92a-3p OCIAD2 OCIA domain containing 2 HGNC:28685 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-92a-3p SAP30 Sin3A associated protein 30 HGNC:10532 details
hsa-miR-92a-3p details
hsa-miR-92a-3p YIF1B Yip1 interacting factor homolog B, membrane trafficking protein HGNC:30511 details
hsa-miR-92a-3p KANSL2 KAT8 regulatory NSL complex subunit 2 HGNC:26024 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SAFB scaffold attachment factor B HGNC:10520 details
hsa-miR-92a-3p KPTN kaptin, actin binding protein HGNC:6404 details
hsa-miR-92a-3p TFG trafficking from ER to golgi regulator HGNC:11758 details
hsa-miR-92a-3p BFAR bifunctional apoptosis regulator HGNC:17613 details
hsa-miR-92a-3p ALDH9A1 aldehyde dehydrogenase 9 family member A1 HGNC:412 details
hsa-miR-92a-3p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-92a-3p THUMPD1 THUMP domain containing 1 HGNC:23807 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SUGP1 SURP and G-patch domain containing 1 HGNC:18643 details
hsa-miR-92a-3p AP3D1 adaptor related protein complex 3 subunit delta 1 HGNC:568 details
hsa-miR-92a-3p MCM7 minichromosome maintenance complex component 7 HGNC:6950 details
hsa-miR-92a-3p PRELID1 PRELI domain containing 1 HGNC:30255 details
hsa-miR-92a-3p SLC2A6 solute carrier family 2 member 6 HGNC:11011 details
hsa-miR-92a-3p OPTN optineurin HGNC:17142 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CCT7 chaperonin containing TCP1 subunit 7 HGNC:1622 details
hsa-miR-92a-3p CNOT1 CCR4-NOT transcription complex subunit 1 HGNC:7877 details
hsa-miR-92a-3p SUCLG2 succinate-CoA ligase GDP-forming subunit beta HGNC:11450 details
hsa-miR-92a-3p E4F1 E4F transcription factor 1 HGNC:3121 details
hsa-miR-92a-3p CSTF2T cleavage stimulation factor subunit 2 tau variant HGNC:17086 details
hsa-miR-92a-3p OAZ1 ornithine decarboxylase antizyme 1 HGNC:8095 details
hsa-miR-92a-3p KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-92a-3p SERTAD3 SERTA domain containing 3 HGNC:17931 details
hsa-miR-92a-3p CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-92a-3p SRF serum response factor HGNC:11291 details
hsa-miR-92a-3p EMD emerin HGNC:3331 details
hsa-miR-92a-3p CXCL16 C-X-C motif chemokine ligand 16 HGNC:16642 details
hsa-miR-92a-3p RSPRY1 ring finger and SPRY domain containing 1 HGNC:29420 details
hsa-miR-92a-3p F8A3 coagulation factor VIII associated 3 HGNC:31850 details
hsa-miR-92a-3p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-92a-3p ANXA11 annexin A11 HGNC:535 details
hsa-miR-92a-3p RPS8 ribosomal protein S8 HGNC:10441 details
hsa-miR-92a-3p TMUB1 transmembrane and ubiquitin like domain containing 1 HGNC:21709 details
hsa-miR-92a-3p GOLM1 golgi membrane protein 1 HGNC:15451 details
hsa-miR-92a-3p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-92a-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-92a-3p UPF2 UPF2 regulator of nonsense mediated mRNA decay HGNC:17854 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-92a-3p ZNF687 zinc finger protein 687 HGNC:29277 details
hsa-miR-92a-3p RBM27 RNA binding motif protein 27 HGNC:29243 details
hsa-miR-92a-3p EZR ezrin HGNC:12691 details
hsa-miR-92a-3p TNFRSF10B TNF receptor superfamily member 10b HGNC:11905 details
hsa-miR-92a-3p HMGXB3 HMG-box containing 3 HGNC:28982 details
hsa-miR-92a-3p NKX3-1 NK3 homeobox 1 HGNC:7838 details
hsa-miR-92a-3p details
hsa-miR-92a-3p PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 HGNC:20610 details
hsa-miR-92a-3p TP53 tumor protein p53 HGNC:11998 details
hsa-miR-92a-3p QRSL1 glutaminyl-tRNA amidotransferase subunit QRSL1 HGNC:21020 details
hsa-miR-92a-3p NR1H4 nuclear receptor subfamily 1 group H member 4 HGNC:7967 details
hsa-miR-92a-3p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-92a-3p SOCS5 suppressor of cytokine signaling 5 HGNC:16852 details
hsa-miR-92a-3p MYC MYC proto-oncogene, bHLH transcription factor HGNC:7553 details
hsa-miR-92a-3p ZNF98 zinc finger protein 98 HGNC:13174 details
hsa-miR-92a-3p ZNF721 zinc finger protein 721 HGNC:29425 details
hsa-miR-92a-3p ZNF492 zinc finger protein 492 HGNC:23707 details
hsa-miR-92a-3p ZNF430 zinc finger protein 430 HGNC:20808 details
hsa-miR-92a-3p ZNF224 zinc finger protein 224 HGNC:13017 details
hsa-miR-92a-3p ZNF17 zinc finger protein 17 HGNC:12958 details
hsa-miR-92a-3p ZFC3H1 zinc finger C3H1-type containing HGNC:28328 details
hsa-miR-92a-3p ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-92a-3p XRN1 5'-3' exoribonuclease 1 HGNC:30654 details
hsa-miR-92a-3p XPR1 xenotropic and polytropic retrovirus receptor 1 HGNC:12827 details
hsa-miR-92a-3p WRNIP1 WRN helicase interacting protein 1 HGNC:20876 details
hsa-miR-92a-3p VPS54 VPS54 subunit of GARP complex HGNC:18652 details
hsa-miR-92a-3p VMA21 vacuolar ATPase assembly factor VMA21 HGNC:22082 details
hsa-miR-92a-3p VDAC2 voltage dependent anion channel 2 HGNC:12672 details
hsa-miR-92a-3p UVRAG UV radiation resistance associated HGNC:12640 details
hsa-miR-92a-3p UBXN4 UBX domain protein 4 HGNC:14860 details
hsa-miR-92a-3p TULP4 TUB like protein 4 HGNC:15530 details
hsa-miR-92a-3p TSC1 TSC complex subunit 1 HGNC:12362 details
hsa-miR-92a-3p TRIO trio Rho guanine nucleotide exchange factor HGNC:12303 details
hsa-miR-92a-3p TRAM2 translocation associated membrane protein 2 HGNC:16855 details
hsa-miR-92a-3p TOB2 transducer of ERBB2, 2 HGNC:11980 details
hsa-miR-92a-3p TOB1 transducer of ERBB2, 1 HGNC:11979 details
hsa-miR-92a-3p NEMP1 nuclear envelope integral membrane protein 1 HGNC:29001 details
hsa-miR-92a-3p CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 HGNC:26759 details
hsa-miR-92a-3p TACC1 transforming acidic coiled-coil containing protein 1 HGNC:11522 details
hsa-miR-92a-3p KMT5B lysine methyltransferase 5B HGNC:24283 details
hsa-miR-92a-3p details
hsa-miR-92a-3p SRPRA SRP receptor subunit alpha HGNC:11307 details
hsa-miR-92a-3p SPRYD4 SPRY domain containing 4 HGNC:27468 details
hsa-miR-92a-3p SPOCK2 SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2 HGNC:13564 details
hsa-miR-92a-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-92a-3p SNX10 sorting nexin 10 HGNC:14974 details
hsa-miR-92a-3p SNN stannin HGNC:11149 details
hsa-miR-92a-3p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-92a-3p SMAD6 SMAD family member 6 HGNC:6772 details
hsa-miR-92a-3p SLC9A1 solute carrier family 9 member A1 HGNC:11071 details
hsa-miR-92a-3p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-92a-3p SLC39A6 solute carrier family 39 member 6 HGNC:18607 details
hsa-miR-92a-3p SLC37A3 solute carrier family 37 member 3 HGNC:20651 details
hsa-miR-92a-3p SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-92a-3p SLC25A16 solute carrier family 25 member 16 HGNC:10986 details
hsa-miR-92a-3p SLC10A7 solute carrier family 10 member 7 HGNC:23088 details
hsa-miR-92a-3p SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-92a-3p SH3PXD2A SH3 and PX domains 2A HGNC:23664 details
hsa-miR-92a-3p SGPP1 sphingosine-1-phosphate phosphatase 1 HGNC:17720 details
hsa-miR-92a-3p SGK3 serum/glucocorticoid regulated kinase family member 3 HGNC:10812 details
hsa-miR-92a-3p PEAK1 pseudopodium enriched atypical kinase 1 HGNC:29431 details
hsa-miR-92a-3p SCAF11 SR-related CTD associated factor 11 HGNC:10784 details
hsa-miR-92a-3p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-92a-3p SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-92a-3p SELENOT selenoprotein T HGNC:18136 details
hsa-miR-92a-3p RRN3 RRN3 homolog, RNA polymerase I transcription factor HGNC:30346 details
hsa-miR-92a-3p RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-92a-3p RP2 RP2 activator of ARL3 GTPase HGNC:10274 details
hsa-miR-92a-3p RNF4 ring finger protein 4 HGNC:10067 details
hsa-miR-92a-3p RNF103 ring finger protein 103 HGNC:12859 details
hsa-miR-92a-3p REXO1 RNA exonuclease 1 homolog HGNC:24616 details
hsa-miR-92a-3p REV3L REV3 like, DNA directed polymerase zeta catalytic subunit HGNC:9968 details
hsa-miR-92a-3p RBL2 RB transcriptional corepressor like 2 HGNC:9894 details
hsa-miR-92a-3p RAD21 RAD21 cohesin complex component HGNC:9811 details
hsa-miR-92a-3p IFT22 intraflagellar transport 22 HGNC:21895 details
hsa-miR-92a-3p RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-92a-3p RAB7B RAB7B, member RAS oncogene family HGNC:30513 details
hsa-miR-92a-3p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-92a-3p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-92a-3p PTGER4 prostaglandin E receptor 4 HGNC:9596 details
hsa-miR-92a-3p PSME3 proteasome activator subunit 3 HGNC:9570 details
hsa-miR-92a-3p PSMD5 proteasome 26S subunit, non-ATPase 5 HGNC:9563 details
hsa-miR-92a-3p PPP1R3D protein phosphatase 1 regulatory subunit 3D HGNC:9294 details
hsa-miR-92a-3p PPP1R12C protein phosphatase 1 regulatory subunit 12C HGNC:14947 details
hsa-miR-92a-3p PPCS phosphopantothenoylcysteine synthetase HGNC:25686 details
hsa-miR-92a-3p details
hsa-miR-92a-3p PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma HGNC:8996 details
hsa-miR-92a-3p PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 HGNC:30034 details
hsa-miR-92a-3p PHTF2 putative homeodomain transcription factor 2 HGNC:13411 details
hsa-miR-92a-3p PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 HGNC:29149 details
hsa-miR-92a-3p PER2 period circadian regulator 2 HGNC:8846 details
hsa-miR-92a-3p CDK16 cyclin dependent kinase 16 HGNC:8749 details
hsa-miR-92a-3p PBLD phenazine biosynthesis like protein domain containing HGNC:23301 details
hsa-miR-92a-3p details
hsa-miR-92a-3p PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 HGNC:8574 details
hsa-miR-92a-3p OTUD3 OTU deubiquitinase 3 HGNC:29038 details
hsa-miR-92a-3p NUP43 nucleoporin 43 HGNC:21182 details
hsa-miR-92a-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-92a-3p NSF N-ethylmaleimide sensitive factor, vesicle fusing ATPase HGNC:8016 details
hsa-miR-92a-3p NRAS NRAS proto-oncogene, GTPase HGNC:7989 details
hsa-miR-92a-3p NPTN neuroplastin HGNC:17867 details
hsa-miR-92a-3p GLYR1 glyoxylate reductase 1 homolog HGNC:24434 details
hsa-miR-92a-3p NFATC2IP nuclear factor of activated T cells 2 interacting protein HGNC:25906 details
hsa-miR-92a-3p NECAP1 NECAP endocytosis associated 1 HGNC:24539 details
hsa-miR-92a-3p MYO5A myosin VA HGNC:7602 details
hsa-miR-92a-3p MTMR1 myotubularin related protein 1 HGNC:7449 details
hsa-miR-92a-3p MTF1 metal regulatory transcription factor 1 HGNC:7428 details
hsa-miR-92a-3p MRS2 magnesium transporter MRS2 HGNC:13785 details
hsa-miR-92a-3p MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-92a-3p MPP1 membrane palmitoylated protein 1 HGNC:7219 details
hsa-miR-92a-3p MORC3 MORC family CW-type zinc finger 3 HGNC:23572 details
hsa-miR-92a-3p MIA3 MIA SH3 domain ER export factor 3 HGNC:24008 details
hsa-miR-92a-3p MFN1 mitofusin 1 HGNC:18262 details
hsa-miR-92a-3p MEF2D myocyte enhancer factor 2D HGNC:6997 details
hsa-miR-92a-3p MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-92a-3p MBD2 methyl-CpG binding domain protein 2 HGNC:6917 details
hsa-miR-92a-3p MAST3 microtubule associated serine/threonine kinase 3 HGNC:19036 details
hsa-miR-92a-3p MAN2A1 mannosidase alpha class 2A member 1 HGNC:6824 details
hsa-miR-92a-3p LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-92a-3p LAMP2 lysosomal associated membrane protein 2 HGNC:6501 details
hsa-miR-92a-3p KLHL18 kelch like family member 18 HGNC:29120 details
hsa-miR-92a-3p KLHL14 kelch like family member 14 HGNC:29266 details
hsa-miR-92a-3p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-92a-3p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-92a-3p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-92a-3p KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-92a-3p details
hsa-miR-92a-3p KIAA1109 KIAA1109 HGNC:26953 details
hsa-miR-92a-3p details
hsa-miR-92a-3p JOSD1 Josephin domain containing 1 HGNC:28953 details
hsa-miR-92a-3p ITPR1 inositol 1,4,5-trisphosphate receptor type 1 HGNC:6180 details
hsa-miR-92a-3p IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-92a-3p ICAM1 intercellular adhesion molecule 1 HGNC:5344 details
hsa-miR-92a-3p IBTK inhibitor of Bruton tyrosine kinase HGNC:17853 details
hsa-miR-92a-3p HIVEP1 HIVEP zinc finger 1 HGNC:4920 details
hsa-miR-92a-3p HECTD1 HECT domain E3 ubiquitin protein ligase 1 HGNC:20157 details
hsa-miR-92a-3p GRAMD2B GRAM domain containing 2B HGNC:24911 details
hsa-miR-92a-3p GRAMD1B GRAM domain containing 1B HGNC:29214 details
hsa-miR-92a-3p GOLGA8B golgin A8 family member B HGNC:31973 details
hsa-miR-92a-3p GOLGA4 golgin A4 HGNC:4427 details
hsa-miR-92a-3p CPTP ceramide-1-phosphate transfer protein HGNC:28116 details
hsa-miR-92a-3p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-92a-3p GIT2 GIT ArfGAP 2 HGNC:4273 details
hsa-miR-92a-3p GATAD2B GATA zinc finger domain containing 2B HGNC:30778 details
hsa-miR-92a-3p GAN gigaxonin HGNC:4137 details
hsa-miR-92a-3p GAA alpha glucosidase HGNC:4065 details
hsa-miR-92a-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-92a-3p FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-92a-3p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-92a-3p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-92a-3p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-92a-3p FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-92a-3p FAR1 fatty acyl-CoA reductase 1 HGNC:26222 details
hsa-miR-92a-3p FAM91A1 family with sequence similarity 91 member A1 HGNC:26306 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-92a-3p EXOC5 exocyst complex component 5 HGNC:10696 details
hsa-miR-92a-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-92a-3p EPM2AIP1 EPM2A interacting protein 1 HGNC:19735 details
hsa-miR-92a-3p EID2B EP300 interacting inhibitor of differentiation 2B HGNC:26796 details
hsa-miR-92a-3p EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 HGNC:18967 details
hsa-miR-92a-3p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-92a-3p DYNLT3 dynein light chain Tctex-type 3 HGNC:11694 details
hsa-miR-92a-3p DUSP5 dual specificity phosphatase 5 HGNC:3071 details
hsa-miR-92a-3p DUSP10 dual specificity phosphatase 10 HGNC:3065 details
hsa-miR-92a-3p DUS2 dihydrouridine synthase 2 HGNC:26014 details
hsa-miR-92a-3p DSTYK dual serine/threonine and tyrosine protein kinase HGNC:29043 details
hsa-miR-92a-3p DOCK9 dedicator of cytokinesis 9 HGNC:14132 details
hsa-miR-92a-3p DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 HGNC:16410 details
hsa-miR-92a-3p DNAJC27 DnaJ heat shock protein family (Hsp40) member C27 HGNC:30290 details
hsa-miR-92a-3p DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 HGNC:6968 details
hsa-miR-92a-3p DBT dihydrolipoamide branched chain transacylase E2 HGNC:2698 details
hsa-miR-92a-3p DAB2IP DAB2 interacting protein HGNC:17294 details
hsa-miR-92a-3p CPEB3 cytoplasmic polyadenylation element binding protein 3 HGNC:21746 details
hsa-miR-92a-3p COG3 component of oligomeric golgi complex 3 HGNC:18619 details
hsa-miR-92a-3p CNIH1 cornichon family AMPA receptor auxiliary protein 1 HGNC:19431 details
hsa-miR-92a-3p CIC capicua transcriptional repressor HGNC:14214 details
hsa-miR-92a-3p CDC6 cell division cycle 6 HGNC:1744 details
hsa-miR-92a-3p CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-92a-3p CD69 CD69 molecule HGNC:1694 details
hsa-miR-92a-3p CCDC113 coiled-coil domain containing 113 HGNC:25002 details
hsa-miR-92a-3p CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-92a-3p C6orf62 chromosome 6 open reading frame 62 HGNC:20998 details
hsa-miR-92a-3p C2orf69 chromosome 2 open reading frame 69 HGNC:26799 details
hsa-miR-92a-3p C21orf91 chromosome 21 open reading frame 91 HGNC:16459 details
hsa-miR-92a-3p NOL4L nucleolar protein 4 like HGNC:16106 details
hsa-miR-92a-3p C11orf24 chromosome 11 open reading frame 24 HGNC:1174 details
hsa-miR-92a-3p EDRF1 erythroid differentiation regulatory factor 1 HGNC:24640 details
hsa-miR-92a-3p CCDC186 coiled-coil domain containing 186 HGNC:24349 details
hsa-miR-92a-3p BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-92a-3p BICD2 BICD cargo adaptor 2 HGNC:17208 details
hsa-miR-92a-3p BCAT2 branched chain amino acid transaminase 2 HGNC:977 details
hsa-miR-92a-3p AURKA aurora kinase A HGNC:11393 details
hsa-miR-92a-3p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-92a-3p ATP2B4 ATPase plasma membrane Ca2+ transporting 4 HGNC:817 details
hsa-miR-92a-3p ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-92a-3p ARFGEF2 ADP ribosylation factor guanine nucleotide exchange factor 2 HGNC:15853 details
hsa-miR-92a-3p APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 HGNC:24035 details
hsa-miR-92a-3p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-92a-3p ANKIB1 ankyrin repeat and IBR domain containing 1 HGNC:22215 details
hsa-miR-92a-3p ADAM10 ADAM metallopeptidase domain 10 HGNC:188 details
hsa-miR-92a-3p ACAA1 acetyl-CoA acyltransferase 1 HGNC:82 details
hsa-miR-92a-3p PPIC peptidylprolyl isomerase C HGNC:9256 details
hsa-miR-92a-3p details
hsa-miR-92a-3p CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-92a-3p SLC33A1 solute carrier family 33 member 1 HGNC:95 details
hsa-miR-92a-3p TAF8 TATA-box binding protein associated factor 8 HGNC:17300 details
hsa-miR-92a-3p CYP2C19 cytochrome P450 family 2 subfamily C member 19 HGNC:2621 details
hsa-miR-92a-3p KIAA1586 KIAA1586 HGNC:21360 details
hsa-miR-92a-3p TMEM239 transmembrane protein 239 HGNC:40044 details
hsa-miR-92a-3p NLRP9 NLR family pyrin domain containing 9 HGNC:22941 details
hsa-miR-92a-3p MRPS21 mitochondrial ribosomal protein S21 HGNC:14046 details
hsa-miR-92a-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-92a-3p SNRPD1 small nuclear ribonucleoprotein D1 polypeptide HGNC:11158 details
hsa-miR-92a-3p TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-92a-3p OPA3 outer mitochondrial membrane lipid metabolism regulator OPA3 HGNC:8142 details
hsa-miR-92a-3p ZNRF3 zinc and ring finger 3 HGNC:18126 details
hsa-miR-92a-3p ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like HGNC:22423 details
hsa-miR-92a-3p ZBTB8B zinc finger and BTB domain containing 8B HGNC:37057 details
hsa-miR-92a-3p TOR1B torsin family 1 member B HGNC:11995 details
hsa-miR-92a-3p RBFOX2 RNA binding fox-1 homolog 2 HGNC:9906 details
hsa-miR-92a-3p PTGES2 prostaglandin E synthase 2 HGNC:17822 details
hsa-miR-92a-3p PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-92a-3p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-92a-3p details
hsa-miR-92a-3p details
hsa-miR-92a-3p GOLGA8A golgin A8 family member A HGNC:31972 details
hsa-miR-92a-3p GM2A GM2 ganglioside activator HGNC:4367 details
hsa-miR-92a-3p FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-92a-3p EIF1 eukaryotic translation initiation factor 1 HGNC:3249 details
hsa-miR-92a-3p DDI2 DNA damage inducible 1 homolog 2 HGNC:24578 details
hsa-miR-92a-3p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-92a-3p BAZ2B bromodomain adjacent to zinc finger domain 2B HGNC:963 details
hsa-miR-92a-3p IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-92a-3p ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-92a-3p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-92a-3p CASKIN1 CASK interacting protein 1 HGNC:20879 details
hsa-miR-92a-3p ZDHHC21 zinc finger DHHC-type palmitoyltransferase 21 HGNC:20750 details
hsa-miR-92a-3p ABCF2 ATP binding cassette subfamily F member 2 HGNC:71 details
hsa-miR-92a-3p UBE2Z ubiquitin conjugating enzyme E2 Z HGNC:25847 details
hsa-miR-92a-3p SLC12A5 solute carrier family 12 member 5 HGNC:13818 details
hsa-miR-92a-3p BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-92a-3p BCL11B BAF chromatin remodeling complex subunit BCL11B HGNC:13222 details
hsa-miR-92a-3p GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-92a-3p ASGR2 asialoglycoprotein receptor 2 HGNC:743 details
hsa-miR-92a-3p RPL9 ribosomal protein L9 HGNC:10369 details
hsa-miR-92a-3p RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-92a-3p PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-92a-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-92a-3p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-92a-3p CPEB4 cytoplasmic polyadenylation element binding protein 4 HGNC:21747 details
hsa-miR-92a-3p CNOT2 CCR4-NOT transcription complex subunit 2 HGNC:7878 details
hsa-miR-92a-3p BCAT1 branched chain amino acid transaminase 1 HGNC:976 details
hsa-miR-92a-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-92a-3p ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-92a-3p XKR7 XK related 7 HGNC:23062 details
hsa-miR-92a-3p TPPP tubulin polymerization promoting protein HGNC:24164 details
hsa-miR-92a-3p GOLGA8J golgin A8 family member J HGNC:38650 details
hsa-miR-92a-3p GOLGA8IP golgin A8 family member I, pseudogene HGNC:26660 details
hsa-miR-92a-3p GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-92a-3p CTDSPL CTD small phosphatase like HGNC:16890 details
hsa-miR-92a-3p ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-92a-3p MOAP1 modulator of apoptosis 1 HGNC:16658 details
hsa-miR-92a-3p PAWR pro-apoptotic WT1 regulator HGNC:8614 details
hsa-miR-92a-3p COX20 cytochrome c oxidase assembly factor COX20 HGNC:26970 details
hsa-miR-92a-3p INCENP inner centromere protein HGNC:6058 details
hsa-miR-92a-3p BMP8A bone morphogenetic protein 8a HGNC:21650 details
hsa-miR-92a-3p C1orf35 chromosome 1 open reading frame 35 HGNC:19032 details
hsa-miR-92a-3p ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-92a-3p ZFP62 ZFP62 zinc finger protein HGNC:23241 details
hsa-miR-92a-3p SLC25A32 solute carrier family 25 member 32 HGNC:29683 details
hsa-miR-92a-3p ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-92a-3p GULP1 GULP PTB domain containing engulfment adaptor 1 HGNC:18649 details
hsa-miR-92a-3p SLC39A14 solute carrier family 39 member 14 HGNC:20858 details
hsa-miR-92a-3p EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 HGNC:3289 details
hsa-miR-92a-3p ZNF24 zinc finger protein 24 HGNC:13032 details
hsa-miR-92a-3p SOX11 SRY-box transcription factor 11 HGNC:11191 details
hsa-miR-92a-3p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-92a-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-92a-3p GRAMD4 GRAM domain containing 4 HGNC:29113 details
hsa-miR-92a-3p GFPT2 glutamine-fructose-6-phosphate transaminase 2 HGNC:4242 details
hsa-miR-92a-3p GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 HGNC:4129 details
hsa-miR-92a-3p CCSER2 coiled-coil serine rich protein 2 HGNC:29197 details
hsa-miR-92a-3p NPY4R neuropeptide Y receptor Y4 HGNC:9329 details
hsa-miR-92a-3p ZNF417 zinc finger protein 417 HGNC:20646 details
hsa-miR-92a-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-92a-3p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-92a-3p PRRG4 proline rich and Gla domain 4 HGNC:30799 details
hsa-miR-92a-3p NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 HGNC:29923 details
hsa-miR-92a-3p HOXC8 homeobox C8 HGNC:5129 details
hsa-miR-92a-3p SZRD1 SUZ RNA binding domain containing 1 HGNC:30232 details
hsa-miR-92a-3p GEMIN2 gem nuclear organelle associated protein 2 HGNC:10884 details
hsa-miR-92a-3p ZSCAN12 zinc finger and SCAN domain containing 12 HGNC:13172 details
hsa-miR-92a-3p AP5Z1 adaptor related protein complex 5 subunit zeta 1 HGNC:22197 details
hsa-miR-92a-3p MED19 mediator complex subunit 19 HGNC:29600 details
hsa-miR-92a-3p CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-92a-3p GTF2E1 general transcription factor IIE subunit 1 HGNC:4650 details
hsa-miR-92a-3p TRIM36 tripartite motif containing 36 HGNC:16280 details
hsa-miR-92a-3p UHRF1BP1 UHRF1 binding protein 1 HGNC:21216 details
hsa-miR-92a-3p ZFYVE21 zinc finger FYVE-type containing 21 HGNC:20760 details
hsa-miR-92a-3p WDR81 WD repeat domain 81 HGNC:26600 details
hsa-miR-92a-3p VPS4B vacuolar protein sorting 4 homolog B HGNC:10895 details
hsa-miR-92a-3p ELOA elongin A HGNC:11620 details
hsa-miR-92a-3p PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-92a-3p MED29 mediator complex subunit 29 HGNC:23074 details
hsa-miR-92a-3p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-92a-3p CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 HGNC:105 details
hsa-miR-92a-3p CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 HGNC:1775 details
hsa-miR-92a-3p ZNF75A zinc finger protein 75a HGNC:13146 details
hsa-miR-92a-3p ZNF598 zinc finger protein 598, E3 ubiquitin ligase HGNC:28079 details
hsa-miR-92a-3p ZNF695 zinc finger protein 695 HGNC:30954 details
hsa-miR-92a-3p MRO maestro HGNC:24121 details
hsa-miR-92a-3p IPP intracisternal A particle-promoted polypeptide HGNC:6108 details
hsa-miR-92a-3p MYZAP myocardial zonula adherens protein HGNC:43444 details
hsa-miR-92a-3p TOR4A torsin family 4 member A HGNC:25981 details
hsa-miR-92a-3p CIDEC cell death inducing DFFA like effector c HGNC:24229 details
hsa-miR-92a-3p AGBL5 AGBL carboxypeptidase 5 HGNC:26147 details
hsa-miR-92a-3p LETM1 leucine zipper and EF-hand containing transmembrane protein 1 HGNC:6556 details
hsa-miR-92a-3p RAB3D RAB3D, member RAS oncogene family HGNC:9779 details
hsa-miR-92a-3p ZADH2 zinc binding alcohol dehydrogenase domain containing 2 HGNC:28697 details
hsa-miR-92a-3p USP28 ubiquitin specific peptidase 28 HGNC:12625 details
hsa-miR-92a-3p UCK2 uridine-cytidine kinase 2 HGNC:12562 details
hsa-miR-92a-3p TBC1D8 TBC1 domain family member 8 HGNC:17791 details
hsa-miR-92a-3p SPCS3 signal peptidase complex subunit 3 HGNC:26212 details
hsa-miR-92a-3p SMU1 SMU1 DNA replication regulator and spliceosomal factor HGNC:18247 details
hsa-miR-92a-3p SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 HGNC:11101 details
hsa-miR-92a-3p SLX4 SLX4 structure-specific endonuclease subunit HGNC:23845 details
hsa-miR-92a-3p REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-92a-3p PPP1R37 protein phosphatase 1 regulatory subunit 37 HGNC:27607 details
hsa-miR-92a-3p PMEPA1 prostate transmembrane protein, androgen induced 1 HGNC:14107 details
hsa-miR-92a-3p PGAM4 phosphoglycerate mutase family member 4 HGNC:21731 details
hsa-miR-92a-3p PAX9 paired box 9 HGNC:8623 details
hsa-miR-92a-3p PAIP1 poly(A) binding protein interacting protein 1 HGNC:16945 details
hsa-miR-92a-3p NFYB nuclear transcription factor Y subunit beta HGNC:7805 details
hsa-miR-92a-3p MAP2K4 mitogen-activated protein kinase kinase 4 HGNC:6844 details
hsa-miR-92a-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-92a-3p KIAA1958 KIAA1958 HGNC:23427 details
hsa-miR-92a-3p HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-92a-3p CLTA clathrin light chain A HGNC:2090 details
hsa-miR-92a-3p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-92a-3p AKAP10 A-kinase anchoring protein 10 HGNC:368 details
hsa-miR-92a-3p AEN apoptosis enhancing nuclease HGNC:25722 details
hsa-miR-92a-3p SRFBP1 serum response factor binding protein 1 HGNC:26333 details
hsa-miR-92a-3p GPBP1L1 GC-rich promoter binding protein 1 like 1 HGNC:28843 details
hsa-miR-92a-3p NF2 neurofibromin 2 HGNC:7773 details
hsa-miR-92a-3p HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-92a-3p GNAQ G protein subunit alpha q HGNC:4390 details
hsa-miR-92a-3p C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-92a-3p ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 HGNC:18984 details
hsa-miR-92a-3p ZNF277 zinc finger protein 277 HGNC:13070 details
hsa-miR-92a-3p FMN1 formin 1 HGNC:3768 details
hsa-miR-92a-3p TLR3 toll like receptor 3 HGNC:11849 details
hsa-miR-92a-3p TMEM41A transmembrane protein 41A HGNC:30544 details
hsa-miR-92a-3p TEF TEF transcription factor, PAR bZIP family member HGNC:11722 details
hsa-miR-92a-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-92a-3p ATOX1 antioxidant 1 copper chaperone HGNC:798 details
hsa-miR-92a-3p PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-92a-3p FASLG Fas ligand HGNC:11936 details
hsa-miR-92a-3p FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-92a-3p POLQ DNA polymerase theta HGNC:9186 details
hsa-miR-92a-3p ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-92a-3p ESRP1 epithelial splicing regulatory protein 1 HGNC:25966 details
hsa-miR-92a-3p ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-92a-3p YIPF4 Yip1 domain family member 4 HGNC:28145 details
hsa-miR-92a-3p SH2B3 SH2B adaptor protein 3 HGNC:29605 details
hsa-miR-92a-3p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-92a-3p CCDC171 coiled-coil domain containing 171 HGNC:29828 details
hsa-miR-92a-3p ALG14 ALG14 UDP-N-acetylglucosaminyltransferase subunit HGNC:28287 details
hsa-miR-92a-3p details
hsa-miR-92a-3p RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-92a-3p EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 HGNC:3288 details
hsa-miR-92a-3p ZNF267 zinc finger protein 267 HGNC:13060 details
hsa-miR-92a-3p PLXNA3 plexin A3 HGNC:9101 details
hsa-miR-92a-3p LAX1 lymphocyte transmembrane adaptor 1 HGNC:26005 details
hsa-miR-92a-3p AGMAT agmatinase HGNC:18407 details
hsa-miR-92a-3p MCF2L2 MCF.2 cell line derived transforming sequence-like 2 HGNC:30319 details
hsa-miR-92a-3p PNO1 partner of NOB1 homolog HGNC:32790 details
hsa-miR-92a-3p NARF nuclear prelamin A recognition factor HGNC:29916 details
hsa-miR-92a-3p