miRTarBase - #MIRT000282 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WNT3A   
Synonyms -
Description Wnt family member 3A
Transcript NM_033131   
Expression
Putative miRNA Targets on WNT3A
3'UTR of WNT3A
(miRNA target sites are highlighted)
>WNT3A|NM_033131|3'UTR
   1 GCACCGGCCGCGGCTCCCCCTGGACGGGGCGGGCCCTGCCTGAGGGTGGGCTTTTCCCTGGGTGGAGCAGGACTCCCACC
  81 TAAACGGGGCAGTACTCCTCCCTGGGGGCGGGACTCCTCCCTGGGGGTGGGGCTCCTACCTGGGGGCAGAACTCCTACCT
 161 GAAGGCAGGGCTCCTCCCTGGAGCTAGTGTCTCCTCTCTGGTGGCTGGGCTGCTCCTGAATGAGGCGGAGCTCCAGGATG
 241 GGGAGGGGCTCTGCGTTGGCTTCTCCCTGGGGACGGGGCTCCCCTGGACAGAGGCGGGGCTACAGATTGGGCGGGGCTTC
 321 TCTTGGGTGGGACAGGGCTTCTCCTGCGGGGGCGAGGCCCCTCCCAGTAAGGGCGTGGCTCTGGGTGGGCGGGGCACTAG
 401 GTAGGCTTCTACCTGCAGGCGGGGCTCCTCCTGAAGGAGGCGGGGCTCTAGGATGGGGCACGGCTCTGGGGTAGGCTGCT
 481 CCCTGAGGGCGGAGCGCCTCCTTAGGAGTGGGGTTTTATGGTGGATGAGGCTTCTTCCTGGATGGGGCAGAGCTTCTCCT
 561 GACCAGGGCAAGGCCCCTTCCACGGGGGCTGTGGCTCTGGGTGGGCGTGGCCTGCATAGGCTCCTTCCTGTGGGTGGGGC
 641 TTCTCTGGGACCAGGCTCCAATGGGGCGGGGCTTCTCTCCGCGGGTGGGACTCTTCCCTGGGAACCGCCCTCCTGATTAA
 721 GGCGTGGCTTCTGCAGGAATCCCGGCTCCAGAGCAGGAAATTCAGCCCACCAGCCACCTCATCCCCAACCCCCTGTAAGG
 801 TTCCATCCACCCCTGCGTCGAGCTGGGAAGGTTCCATGAAGCGAGTCGGGTCCCCAACCCGTGCCCCTGGGATCCGAGGG
 881 CCCCTCTCCAAGCGCCTGGCTTTGGAATGCTCCAGGCGCGCCGACGCCTGTGCCACCCCTTCCTCAGCCTGGGGTTTGAC
 961 CACCCACCTGACCAGGGGCCCTACCTGGGGAAAGCCTGAAGGGCCTCCCAGCCCCCAACCCCAAGACCAAGCTTAGTCCT
1041 GGGAGAGGACAGGGACTTCGCAGAGGCAAGCGACCGAGGCCCTCCCAAAGAGGCCCGCCCTGCCCGGGCTCCCACACCGT
1121 CAGGTACTCCTGCCAGGGAACTGGCCTGCTGCGCCCCAGGCCCCGCCCGTCTCTGCTCTGCTCAGCTGCGCCCCCTTCTT
1201 TGCAGCTGCCCAGCCCCTCCTCCCTGCCCTCGGGTCTCCCCACCTGCACTCCATCCAGCTACAGGAGAGATAGAAGCCTC
1281 TCGTCCCGTCCCTCCCTTTCCTCCGCCTGTCCACAGCCCCTTAAGGGAAAGGTAGGAAGAGAGGTCCAGCCCCCCAGGCT
1361 GCCCAGAGCTGCTGGTCTCATTTGGGGGCGTTCGGGAGGTTTGGGGGGCATCAACCCCCCGACTGTGCTGCTCGCGAAGG
1441 TCCCACAGCCCTGAGATGGGCCGGCCCCCTTCCTGGCCCCTCATGGCGGGACTGGAGAAATGGTCCGCTTTCCTGGAGCC
1521 AATGGCCCGGCCCCTCCTGACTCATCCGCCTGGCCCGGGAATGAATGGGGAGGCCGCTGAACCCACCCGGCCCATATCCC
1601 TGGTTGCCTCATGGCCAGCGCCCCTCAGCCTCTGCCACTGTGAACCGGCTCCCACCCTCAAGGTGCGGGGAGAAGAAGCG
1681 GCCAGGCGGGGCGCCCCAAGAGCCCAAAAGAGGGCACACCGCCATCCTCTGCCTCAAATTCTGCGTTTTTGGTTTTAATG
1761 TTATATCTGATGCTGCTATATCCACTGTCCAACGGAGTTAGACGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU--ACACGACGAu 5'
            ||| ||   :  ||||||||| 
Target 5' atCAACCCCCCGACTGTGCTGCTc 3'
1410 - 1433 154.00 -15.20
2
miRNA  3' guGUU-UGGUA-AUAC-ACGACGAu 5'
            :|| :::|| | || ||||||| 
Target 5' ttTAATGTTATATCTGATGCTGCTa 3'
1754 - 1778 152.00 -10.80
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || || | ||| ||| 
Target 5' tgcgccCCCTTCTTTGCAGCTg 3'
1187 - 1208 124.00 -7.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8436875 121 COSMIC
COSN31557507 497 COSMIC
COSN31572231 535 COSMIC
COSN6446134 552 COSMIC
COSN28681032 585 COSMIC
COSN31491043 650 COSMIC
COSN31493243 659 COSMIC
COSN30449660 678 COSMIC
COSN30471684 689 COSMIC
COSN31543130 696 COSMIC
COSN30485945 711 COSMIC
COSM5762267 736 COSMIC
COSM8320351 745 COSMIC
COSM7130085 753 COSMIC
COSM3377011 770 COSMIC
COSM3864613 772 COSMIC
COSM7981348 787 COSMIC
COSM7117968 817 COSMIC
COSM7806877 839 COSMIC
COSN24402458 842 COSMIC
COSN30187562 843 COSMIC
COSN31960420 849 COSMIC
COSN30150583 855 COSMIC
COSN30647167 861 COSMIC
COSN30450513 866 COSMIC
COSN31563109 872 COSMIC
COSN27005109 876 COSMIC
COSN30176397 877 COSMIC
COSN30458015 884 COSMIC
COSN28194435 919 COSMIC
COSN31554501 920 COSMIC
COSN13521916 921 COSMIC
COSN31493840 935 COSMIC
COSN30498126 981 COSMIC
COSN30164546 1356 COSMIC
COSN31583977 1436 COSMIC
COSN26464419 1493 COSMIC
COSN28738899 1524 COSMIC
COSN31487344 1643 COSMIC
COSN26567932 1647 COSMIC
COSN31481402 1683 COSMIC
COSN1099202 1693 COSMIC
COSN20096099 1698 COSMIC
COSN31487315 1701 COSMIC
COSN1099203 1766 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1395328616 5 dbSNP
rs764471622 6 dbSNP
rs972332667 7 dbSNP
rs1171208437 8 dbSNP
rs1025283111 13 dbSNP
rs751732710 14 dbSNP
rs749601552 16 dbSNP
rs757441870 17 dbSNP
rs767551023 20 dbSNP
rs1381489780 24 dbSNP
rs80286438 27 dbSNP
rs148630829 31 dbSNP
rs779940896 32 dbSNP
rs1473798636 33 dbSNP
rs978924990 35 dbSNP
rs1354588269 39 dbSNP
rs1218521775 40 dbSNP
rs1440489573 42 dbSNP
rs1369176732 45 dbSNP
rs568730418 46 dbSNP
rs908999073 48 dbSNP
rs932041164 52 dbSNP
rs1050952212 57 dbSNP
rs535688688 67 dbSNP
rs944742043 69 dbSNP
rs1316285358 72 dbSNP
rs1230392089 73 dbSNP
rs1040957156 75 dbSNP
rs897102503 80 dbSNP
rs778606684 82 dbSNP
rs922642031 87 dbSNP
rs1026794588 89 dbSNP
rs370330672 91 dbSNP
rs1188885042 92 dbSNP
rs888293476 93 dbSNP
rs921421744 94 dbSNP
rs1191806848 95 dbSNP
rs1001257349 98 dbSNP
rs1257513085 102 dbSNP
rs1204769565 103 dbSNP
rs557501637 109 dbSNP
rs1280046476 110 dbSNP
rs575678100 111 dbSNP
rs539912321 113 dbSNP
rs959726283 116 dbSNP
rs1229475184 126 dbSNP
rs1341697890 127 dbSNP
rs1204987045 133 dbSNP
rs992932743 136 dbSNP
rs1473594919 140 dbSNP
rs1020476307 144 dbSNP
rs967580522 145 dbSNP
rs1189482436 158 dbSNP
rs1252568248 167 dbSNP
rs1452703735 170 dbSNP
rs1168971995 174 dbSNP
rs1431300151 185 dbSNP
rs752107 186 dbSNP
rs1379367070 194 dbSNP
rs926090760 197 dbSNP
rs1472849335 202 dbSNP
rs932146621 205 dbSNP
rs1369625859 209 dbSNP
rs1466492777 212 dbSNP
rs1046217640 213 dbSNP
rs111458816 222 dbSNP
rs79401323 231 dbSNP
rs911995868 240 dbSNP
rs1206348317 242 dbSNP
rs1271159833 244 dbSNP
rs1214133703 256 dbSNP
rs374096538 261 dbSNP
rs561661836 262 dbSNP
rs952452018 268 dbSNP
rs1436955008 269 dbSNP
rs573850340 272 dbSNP
rs1308518811 273 dbSNP
rs183645114 275 dbSNP
rs1352488738 276 dbSNP
rs562684180 281 dbSNP
rs964648303 282 dbSNP
rs897845508 286 dbSNP
rs1162132961 287 dbSNP
rs113606278 289 dbSNP
rs368115699 290 dbSNP
rs1312199347 292 dbSNP
rs1238980586 293 dbSNP
rs1183457332 294 dbSNP
rs1048348626 296 dbSNP
rs888241416 297 dbSNP
rs1001808432 299 dbSNP
rs1204165353 303 dbSNP
rs1331698770 306 dbSNP
rs1452387097 308 dbSNP
rs1055536281 309 dbSNP
rs1275173551 312 dbSNP
rs1211941124 314 dbSNP
rs1209718750 316 dbSNP
rs752108 318 dbSNP
rs1225330219 323 dbSNP
rs1370997110 325 dbSNP
rs1278713315 333 dbSNP
rs977528443 336 dbSNP
rs1014024304 338 dbSNP
rs1460475006 339 dbSNP
rs936048261 340 dbSNP
rs1019880661 341 dbSNP
rs916459565 344 dbSNP
rs1176958226 347 dbSNP
rs1255151599 348 dbSNP
rs1454953980 348 dbSNP
rs1418526875 349 dbSNP
rs1468096578 355 dbSNP
rs1268848067 357 dbSNP
rs947983220 358 dbSNP
rs967026655 365 dbSNP
rs1046186152 368 dbSNP
rs1000366662 369 dbSNP
rs551501618 377 dbSNP
rs993858373 380 dbSNP
rs1033265106 382 dbSNP
rs1300806023 383 dbSNP
rs1046831591 385 dbSNP
rs1365364203 386 dbSNP
rs868735950 388 dbSNP
rs866043756 389 dbSNP
rs1343984238 391 dbSNP
rs560244255 393 dbSNP
rs1435743968 402 dbSNP
rs527295568 402 dbSNP
rs1018376175 403 dbSNP
rs1172083340 404 dbSNP
rs1409618698 405 dbSNP
rs548966168 406 dbSNP
rs966501266 407 dbSNP
rs1451783355 409 dbSNP
rs998469709 410 dbSNP
rs1159606768 421 dbSNP
rs1393355978 424 dbSNP
rs1456072422 429 dbSNP
rs377367177 441 dbSNP
rs919224677 444 dbSNP
rs1233177724 447 dbSNP
rs1367724649 453 dbSNP
rs1044260256 457 dbSNP
rs1297225383 461 dbSNP
rs752109 462 dbSNP
rs879266966 463 dbSNP
rs1288804466 464 dbSNP
rs1415934577 466 dbSNP
rs1377711554 467 dbSNP
rs1311405701 469 dbSNP
rs957685820 471 dbSNP
rs368193456 476 dbSNP
rs1229458792 480 dbSNP
rs909818564 482 dbSNP
rs1293066208 486 dbSNP
rs536126134 490 dbSNP
rs937172489 499 dbSNP
rs534196053 514 dbSNP
rs947983365 519 dbSNP
rs1418885696 525 dbSNP
rs1188643297 531 dbSNP
rs1266217992 538 dbSNP
rs982017297 539 dbSNP
rs1486597398 556 dbSNP
rs1480370589 568 dbSNP
rs1209928419 569 dbSNP
rs1480809068 575 dbSNP
rs1252715381 579 dbSNP
rs1056012326 585 dbSNP
rs761136814 589 dbSNP
rs1249596944 595 dbSNP
rs1427173461 600 dbSNP
rs550932780 601 dbSNP
rs1431832761 608 dbSNP
rs879768146 616 dbSNP
rs1357947190 619 dbSNP
rs1416918050 622 dbSNP
rs370423443 631 dbSNP
rs1414561513 634 dbSNP
rs1397571706 635 dbSNP
rs1300183214 637 dbSNP
rs1421785968 640 dbSNP
rs1451105399 641 dbSNP
rs1460645075 645 dbSNP
rs902855871 649 dbSNP
rs888180335 651 dbSNP
rs1476205811 652 dbSNP
rs867232012 653 dbSNP
rs1350079118 656 dbSNP
rs1039361081 657 dbSNP
rs1033209197 661 dbSNP
rs1273378221 662 dbSNP
rs1373020069 663 dbSNP
rs1331948937 668 dbSNP
rs1291979508 670 dbSNP
rs867996190 678 dbSNP
rs1244693289 680 dbSNP
rs146171382 684 dbSNP
rs903441970 688 dbSNP
rs373577769 695 dbSNP
rs778704895 696 dbSNP
rs1253165889 706 dbSNP
rs747771925 707 dbSNP
rs1191427132 708 dbSNP
rs1033612076 709 dbSNP
rs780451129 720 dbSNP
rs936850777 720 dbSNP
rs771746390 724 dbSNP
rs377412775 726 dbSNP
rs746487405 731 dbSNP
rs770473724 733 dbSNP
rs766626407 734 dbSNP
rs1326347035 737 dbSNP
rs764378056 738 dbSNP
rs1438976878 743 dbSNP
rs774764287 744 dbSNP
rs762007827 745 dbSNP
rs767744663 746 dbSNP
rs771226844 747 dbSNP
rs1316846342 749 dbSNP
rs41270171 751 dbSNP
rs372818343 754 dbSNP
rs756205043 755 dbSNP
rs766404258 756 dbSNP
rs41270173 757 dbSNP
rs765770383 766 dbSNP
rs754889166 770 dbSNP
rs116201409 771 dbSNP
rs747975567 774 dbSNP
rs1353366763 775 dbSNP
rs774815421 776 dbSNP
rs74143635 777 dbSNP
rs1396365439 779 dbSNP
rs777547224 782 dbSNP
rs1311252323 783 dbSNP
rs1325415719 785 dbSNP
rs1443378008 785 dbSNP
rs1351201142 788 dbSNP
rs746612179 789 dbSNP
rs770598373 790 dbSNP
rs1387073791 794 dbSNP
rs749815607 795 dbSNP
rs1204523547 796 dbSNP
rs769200838 798 dbSNP
rs774619611 800 dbSNP
rs762211395 801 dbSNP
rs772370757 802 dbSNP
rs773450831 806 dbSNP
rs759935619 810 dbSNP
rs1395448852 812 dbSNP
rs1438055260 815 dbSNP
rs909738253 817 dbSNP
rs760817340 819 dbSNP
rs1230671517 820 dbSNP
rs952018222 824 dbSNP
rs766463625 826 dbSNP
rs753943147 827 dbSNP
rs1251878568 828 dbSNP
rs759461721 832 dbSNP
rs187908511 842 dbSNP
rs752485131 843 dbSNP
rs758237439 844 dbSNP
rs1411855258 848 dbSNP
rs777672284 850 dbSNP
rs1327183640 851 dbSNP
rs573884572 852 dbSNP
rs751268552 855 dbSNP
rs756955504 856 dbSNP
rs780914946 858 dbSNP
rs77819929 862 dbSNP
rs75025283 865 dbSNP
rs1271154456 866 dbSNP
rs1242540377 867 dbSNP
rs769088618 871 dbSNP
rs779493560 872 dbSNP
rs1055722016 877 dbSNP
rs1270502086 879 dbSNP
rs748559578 882 dbSNP
rs772427765 883 dbSNP
rs773510049 884 dbSNP
rs917029450 886 dbSNP
rs544488678 919 dbSNP
rs1312845666 920 dbSNP
rs539059717 921 dbSNP
rs1274448196 931 dbSNP
rs1228257281 932 dbSNP
rs903409221 936 dbSNP
rs1041438733 943 dbSNP
rs577773195 948 dbSNP
rs1375890079 950 dbSNP
rs1450700024 953 dbSNP
rs372425314 954 dbSNP
rs1361612930 955 dbSNP
rs1054028542 961 dbSNP
rs888802719 974 dbSNP
rs1008191745 979 dbSNP
rs1191744619 979 dbSNP
rs560305054 985 dbSNP
rs764452233 988 dbSNP
rs11588071 989 dbSNP
rs893316995 990 dbSNP
rs1213511798 995 dbSNP
rs1484860631 996 dbSNP
rs11586760 998 dbSNP
rs1012999472 999 dbSNP
rs1277894066 1009 dbSNP
rs1023438134 1012 dbSNP
rs1341628079 1013 dbSNP
rs1212055876 1015 dbSNP
rs971458720 1018 dbSNP
rs1237869779 1020 dbSNP
rs370077555 1021 dbSNP
rs1002806162 1031 dbSNP
rs1237844305 1039 dbSNP
rs115017967 1045 dbSNP
rs1329208193 1045 dbSNP
rs1026383217 1055 dbSNP
rs751810699 1072 dbSNP
rs984885623 1075 dbSNP
rs1419240221 1079 dbSNP
rs1034061983 1082 dbSNP
rs983130616 1085 dbSNP
rs1249468506 1086 dbSNP
rs1205546488 1088 dbSNP
rs1449594055 1095 dbSNP
rs1171466901 1099 dbSNP
rs1271098546 1101 dbSNP
rs1261007703 1103 dbSNP
rs959402627 1105 dbSNP
rs991810411 1106 dbSNP
rs917205116 1107 dbSNP
rs1274984007 1110 dbSNP
rs1231375256 1112 dbSNP
rs1378246119 1113 dbSNP
rs1279901908 1118 dbSNP
rs1443981445 1119 dbSNP
rs1416655943 1120 dbSNP
rs1330214576 1130 dbSNP
rs962899225 1132 dbSNP
rs1167804302 1134 dbSNP
rs975278969 1137 dbSNP
rs1344999623 1148 dbSNP
rs949872100 1154 dbSNP
rs977250775 1166 dbSNP
rs1469018993 1167 dbSNP
rs924468398 1176 dbSNP
rs935726091 1179 dbSNP
rs1054221510 1190 dbSNP
rs41270175 1196 dbSNP
rs1322855977 1198 dbSNP
rs943089760 1199 dbSNP
rs1225280845 1206 dbSNP
rs924302249 1216 dbSNP
rs779748475 1229 dbSNP
rs144137720 1233 dbSNP
rs1041020615 1235 dbSNP
rs866498159 1239 dbSNP
rs1441163684 1240 dbSNP
rs934880561 1242 dbSNP
rs551259970 1247 dbSNP
rs569407975 1248 dbSNP
rs1013463541 1253 dbSNP
rs539659069 1265 dbSNP
rs1402811062 1271 dbSNP
rs887951858 1272 dbSNP
rs1454856658 1276 dbSNP
rs907268389 1277 dbSNP
rs1279192852 1283 dbSNP
rs1002942215 1287 dbSNP
rs1006269930 1289 dbSNP
rs1242649461 1290 dbSNP
rs1217854118 1291 dbSNP
rs1269690486 1300 dbSNP
rs1445121265 1303 dbSNP
rs1033806501 1304 dbSNP
rs959626582 1305 dbSNP
rs992198547 1306 dbSNP
rs950760691 1316 dbSNP
rs1024627190 1317 dbSNP
rs1300742976 1317 dbSNP
rs34629142 1317 dbSNP
rs1004126672 1318 dbSNP
rs1244487707 1328 dbSNP
rs971267336 1333 dbSNP
rs1433490514 1338 dbSNP
rs41270177 1343 dbSNP
rs962659668 1350 dbSNP
rs754888110 1351 dbSNP
rs921110192 1354 dbSNP
rs117915605 1355 dbSNP
rs990304303 1356 dbSNP
rs910337340 1359 dbSNP
rs1188255657 1362 dbSNP
rs943016605 1363 dbSNP
rs1476780931 1373 dbSNP
rs534010458 1383 dbSNP
rs555380633 1388 dbSNP
rs1262335088 1390 dbSNP
rs541641949 1394 dbSNP
rs922944579 1397 dbSNP
rs1486495802 1403 dbSNP
rs934355876 1403 dbSNP
rs1054131592 1404 dbSNP
rs1307632556 1406 dbSNP
rs374243654 1409 dbSNP
rs1216871820 1413 dbSNP
rs1339139010 1413 dbSNP
rs567650908 1416 dbSNP
rs887941736 1419 dbSNP
rs949013249 1421 dbSNP
rs1321765061 1422 dbSNP
rs1044946606 1426 dbSNP
rs1465709462 1427 dbSNP
rs907405968 1429 dbSNP
rs537807916 1432 dbSNP
rs1055603976 1445 dbSNP
rs1422844850 1470 dbSNP
rs1188484887 1483 dbSNP
rs895253575 1484 dbSNP
rs1014108204 1487 dbSNP
rs1024948856 1489 dbSNP
rs1180974454 1496 dbSNP
rs1226416179 1501 dbSNP
rs886535475 1502 dbSNP
rs1006594349 1505 dbSNP
rs1316687094 1506 dbSNP
rs1257988485 1507 dbSNP
rs1016282759 1513 dbSNP
rs1357808641 1518 dbSNP
rs1395765268 1522 dbSNP
rs966691615 1523 dbSNP
rs117497173 1524 dbSNP
rs1464134372 1524 dbSNP
rs1031590060 1526 dbSNP
rs1165637317 1529 dbSNP
rs1462930101 1530 dbSNP
rs1287258838 1539 dbSNP
rs957194582 1539 dbSNP
rs1163850218 1543 dbSNP
rs1028141364 1546 dbSNP
rs990028705 1549 dbSNP
rs1176331717 1556 dbSNP
rs556870601 1557 dbSNP
rs964464213 1558 dbSNP
rs955834051 1560 dbSNP
rs1359112646 1572 dbSNP
rs976244249 1587 dbSNP
rs1264149754 1589 dbSNP
rs1471894987 1591 dbSNP
rs922892141 1599 dbSNP
rs1184885431 1604 dbSNP
rs1317827145 1613 dbSNP
rs1444821210 1622 dbSNP
rs545247052 1629 dbSNP
rs553989329 1632 dbSNP
rs1161720476 1636 dbSNP
rs146790236 1648 dbSNP
rs34663922 1655 dbSNP
rs572206383 1658 dbSNP
rs980362637 1660 dbSNP
rs542741046 1664 dbSNP
rs1454127789 1671 dbSNP
rs1365324403 1674 dbSNP
rs1156522374 1679 dbSNP
rs377651595 1681 dbSNP
rs942172695 1682 dbSNP
rs202177020 1694 dbSNP
rs192431149 1700 dbSNP
rs560774129 1703 dbSNP
rs1368708320 1716 dbSNP
rs942137811 1721 dbSNP
rs895319718 1724 dbSNP
rs1013639334 1727 dbSNP
rs1336164027 1728 dbSNP
rs531344906 1739 dbSNP
rs1243761161 1745 dbSNP
rs1235532877 1746 dbSNP
rs776862123 1750 dbSNP
rs999516763 1752 dbSNP
rs1382701193 1760 dbSNP
rs1386913280 1762 dbSNP
rs1296141821 1763 dbSNP
rs1418810109 1764 dbSNP
rs1028277158 1769 dbSNP
rs1228464831 1781 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Bonci D; Coppola V; Musumeci M; Addario A; et al.
- Nature medicine, 2008
MicroRNAs (miRNAs) are noncoding small RNAs that repress protein translation by targeting specific messenger RNAs. miR-15a and miR-16-1 act as putative tumor suppressors by targeting the oncogene BCL2. These miRNAs form a cluster at the chromosomal region 13q14, which is frequently deleted in cancer. Here, we report that the miR-15a and miR-16-1 cluster targets CCND1 (encoding cyclin D1) and WNT3A, which promotes several tumorigenic features such as survival, proliferation and invasion. In cancer cells of advanced prostate tumors, the miR-15a and miR-16 level is significantly decreased, whereas the expression of BCL2, CCND1 and WNT3A is inversely upregulated. Delivery of antagomirs specific for miR-15a and miR-16 to normal mouse prostate results in marked hyperplasia, and knockdown of miR-15a and miR-16 promotes survival, proliferation and invasiveness of untransformed prostate cells, which become tumorigenic in immunodeficient NOD-SCID mice. Conversely, reconstitution of miR-15a and miR-16-1 expression results in growth arrest, apoptosis and marked regression of prostate tumor xenografts. Altogether, we propose that miR-15a and miR-16 act as tumor suppressor genes in prostate cancer through the control of cell survival, proliferation and invasion. These findings have therapeutic implications and may be exploited for future treatment of prostate cancer.
LinkOut: [PMID: 18931683]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BxPC-3
Disease pancreatic carcinoma
Location of target site 3'UTR
Tools used in this research microRNA.org , miRanda , miRBase Target Database , PicTar , TargetBoost , TargetScan
Original Description (Extracted from the article) ... miR-15a and miR-214 were dysregulated in the tumor samples. This is the first time that miR-214 has been identified as aberrantly expressed in pancreatic cancer. In vitro experiments showed that overexpression of miR-15a inhibited the viability of pancreatic cancer cells,whereas overexpression of miR-214 decreased the sensitivity of the cells to gemcitabine (GEM). Furthermore, we identified WNT3A and FGF7 as potential targets of miR-15a and ING4 as a target of miR-214. ...

- Zhang XJ; Ye H; Zeng CW; He B; Zhang H; Chen YQ, 2010, Journal of hematology & oncology.

Article - Zhang XJ; Ye H; Zeng CW; He B; Zhang H; Chen YQ
- Journal of hematology & oncology, 2010
BACKGROUND: Recent reports indicate that microRNAs (miRNAs) play a critical role in malignancies. However, the role that miRNAs play in pancreatic cancer remains to be determined. The purpose of this study was to investigate aberrantly expressed miRNAs in pancreatic cancer tissues and demonstrate their roles in disease progression. RESULTS: We detected the expression patterns of miRNAs in 10 pancreatic cancer tissues and their adjacent benign tissues by quantitative real time-PCR (qRT-PCR) and found that miR-15a and miR-214 were dysregulated in the tumor samples. This is the first time that miR-214 has been identified as aberrantly expressed in pancreatic cancer. In vitro experiments showed that overexpression of miR-15a inhibited the viability of pancreatic cancer cells, whereas overexpression of miR-214 decreased the sensitivity of the cells to gemcitabine (GEM). Furthermore, we identified WNT3A and FGF7 as potential targets of miR-15a and ING4 as a target of miR-214. CONCLUSIONS: Aberrant expression of miRNAs such as miR-15a and miR-214 results in different cellular effects in pancreatic cancer. Downregulation of miR-15a might contribute to proliferation of pancreatic cancer cells, whereas upregulation of miR-214 in pancreatic cancer specimens might be related to the poor response of pancreatic cancer cells to chemotherapy. MiR-15a directly targets multiple genes relevant in pancreatic cancer, suggesting that it may serve as a novel therapeutic target for treatment of the disease.
LinkOut: [PMID: 21106054]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*