miRTarBase - #MIRT000364 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IGF1R   
Synonyms CD221, IGFIR, IGFR, JTK13
Description insulin like growth factor 1 receptor
Transcript NM_000875   
Expression
Putative miRNA Targets on IGF1R
3'UTR of IGF1R
(miRNA target sites are highlighted)
>IGF1R|NM_000875|3'UTR
   1 TCCTTGGATCCTGAATCTGTGCAAACAGTAACGTGTGCGCACGCGCAGCGGGGTGGGGGGGGAGAGAGAGTTTTAACAAT
  81 CCATTCACAAGCCTCCTGTACCTCAGTGGATCTTCAGAACTGCCCTTGCTGCCCGCGGGAGACAGCTTCTCTGCAGTAAA
 161 ACACATTTGGGATGTTCCTTTTTTCAATATGCAAGCAGCTTTTTATTCCCTGCCCAAACCCTTAACTGACATGGGCCTTT
 241 AAGAACCTTAATGACAACACTTAATAGCAACAGAGCACTTGAGAACCAGTCTCCTCACTCTGTCCCTGTCCTTCCCTGTT
 321 CTCCCTTTCTCTCTCCTCTCTGCTTCATAACGGAAAAATAATTGCCACAAGTCCAGCTGGGAAGCCCTTTTTATCAGTTT
 401 GAGGAAGTGGCTGTCCCTGTGGCCCCATCCAACCACTGTACACACCCGCCTGACACCGTGGGTCATTACAAAAAAACACG
 481 TGGAGATGGAAATTTTTACCTTTATCTTTCACCTTTCTAGGGACATGAAATTTACAAAGGGCCATCGTTCATCCAAGGCT
 561 GTTACCATTTTAACGCTGCCTAATTTTGCCAAAATCCTGAACTTTCTCCCTCATCGGCCCGGCGCTGATTCCTCGTGTCC
 641 GGAGGCATGGGTGAGCATGGCAGCTGGTTGCTCCATTTGAGAGACACGCTGGCGACACACTCCGTCCATCCGACTGCCCC
 721 TGCTGTGCTGCTCAAGGCCACAGGCACACAGGTCTCATTGCTTCTGACTAGATTATTATTTGGGGGAACTGGACACAATA
 801 GGTCTTTCTCTCAGTGAAGGTGGGGAGAAGCTGAACCGGCTTCCCTGCCCTGCCTCCCCAGCCCCCTGCCCAACCCCCAA
 881 GAATCTGGTGGCCATGGGCCCCGAAGCAGCCTGGCGGACAGGCTTGGAGTCAAGGGGCCCCATGCCTGCTTCTCTCCCAG
 961 CCCCAGCTCCCCCGCCCGCCCCCAAGGACACAGATGGGAAGGGGTTTCCAGGGACTCAGCCCCACTGTTGATGCAGGTTT
1041 GCAAGGAAAGAAATTCAAACACCACAACAGCAGTAAGAAGAAAAGCAGTCAATGGATTCAAGCATTCTAAGCTTTGTTGA
1121 CATTTTCTCTGTTCCTAGGACTTCTTCATGGGTCTTACAGTTCTATGTTAGACCATGAAACATTTGCATACACATCGTCT
1201 TTAATGTCACTTTTATAACTTTTTTACGGTTCAGATATTCATCTATACGTCTGTACAGAAAAAAAAAAGCTGCTATTTTT
1281 TTTGTTCTTGATCTTTGTGGATTTAATCTATGAAAACCTTCAGGTCCACCCTCTCCCCTTTCTGCTCACTCCAAGAAACT
1361 TCTTATGCTTTGTACTAGAGTGCGTGACTTTCTTCCTCTTTTCCCGGTAATGGATACTTCTATCACATAATTTGCCATGA
1441 ACTGTTGGATGCCTTTTTATAAATACATCCCCCATCCCTGCTCCCACCTGCCCCTTTAGTTGTTTTCTAACCCGTAGGCT
1521 CTCTGGGCACGAGGCAGAAAGCAGGCCGGGCACCCATCCTGAGAGGGCCGCGCTCCTCTCCCCAGCCTGCCCTCACAGCA
1601 TTGGAGCCTGTTACAGTGCAAGACATGATACAAACTCAGGTCAGAAAAACAAAGGTTAAATATTTCACACGTCTTTGTTC
1681 AGTGTTTCCACTCACCGTGGTTGAGAAGCCTCACCCTCTCTTTCCCTTGCCTTTGCTTAGGTTGTGACACACATATATAT
1761 ATATTTTTTTAATTCTTGGGTACAACAGCAGTGTTAACCGCAGACACTAGGCATTTGGATTACTATTTTTCTTAATGGCT
1841 ATTTAATCCTTCCATCCCACGAAAAACAGCTGCTGAGTCCAAGGGAGCAGCAGAGCGTGGTCCGGCAGGGCCTGTTGTGG
1921 CCCTCGCCACCCCCCTCACCGGACCGACTGACCTGTCTTTGGAACCAGAACATCCCAAGGGAACTCCTTCGCACTGGCGT
2001 TGAGTGGGACCCCGGGATCCAGGCTGGCCCAGGGCGGCACCCTCAGGGCTGTGCCCGCTGGAGTGCTAGGTGGAGGCAGC
2081 ACAGACGCCACGGTGGCCCAAGAGCCCCTTTGCTTCTTGCTGGGGGACCAGGGCTGTGGTGCTGGCCCACTTTCCCTCGG
2161 CCAGGAATCCAGGTCCTTGGGGCCCAGGGGTCTTGTCTTGTTTCATTTTTAGCACTTCTCACCAGAGAGATGACAGCACA
2241 AGAGTTGCTTCTGGGATAGAAATGTTTAGGAGTAAGAACAAAGCTGGGATACGGTGATTGCTAGTTGTGACTGAAGATTC
2321 AACACAGAAAAGAAAGTTTATACGGCTTTTTTGCTGGTCAGCAGTTTGTCCCACTGCTTTCTCTAGTCTCTATCCCATAG
2401 CGTGTTCCCTTTAAAAAAAAAAAAAAGGTATTATATGTAGGAGTTTTCTTTTAATTTATTTTGTGATAAATTACCAGTTT
2481 CAATCACTGTAGAAAAGCCCCATTATGAATTTAAATTTCAAGGAAAGGGTGTGTGTGTGTGTATGTGTGGGGTGTGTGTG
2561 TGTGAGAGTGATGGGACAGTTCTTGATTTTTTGGGTTTTTTTTCCCCCAAACATTTATCTACCTCACTCTTATTTTTTAT
2641 ATGTGTATATAGACAAAAGAATACATCTCACCTTTCTCAGCACCTGACAATAGGCCGTTGATACTGGTAACCTCATCCAC
2721 GCCACAGGCGCCACACCCAGGTGATGCAGGGGGAAGCCAGGCTGTATTCCGGGGTCAAAGCAACACTAACTCACCTCTCT
2801 GCTCATTTCAGACAGCTTGCCTTTTTCTGAGATGTCCTGTTTTGTGTTGCTTTTTTTGTTTTGTTTTCTATCTTGGTTTC
2881 CACCAAGGTGTTAGATTTCTCCTCCTCCTAGCCAGGTGGCCCTGTGAGGCCAACGAGGGCACCAGAGCACACCTGGGGGA
2961 GCCACCAGGCTGTCCCTGGCTGGTTGTCTTTGGAACAAACTGCTTCTGTGCAGATGGAATGACCAACACATTTCGTCCTT
3041 AAGAGAGCAGTGGTTCCTCAGGTTCTGAGGAGAGGAAGGTGTCCAGGCAGCACCATCTCTGTGCGAATCCCCAGGGTAAA
3121 GGCGTGGGGCATTGGGTTTGCTCCCCTTGCTGCTGCTCCATCCCTGCAGGAGGCTCGCGCTGAGGCAGGACCGTGCGGCC
3201 ATGGCTGCTGCATTCATTGAGCACAAAGGTGCAGCTGCAGCAGCAGCTGGAGAGCAAGAGTCACCCAGCCTGTGCGCCAG
3281 AATGCAGAGGCTCCTGACCTCACAGCCAGTCCCTGATAGAACACACGCAGGAGCAGAGTCCCCTCCCCCTCCAGGCTGCC
3361 CTCTCAACTTCTCCCTCACCTCCTTCCCTAGGGGTAGACAGAGATGTACCAAACCTTCCGGCTGGAAAGCCCAGTGGCCG
3441 GCGCCGAGGCTCGTGGCGTCACGCCCCCCCCGCCAGGGCTGTACCTCCGTCTCCCTGGTCCTGCTGCTCACAGGACAGAC
3521 GGCTCGCTCCCCTCTTCCAGCAGCTGCTCTTACAGGCACTGATGATTTCGCTGGGAAGTGTGGCGGGCAGCTTTGCCTAA
3601 GCGTGGATGGCTCCTCGGCAATTCCAGCCTAAGTGAAGGCGCTCAGGAGCCTCCTGCTGGAACGCGACCCATCTCTCCCA
3681 GGACCCCGGGGATCTTAAGGTCATTGAGAAATACTGTTGGATCAGGGTTTTGTTCTTCCACACTGTAGGTGACCCCTTGG
3761 AATAACGGCCTCTCCTCTCGTGCACATACCTACCGGTTTCCACAACTGGATTTCTACAGATCATTCAGCTGGTTATAAGG
3841 GTTTTGTTTAAACTGTCCGAGTTACTGATGTCATTTTGTTTTTGTTTTATGTAGGTAGCTTTTAAGTAGAAAACACTAAC
3921 AGTGTAGTGCCCATCATAGCAAATGCTTCAGAAACACCTCAATAAAAGAGAAAACTTGGCTTGTGTGATGGTGCAGTCAC
4001 TTTACTGGACCAACCCACCCACCTTGACTATACCAAGGCATCATCTATCCACAGTTCTAGCCTAACTTCATGCTGATTTC
4081 TCTGCCTCTTGATTTTTCTCTGTGTGTTCCAAATAATCTTAAGCTGAGTTGTGGCATTTTCCATGCAACCTCCTTCTGCC
4161 AGCAGCTCACACTGCTTGAAGTCATATGAACCACTGAGGCACATCATGGAATTGATGTGAGCATTAAGACGTTCTCCCAC
4241 ACAGCCCTTCCCTGAGGCAGCAGGAGCTGGTGTGTACTGGAGACACTGTTGAACTTGATCAAGACCCAGACCACCCCAGG
4321 TCTCCTTCGTGGGATGTCATGACGTTTGACATACCTTTGGAACGAGCCTCCTCCTTGGAAGATGGAAGACCGTGTTCGTG
4401 GCCGACCTGGCCTCTCCTGGCCTGTTTCTTAAGATGCGGAGTCACATTTCAATGGTACGAAAAGTGGCTTCGTAAAATAG
4481 AAGAGCAGTCACTGTGGAACTACCAAATGGCGAGATGCTCGGTGCACATTGGGGTGCTTTGGGATAAAAGATTTATGAGC
4561 CAACTATTCTCTGGCACCAGATTCTAGGCCAGTTTGTTCCACTGAAGCTTTTCCCACAGCAGTCCACCTCTGCAGGCTGG
4641 CAGCCGAATGGCTTGCCAGTGGCTCTGTGGCAAGATCACACTGAGATCGATGGGTGAGAAGGCTAGGATGCTTGTCTAGT
4721 GTTCTTAGCTGTCACGTTGGCTCCTTCCAGGGTGGCCAGACGGTGTTGGCCACTCCCTTCTAAAACACAGGCGCCCTCCT
4801 GGTGACAGTGACCCGCCGTGGTATGCCTTGGCCCATTCCAGCAGTCCCAGTTATGCATTTCAAGTTTGGGGTTTGTTCTT
4881 TTCGTTAATGTTCCTCTGTGTTGTCAGCTGTCTTCATTTCCTGGGCTAAGCAGCATTGGGAGATGTGGACCAGAGATCCA
4961 CTCCTTAAGAACCAGTGGCGAAAGACACTTTCTTTCTTCACTCTGAAGTAGCTGGTGGTACAAATGAGAACTTCAAGAGA
5041 GGATGTTATTTAGACTGAACCTCTGTTGCCAGAGATGCTGAAGATACAGACCTTGGACAGGTCAGAGGGTTTCATTTTTG
5121 GCCTTCATCTTAGATGACTGGTTGCGTCATTTGGAGAAGTGAGTGCTCCTTGATGGTGGAATGACCGGGTGGTGGGTACA
5201 GAACCATTGTCACAGGGATCCTGGCACAGAGAAGAGTTACGAGCAGCAGGGTGCAGGGCTTGGAAGGAATGTGGGCAAGG
5281 TTTTGAACTTGATTGTTCTTGAAGCTATCAGACCACATCGAGGCTCAGCAGTCATCCGTGGGCATTTGGTTTCAACAAAG
5361 AAACCTAACATCCTACTCTGGAAACTGATCTCGGAGTTAAGGCGAATTGTTCAAGAACACAAACTACATCGCACTCGTCA
5441 GTTGTCAGTTCTGGGGCATGACTTTAGCGTTTTGTTTCTGCGAGAACATAACGATCACTCATTTTTATGTCCCACGTGTG
5521 TGTGTCCGCATCTTTCTGGTCAACATTGTTTTAACTAGTCACTCATTAGCGTTTTCAATAGGGCTCTTAAGTCCAGTAGA
5601 TTACGGGTAGTCAGTTGACGAAGATCTGGTTTACAAGAACTAATTAAATGTTTCATTGCATTTTTGTAAGAACAGAATAA
5681 TTTTATAAAATGTTTGTAGTTTATAATTGCCGAAAATAATTTAAAGACACTTTTTTTTTCTCTGTGTGTGCAAATGTGTG
5761 TTTGTGATCCATTTTTTTTTTTTTTTTTTAGGACACCTGTTTACTAGCTAGCTTTACAATATGCCAAAAAAGGATTTCTC
5841 CCTGACCCCATCCGTGGTTCACCCTCTTTTCCCCCCATGCTTTTTGCCCTAGTTTATAACAAAGGAATGATGATGATTTA
5921 AAAAGTAGTTCTGTATCTTCAGTATCTTGGTCTTCCAGAACCCTCTGGTTGGGAAGGGGATCATTTTTTACTGGTCATTT
6001 CCCTTTGGAGTGTAGCTACTTTAACAGATGGAAAGAACCTCATTGGCCATGGAAACAGCCGAGGTGTTGGAGCCCAGCAG
6081 TGCATGGCACCGTTCGGCATCTGGCTTGATTGGTCTGGCTGCCGTCATTGTCAGCACAGTGCCATGGACATGGGAAGACT
6161 TGACTGCACAGCCAATGGTTTTCATGATGATTACAGCATACACAGTGATCACATAAACGATGACAGCTATGGGGCACACA
6241 GGCCATTTGCTTACATGCCTCGTATCATGACTGATTACTGCTTTGTTAGAACACAGAAGAGACCCTATTTTATTTAAGGC
6321 AGAACCCCGAAGATACGTATTTCCAATACAGAAAAGAATTTTTAATAAAAACTATAACATACACAAAAATTGGTTTTAAA
6401 GTTGACTCCACTTCCTCTAACTCCAGTGGATTGTTGGCCATGTCTCCCCAACTCCACAATATCTCTATCATGGGAAACAC
6481 CTGGGGTTTTTGCGCTACATAGGAGAAAGATCTGGAAACTATTTGGGTTTTGTTTTCAACTTTTCATTTGGATGTTTGGC
6561 GTTGCACACACACATCCACCGGTGGAAGAGACGCCCGGTGAAAACACCTGTCTGCTTTCTAAGCCAGTGAGGTTGAGGTG
6641 AGAGGTTTGCCAGAGTTTGTCTACCTCTGGGTATCCCTTTGTCTGGGATAAAAAAAATCAAACCAGAAGGCGGGATGGAA
6721 TGGATGCACCGCAAATAATGCATTTTCTGAGTTTTCTTGTTAAAAAAAAATTTTTTTAAGTAAGAAAAAAAAAGGTAATA
6801 ACATGGCCAATTTGTTACATAAAATGACTTTCTGTGTATAAATTATTCCTAAAAAATCCTGTTTATATAAAAAATCAGTA
6881 GATGAAAAAAATTTCAAAATGTTTTTGTATATTCTGTTGTAAGAATTTATTCCTGTTATTGCGATATACTCTGGATTCTT
6961 TACATAATGGAAAAAAGAAACTGTCTATTTTGAATGGCTGAAGCTAAGGCAACGTTAGTTTCTCTTACTCTGCTTTTTTC
7041 TAGTAAAGTACTACATGGTTTAAGTTAAATAAAATAATTCTGTATGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:|::  | |||||||| 
Target 5' gacACGCTGGCGACACACTCCg 3'
683 - 704 159.00 -17.90
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               |||| ||| |||| || 
Target 5' atccaACCACTGT-ACACACCc 3'
427 - 447 132.00 -17.00
3
miRNA  3' guUUGUG-GUAACAGUGUGAGGu 5'
            || |: |:  ||||||:|:| 
Target 5' ttAAGATGCGGAGTCACATTTCa 3'
4429 - 4451 128.00 -15.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
317464 16 ClinVar
886759 43 ClinVar
317465 44 ClinVar
886760 45 ClinVar
317466 50 ClinVar
317467 54 ClinVar
317468 55 ClinVar
317469 56 ClinVar
888034 56 ClinVar
317470 58 ClinVar
317471 62 ClinVar
888035 64 ClinVar
888036 84 ClinVar
317472 135 ClinVar
317473 150 ClinVar
317474 200 ClinVar
317475 214 ClinVar
884908 232 ClinVar
317476 252 ClinVar
884909 258 ClinVar
317477 292 ClinVar
884910 337 ClinVar
317478 347 ClinVar
884911 353 ClinVar
317479 363 ClinVar
317480 417 ClinVar
317481 448 ClinVar
885825 459 ClinVar
885826 503 ClinVar
885827 507 ClinVar
885828 575 ClinVar
885829 622 ClinVar
317482 625 ClinVar
317483 627 ClinVar
886830 636 ClinVar
317484 641 ClinVar
317485 642 ClinVar
886831 688 ClinVar
317486 713 ClinVar
317487 742 ClinVar
317488 807 ClinVar
317489 838 ClinVar
317490 862 ClinVar
317491 875 ClinVar
317492 911 ClinVar
317493 941 ClinVar
888101 978 ClinVar
888102 1016 ClinVar
317494 1043 ClinVar
888103 1065 ClinVar
317495 1088 ClinVar
317496 1151 ClinVar
884977 1153 ClinVar
317497 1155 ClinVar
884978 1187 ClinVar
317498 1229 ClinVar
317499 1230 ClinVar
317500 1259 ClinVar
317501 1259 ClinVar
317502 1263 ClinVar
884979 1288 ClinVar
317503 1331 ClinVar
317504 1361 ClinVar
317505 1362 ClinVar
885889 1384 ClinVar
885890 1407 ClinVar
317506 1426 ClinVar
885891 1513 ClinVar
317507 1514 ClinVar
885892 1544 ClinVar
886881 1549 ClinVar
886882 1556 ClinVar
317508 1573 ClinVar
886883 1579 ClinVar
317509 1601 ClinVar
886884 1618 ClinVar
317510 1669 ClinVar
886885 1672 ClinVar
317511 1682 ClinVar
317512 1725 ClinVar
317513 1753 ClinVar
317514 1753 ClinVar
317515 1764 ClinVar
888161 1764 ClinVar
317516 1766 ClinVar
888162 1768 ClinVar
888163 1800 ClinVar
888164 1824 ClinVar
317517 1857 ClinVar
885042 1886 ClinVar
317518 1898 ClinVar
317519 1905 ClinVar
317520 1926 ClinVar
317521 1932 ClinVar
885043 1933 ClinVar
317522 1946 ClinVar
317523 1992 ClinVar
317524 2000 ClinVar
317525 2065 ClinVar
885953 2088 ClinVar
885954 2129 ClinVar
885955 2213 ClinVar
317526 2225 ClinVar
317527 2297 ClinVar
317528 2344 ClinVar
317529 2345 ClinVar
317530 2380 ClinVar
317531 2413 ClinVar
886955 2415 ClinVar
886956 2427 ClinVar
317532 2428 ClinVar
317533 2429 ClinVar
317534 2444 ClinVar
317535 2529 ClinVar
886957 2572 ClinVar
886958 2596 ClinVar
886959 2597 ClinVar
317536 2608 ClinVar
886960 2640 ClinVar
888221 2686 ClinVar
317537 2719 ClinVar
317538 2791 ClinVar
888222 2809 ClinVar
888223 2813 ClinVar
317539 2851 ClinVar
317540 2851 ClinVar
317541 2856 ClinVar
888224 2881 ClinVar
317542 2953 ClinVar
317543 2999 ClinVar
317544 3020 ClinVar
885106 3042 ClinVar
885107 3073 ClinVar
317545 3075 ClinVar
885108 3114 ClinVar
317546 3130 ClinVar
317547 3166 ClinVar
885109 3193 ClinVar
317548 3198 ClinVar
317549 3200 ClinVar
886021 3201 ClinVar
886022 3251 ClinVar
886023 3253 ClinVar
886024 3300 ClinVar
886025 3303 ClinVar
317550 3328 ClinVar
317551 3334 ClinVar
317552 3339 ClinVar
317553 3365 ClinVar
887022 3381 ClinVar
887023 3421 ClinVar
317554 3441 ClinVar
317555 3446 ClinVar
317556 3458 ClinVar
317557 3459 ClinVar
317558 3464 ClinVar
317559 3464 ClinVar
317560 3471 ClinVar
888287 3472 ClinVar
317561 3490 ClinVar
888288 3527 ClinVar
888289 3564 ClinVar
317562 3585 ClinVar
317563 3617 ClinVar
885182 3621 ClinVar
885183 3625 ClinVar
885184 3642 ClinVar
885185 3654 ClinVar
885186 3665 ClinVar
885187 3689 ClinVar
317564 3715 ClinVar
317565 3728 ClinVar
317566 3767 ClinVar
886086 3794 ClinVar
317567 3819 ClinVar
886087 3856 ClinVar
317568 3875 ClinVar
886088 3981 ClinVar
317569 4000 ClinVar
317570 4001 ClinVar
317571 4081 ClinVar
887090 4150 ClinVar
317572 4173 ClinVar
317573 4187 ClinVar
317574 4232 ClinVar
887091 4330 ClinVar
887092 4350 ClinVar
317575 4352 ClinVar
317576 4392 ClinVar
888360 4393 ClinVar
888361 4404 ClinVar
317577 4405 ClinVar
888362 4407 ClinVar
888363 4438 ClinVar
317578 4439 ClinVar
317579 4440 ClinVar
885254 4446 ClinVar
317580 4459 ClinVar
317581 4467 ClinVar
317582 4495 ClinVar
885255 4513 ClinVar
317583 4514 ClinVar
317584 4522 ClinVar
317585 4530 ClinVar
886148 4553 ClinVar
317586 4600 ClinVar
317587 4642 ClinVar
317588 4646 ClinVar
886149 4692 ClinVar
317589 4753 ClinVar
317590 4762 ClinVar
886150 4763 ClinVar
887164 4766 ClinVar
317591 4793 ClinVar
317592 4815 ClinVar
317593 4816 ClinVar
317594 4817 ClinVar
887165 4818 ClinVar
887166 4836 ClinVar
887167 4858 ClinVar
317595 4862 ClinVar
317596 4890 ClinVar
888421 4921 ClinVar
317597 4981 ClinVar
888422 5003 ClinVar
888423 5093 ClinVar
888424 5145 ClinVar
317598 5147 ClinVar
317599 5152 ClinVar
317600 5153 ClinVar
885318 5158 ClinVar
885319 5167 ClinVar
885320 5188 ClinVar
317601 5228 ClinVar
317602 5310 ClinVar
885321 5327 ClinVar
886223 5405 ClinVar
317603 5429 ClinVar
317604 5437 ClinVar
317605 5459 ClinVar
886224 5469 ClinVar
886225 5482 ClinVar
317606 5489 ClinVar
317607 5516 ClinVar
887228 5517 ClinVar
887229 5519 ClinVar
887230 5528 ClinVar
887231 5529 ClinVar
317608 5566 ClinVar
317609 5571 ClinVar
317610 5572 ClinVar
317611 5634 ClinVar
888482 5640 ClinVar
317612 5694 ClinVar
888483 5709 ClinVar
317613 5713 ClinVar
317614 5717 ClinVar
317615 5719 ClinVar
317616 5730 ClinVar
317617 5731 ClinVar
317618 5731 ClinVar
317619 5736 ClinVar
317620 5740 ClinVar
317621 5743 ClinVar
884254 5750 ClinVar
884255 5763 ClinVar
317622 5771 ClinVar
317623 5772 ClinVar
317624 5772 ClinVar
317625 5790 ClinVar
317626 5792 ClinVar
884256 5866 ClinVar
884257 5878 ClinVar
884258 5910 ClinVar
317627 5927 ClinVar
317628 6029 ClinVar
886285 6070 ClinVar
886286 6077 ClinVar
317629 6092 ClinVar
317630 6093 ClinVar
886287 6096 ClinVar
317631 6097 ClinVar
886288 6124 ClinVar
317632 6125 ClinVar
887287 6145 ClinVar
317633 6167 ClinVar
887288 6176 ClinVar
317634 6187 ClinVar
317635 6233 ClinVar
317636 6264 ClinVar
317637 6272 ClinVar
887289 6307 ClinVar
317638 6308 ClinVar
317639 6309 ClinVar
888534 6330 ClinVar
888535 6346 ClinVar
317640 6494 ClinVar
888536 6500 ClinVar
317641 6521 ClinVar
888537 6541 ClinVar
317642 6569 ClinVar
888538 6579 ClinVar
317643 6581 ClinVar
317644 6582 ClinVar
317645 6632 ClinVar
884325 6639 ClinVar
317646 6690 ClinVar
317647 6701 ClinVar
317648 6732 ClinVar
317649 6747 ClinVar
317650 6771 ClinVar
317651 6772 ClinVar
317652 6781 ClinVar
317653 6782 ClinVar
317654 6785 ClinVar
317655 6785 ClinVar
317656 6876 ClinVar
317657 6891 ClinVar
317658 6898 ClinVar
317659 6902 ClinVar
886346 6934 ClinVar
886347 6943 ClinVar
317660 6970 ClinVar
317661 6975 ClinVar
317662 6975 ClinVar
887341 7012 ClinVar
317663 7042 ClinVar
COSN30477577 3 COSMIC
COSN31493340 8 COSMIC
COSN20048285 13 COSMIC
COSN18739201 25 COSMIC
COSN30526724 38 COSMIC
COSN30494117 43 COSMIC
COSN31549789 47 COSMIC
COSN30519596 51 COSMIC
COSN1692334 52 COSMIC
COSN30529831 55 COSMIC
COSN9091622 56 COSMIC
COSN30102750 60 COSMIC
COSN30110278 60 COSMIC
COSN28839226 63 COSMIC
COSN28850606 64 COSMIC
COSN30156425 65 COSMIC
COSN508726 65 COSMIC
COSN30481850 82 COSMIC
COSN30519812 101 COSMIC
COSN30461168 134 COSMIC
COSN31527457 150 COSMIC
COSN26669515 165 COSMIC
COSN31575829 179 COSMIC
COSN24913652 209 COSMIC
COSN1182792 286 COSMIC
COSN20112435 418 COSMIC
COSN31533993 521 COSMIC
COSN31561811 575 COSMIC
COSN5215110 625 COSMIC
COSN28681457 705 COSMIC
COSN6643890 911 COSMIC
COSN5758333 973 COSMIC
COSN32056841 998 COSMIC
COSN31565825 1020 COSMIC
COSN27998974 1081 COSMIC
COSN1692335 1153 COSMIC
COSN30539352 1174 COSMIC
COSN26097720 1224 COSMIC
COSN26584641 1228 COSMIC
COSN20112439 1269 COSMIC
COSN27520754 1269 COSMIC
COSN31529970 1363 COSMIC
COSN22059432 1368 COSMIC
COSN29368096 1378 COSMIC
COSN31594997 1406 COSMIC
COSN22423716 1454 COSMIC
COSN31486710 1719 COSMIC
COSN26679483 1873 COSMIC
COSN26555993 1901 COSMIC
COSN31486729 1926 COSMIC
COSN31544192 1959 COSMIC
COSN31579166 1977 COSMIC
COSN31611268 2037 COSMIC
COSN8817511 2064 COSMIC
COSN28744275 2076 COSMIC
COSN28202029 2089 COSMIC
COSN31588874 2092 COSMIC
COSN22594101 2097 COSMIC
COSN30174086 2137 COSMIC
COSN20112440 2427 COSMIC
COSN20112441 2427 COSMIC
COSN20112444 2542 COSMIC
COSN8484490 2564 COSMIC
COSN20112448 2609 COSMIC
COSN21873532 2643 COSMIC
COSN6079152 2670 COSMIC
COSN25290738 2721 COSMIC
COSN28667939 2784 COSMIC
COSN28201735 2790 COSMIC
COSN20112449 2858 COSMIC
COSN20112450 2859 COSMIC
COSN32056396 2939 COSMIC
COSN20112452 3021 COSMIC
COSN27353162 3111 COSMIC
COSN29409351 3112 COSMIC
COSN29414690 3113 COSMIC
COSN8390815 3124 COSMIC
COSN17013737 3130 COSMIC
COSN7297117 3185 COSMIC
COSN20112453 3404 COSMIC
COSN24680606 3420 COSMIC
COSN28717732 3459 COSMIC
COSN31551375 3472 COSMIC
COSN26637768 3473 COSMIC
COSN31603389 3497 COSMIC
COSN15668272 3538 COSMIC
COSN20112454 3576 COSMIC
COSN31591071 3585 COSMIC
COSN31512976 3603 COSMIC
COSN31488637 3645 COSMIC
COSN28676187 3767 COSMIC
COSN9642502 3792 COSMIC
COSN26670656 3828 COSMIC
COSN27093686 3837 COSMIC
COSN31544897 3866 COSMIC
COSN31571450 3914 COSMIC
COSN31480292 3952 COSMIC
COSN28790772 4001 COSMIC
COSN31529959 4081 COSMIC
COSN31568907 4099 COSMIC
COSN30160472 4127 COSMIC
COSN31608485 4254 COSMIC
COSN31533683 4344 COSMIC
COSN22979720 4498 COSMIC
COSN6643891 4646 COSMIC
COSN22975269 4771 COSMIC
COSN22266189 4988 COSMIC
COSN5404272 5010 COSMIC
COSN23515227 5097 COSMIC
COSN31518937 5147 COSMIC
COSN30163986 5201 COSMIC
COSN31533997 5222 COSMIC
COSN16501589 5242 COSMIC
COSN32062675 5244 COSMIC
COSN31542872 5533 COSMIC
COSN25625659 5535 COSMIC
COSN18937086 5540 COSMIC
COSN6079153 5586 COSMIC
COSN31489800 5592 COSMIC
COSN7297118 5605 COSMIC
COSN31563059 5624 COSMIC
COSN31552110 5678 COSMIC
COSN31584538 5713 COSMIC
COSN31589788 5740 COSMIC
COSN20112456 5789 COSMIC
COSN20112455 5790 COSMIC
COSN31609342 5839 COSMIC
COSN25112723 6014 COSMIC
COSN6079154 6015 COSMIC
COSN17181859 6024 COSMIC
COSN1692336 6210 COSMIC
COSN31961139 6494 COSMIC
COSN31529122 6521 COSMIC
COSN31607914 6542 COSMIC
COSN21991351 6554 COSMIC
COSN23688782 6568 COSMIC
COSN24527903 6591 COSMIC
COSN21905302 6654 COSMIC
COSN23542747 6771 COSMIC
COSN31548467 6775 COSMIC
COSN30169814 6882 COSMIC
COSN22900589 6892 COSMIC
COSN31566437 7081 COSMIC
COSN1692338 7083 COSMIC
rs702497 911 GWAS
rs2684788 3767 GWAS
rs2654980 4173 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768174302 2 dbSNP
rs571409547 3 dbSNP
rs1311150402 5 dbSNP
rs372067555 9 dbSNP
rs1377293987 11 dbSNP
rs1449431063 13 dbSNP
rs984958335 15 dbSNP
rs45561434 16 dbSNP
rs1285151604 18 dbSNP
rs763192319 20 dbSNP
rs1216741472 21 dbSNP
rs1298784882 22 dbSNP
rs367953477 23 dbSNP
rs45561034 29 dbSNP
rs768200688 33 dbSNP
rs367730194 34 dbSNP
rs1326638536 35 dbSNP
rs1006078516 36 dbSNP
rs765874885 39 dbSNP
rs375917086 40 dbSNP
rs754564853 41 dbSNP
rs375178223 43 dbSNP
rs56403719 44 dbSNP
rs771268141 45 dbSNP
rs542627412 46 dbSNP
rs1457530119 49 dbSNP
rs199998842 50 dbSNP
rs753277045 50 dbSNP
rs377156732 51 dbSNP
rs749479928 52 dbSNP
rs937851824 53 dbSNP
rs1056264069 54 dbSNP
rs201734173 55 dbSNP
rs542573464 55 dbSNP
rs140896443 56 dbSNP
rs3825954 57 dbSNP
rs45480091 58 dbSNP
rs1029860673 59 dbSNP
rs138593519 60 dbSNP
rs1198090028 61 dbSNP
rs943659759 61 dbSNP
rs370196264 62 dbSNP
rs760763476 62 dbSNP
rs946712156 62 dbSNP
rs1239496047 63 dbSNP
rs886051562 63 dbSNP
rs532740682 64 dbSNP
rs1372650592 66 dbSNP
rs979424844 67 dbSNP
rs1273537158 68 dbSNP
rs1458499347 71 dbSNP
rs1462521055 71 dbSNP
rs926610794 72 dbSNP
rs1363685768 75 dbSNP
rs933014637 76 dbSNP
rs1444733004 80 dbSNP
rs1399825705 83 dbSNP
rs1337638051 87 dbSNP
rs1404258667 92 dbSNP
rs1047491214 93 dbSNP
rs541224051 99 dbSNP
rs764116020 108 dbSNP
rs1171887061 113 dbSNP
rs938151068 116 dbSNP
rs1065304 119 dbSNP
rs1065305 120 dbSNP
rs886213945 121 dbSNP
rs1056458444 124 dbSNP
rs1438545903 125 dbSNP
rs1380246501 128 dbSNP
rs55945252 135 dbSNP
rs185135822 136 dbSNP
rs895060176 137 dbSNP
rs549027440 138 dbSNP
rs1355038328 139 dbSNP
rs1006542506 142 dbSNP
rs1288918862 147 dbSNP
rs886051563 150 dbSNP
rs1017309387 151 dbSNP
rs900148458 160 dbSNP
rs1450500127 161 dbSNP
rs1338963798 164 dbSNP
rs1024898041 171 dbSNP
rs1358008771 175 dbSNP
rs1222378163 177 dbSNP
rs1420138814 179 dbSNP
rs1264453829 184 dbSNP
rs757158399 187 dbSNP
rs1385351221 191 dbSNP
rs765116736 197 dbSNP
rs981424699 199 dbSNP
rs886051564 200 dbSNP
rs1487054776 207 dbSNP
rs560852434 211 dbSNP
rs750280890 214 dbSNP
rs1030057900 216 dbSNP
rs1488822067 218 dbSNP
rs956160218 222 dbSNP
rs758097567 223 dbSNP
rs1215111062 231 dbSNP
rs914688216 232 dbSNP
rs988271453 233 dbSNP
rs1377231488 243 dbSNP
rs1165625851 248 dbSNP
rs1283891946 248 dbSNP
rs188624230 252 dbSNP
rs1342168338 255 dbSNP
rs968365498 258 dbSNP
rs1166279332 259 dbSNP
rs1350452307 259 dbSNP
rs980092057 261 dbSNP
rs550045850 265 dbSNP
rs1412533322 266 dbSNP
rs1265830747 268 dbSNP
rs534281286 268 dbSNP
rs926670882 269 dbSNP
rs571405895 275 dbSNP
rs975371425 277 dbSNP
rs1223858329 282 dbSNP
rs1346855437 287 dbSNP
rs558809166 292 dbSNP
rs917958975 295 dbSNP
rs1320323658 298 dbSNP
rs1288048848 300 dbSNP
rs181294939 302 dbSNP
rs35913807 303 dbSNP
rs929147935 303 dbSNP
rs1047459567 305 dbSNP
rs565858876 306 dbSNP
rs1295228682 316 dbSNP
rs1312350457 319 dbSNP
rs878891675 324 dbSNP
rs1331557992 325 dbSNP
rs755876806 325 dbSNP
rs779698941 328 dbSNP
rs1466832391 329 dbSNP
rs1421082842 336 dbSNP
rs909035373 336 dbSNP
rs746689600 337 dbSNP
rs1193451086 339 dbSNP
rs1287401348 339 dbSNP
rs1039350425 344 dbSNP
rs1037458308 345 dbSNP
rs900179191 346 dbSNP
rs34336558 347 dbSNP
rs554580628 348 dbSNP
rs576962850 352 dbSNP
rs183939661 353 dbSNP
rs891518523 359 dbSNP
rs1217434005 360 dbSNP
rs886051565 363 dbSNP
rs906473151 365 dbSNP
rs1185673857 366 dbSNP
rs1448425123 368 dbSNP
rs1330271617 369 dbSNP
rs1009983169 371 dbSNP
rs1002822738 380 dbSNP
rs1031673659 385 dbSNP
rs780579951 386 dbSNP
rs867905412 388 dbSNP
rs1431924985 392 dbSNP
rs1395075840 402 dbSNP
rs34308422 415 dbSNP
rs968617187 416 dbSNP
rs45484096 417 dbSNP
rs759305154 417 dbSNP
rs3833015 418 dbSNP
rs1236526790 420 dbSNP
rs990161996 424 dbSNP
rs1483429908 431 dbSNP
rs559211045 433 dbSNP
rs771410531 434 dbSNP
rs965218160 443 dbSNP
rs974963874 447 dbSNP
rs555948484 448 dbSNP
rs933593686 449 dbSNP
rs1380953768 454 dbSNP
rs1304949121 456 dbSNP
rs983111461 458 dbSNP
rs35109554 459 dbSNP
rs559962701 463 dbSNP
rs1446911132 465 dbSNP
rs572204601 470 dbSNP
rs542735046 476 dbSNP
rs1037825036 480 dbSNP
rs560911660 481 dbSNP
rs865863822 488 dbSNP
rs1286578305 489 dbSNP
rs1218745818 492 dbSNP
rs1351472862 493 dbSNP
rs1259608685 503 dbSNP
rs947860110 505 dbSNP
rs746281645 507 dbSNP
rs1313158728 516 dbSNP
rs1310147573 518 dbSNP
rs932985724 524 dbSNP
rs1355254559 532 dbSNP
rs1299297189 538 dbSNP
rs906459676 541 dbSNP
rs999361213 542 dbSNP
rs1261524792 543 dbSNP
rs1158051644 545 dbSNP
rs377343628 547 dbSNP
rs35805107 548 dbSNP
rs1234668184 551 dbSNP
rs1010027063 555 dbSNP
rs1263591128 556 dbSNP
rs1468590716 559 dbSNP
rs1487261181 561 dbSNP
rs1261038226 562 dbSNP
rs1043188453 566 dbSNP
rs149544474 567 dbSNP
rs1001420512 575 dbSNP
rs565202200 576 dbSNP
rs1173923162 583 dbSNP
rs532278272 597 dbSNP
rs1428220192 598 dbSNP
rs200046471 600 dbSNP
rs1465787392 601 dbSNP
rs1339081010 602 dbSNP
rs1318252137 603 dbSNP
rs147189739 605 dbSNP
rs1033950422 606 dbSNP
rs1426615609 607 dbSNP
rs1440750120 611 dbSNP
rs772449987 613 dbSNP
rs1022110518 616 dbSNP
rs775653652 617 dbSNP
rs1424680609 619 dbSNP
rs1172550722 620 dbSNP
rs140463146 621 dbSNP
rs1030538051 622 dbSNP
rs565525294 624 dbSNP
rs35922962 625 dbSNP
rs34804698 627 dbSNP
rs1219463039 628 dbSNP
rs574344878 635 dbSNP
rs17847204 636 dbSNP
rs369718719 640 dbSNP
rs886051566 641 dbSNP
rs886051567 642 dbSNP
rs947861410 645 dbSNP
rs1046576505 649 dbSNP
rs1301324056 652 dbSNP
rs1440351095 655 dbSNP
rs927768893 658 dbSNP
rs912934521 660 dbSNP
rs1490812674 662 dbSNP
rs1197057809 664 dbSNP
rs55939798 667 dbSNP
rs1042833505 668 dbSNP
rs1176396167 676 dbSNP
rs1172990213 679 dbSNP
rs1477994218 684 dbSNP
rs529711304 688 dbSNP
rs771604620 689 dbSNP
rs937095858 690 dbSNP
rs537467556 694 dbSNP
rs1164836560 695 dbSNP
rs1436392087 703 dbSNP
rs373494765 704 dbSNP
rs558648364 705 dbSNP
rs776636567 708 dbSNP
rs868391585 710 dbSNP
rs1377770005 711 dbSNP
rs12442522 712 dbSNP
rs534991383 713 dbSNP
rs1005268207 715 dbSNP
rs1416030711 716 dbSNP
rs1301744808 718 dbSNP
rs900580538 721 dbSNP
rs1419723481 728 dbSNP
rs28457673 732 dbSNP
rs1272177510 734 dbSNP
rs1469296346 735 dbSNP
rs1337635383 737 dbSNP
rs963823787 741 dbSNP
rs761776315 742 dbSNP
rs1028868880 743 dbSNP
rs1460918614 750 dbSNP
rs1361582549 753 dbSNP
rs1444502958 754 dbSNP
rs954829552 756 dbSNP
rs1255962784 757 dbSNP
rs954517399 758 dbSNP
rs1488514813 762 dbSNP
rs1005071165 765 dbSNP
rs1288220548 769 dbSNP
rs1015164148 772 dbSNP
rs1195006430 777 dbSNP
rs1350229392 779 dbSNP
rs913132452 789 dbSNP
rs945709235 790 dbSNP
rs963651741 795 dbSNP
rs1312158102 802 dbSNP
rs371787961 803 dbSNP
rs973469772 805 dbSNP
rs886051568 807 dbSNP
rs1399619720 809 dbSNP
rs978865451 811 dbSNP
rs925624658 813 dbSNP
rs1473954578 816 dbSNP
rs1416099374 820 dbSNP
rs1187734542 821 dbSNP
rs1488898641 822 dbSNP
rs1474859606 830 dbSNP
rs1182007343 833 dbSNP
rs937126798 836 dbSNP
rs886051569 838 dbSNP
rs765312779 839 dbSNP
rs1446516836 843 dbSNP
rs1290802714 846 dbSNP
rs528959549 852 dbSNP
rs969469674 854 dbSNP
rs981857740 856 dbSNP
rs1333017514 857 dbSNP
rs1219082387 862 dbSNP
rs1365462101 862 dbSNP
rs886051570 862 dbSNP
rs1342223445 868 dbSNP
rs1401672585 869 dbSNP
rs1320662608 873 dbSNP
rs34875596 875 dbSNP
rs1430270473 876 dbSNP
rs949516053 878 dbSNP
rs1393343994 879 dbSNP
rs1315888757 880 dbSNP
rs1478357957 881 dbSNP
rs1422202597 888 dbSNP
rs1185311497 894 dbSNP
rs1385096017 896 dbSNP
rs1247333861 897 dbSNP
rs1243824156 903 dbSNP
rs867795223 904 dbSNP
rs702497 911 dbSNP
rs935148227 916 dbSNP
rs1293301121 917 dbSNP
rs1005121538 919 dbSNP
rs1406005079 920 dbSNP
rs1281881014 925 dbSNP
rs1016700206 928 dbSNP
rs537769685 938 dbSNP
rs899161150 938 dbSNP
rs987964010 940 dbSNP
rs180897656 941 dbSNP
rs946696610 944 dbSNP
rs1029046122 947 dbSNP
rs1210401728 952 dbSNP
rs1040028545 958 dbSNP
rs770677395 962 dbSNP
rs1426557347 963 dbSNP
rs1195505308 966 dbSNP
rs1452672298 967 dbSNP
rs576022812 974 dbSNP
rs931988325 975 dbSNP
rs148538142 978 dbSNP
rs967725128 979 dbSNP
rs1312691649 980 dbSNP
rs1280659740 982 dbSNP
rs564705839 983 dbSNP
rs1369642690 985 dbSNP
rs890565985 986 dbSNP
rs1370790847 992 dbSNP
rs1296798537 1002 dbSNP
rs978700572 1004 dbSNP
rs1360193106 1005 dbSNP
rs1176101870 1006 dbSNP
rs532473443 1008 dbSNP
rs958365181 1009 dbSNP
rs1159378686 1010 dbSNP
rs991201469 1011 dbSNP
rs1470778383 1014 dbSNP
rs527317156 1016 dbSNP
rs1383240430 1018 dbSNP
rs1208681825 1021 dbSNP
rs1347113254 1022 dbSNP
rs540920136 1025 dbSNP
rs949567248 1026 dbSNP
rs1046576131 1029 dbSNP
rs899408902 1032 dbSNP
rs571119243 1033 dbSNP
rs908030439 1033 dbSNP
rs1380387106 1036 dbSNP
rs1337677095 1039 dbSNP
rs995066839 1040 dbSNP
rs1375430599 1042 dbSNP
rs886051571 1043 dbSNP
rs780750358 1046 dbSNP
rs559171016 1056 dbSNP
rs1362221187 1059 dbSNP
rs1424137788 1060 dbSNP
rs899166991 1060 dbSNP
rs1336346925 1064 dbSNP
rs996150183 1065 dbSNP
rs747653803 1066 dbSNP
rs1263902581 1078 dbSNP
rs2016873 1088 dbSNP
rs1034719729 1089 dbSNP
rs890575821 1090 dbSNP
rs956490006 1094 dbSNP
rs779344140 1095 dbSNP
rs1459681972 1100 dbSNP
rs1008969535 1102 dbSNP
rs1323190055 1107 dbSNP
rs987932987 1108 dbSNP
rs1231912538 1113 dbSNP
rs1250605579 1122 dbSNP
rs1438956269 1123 dbSNP
rs915035748 1128 dbSNP
rs946549810 1131 dbSNP
rs975327900 1135 dbSNP
rs1382925778 1136 dbSNP
rs1469969558 1141 dbSNP
rs1458584936 1142 dbSNP
rs921198812 1148 dbSNP
rs547944915 1151 dbSNP
rs142778685 1153 dbSNP
rs1336227988 1155 dbSNP
rs1424190751 1155 dbSNP
rs886051572 1155 dbSNP
rs1051792191 1158 dbSNP
rs890535023 1161 dbSNP
rs1260404384 1164 dbSNP
rs940792916 1166 dbSNP
rs1469528450 1172 dbSNP
rs1270885448 1174 dbSNP
rs1036458290 1176 dbSNP
rs991086758 1177 dbSNP
rs1335046905 1183 dbSNP
rs899305473 1187 dbSNP
rs971143198 1188 dbSNP
rs995434194 1197 dbSNP
rs746408628 1198 dbSNP
rs940834150 1205 dbSNP
rs905471592 1211 dbSNP
rs1400717173 1217 dbSNP
rs1038359761 1220 dbSNP
rs1169476229 1220 dbSNP
rs879354104 1220 dbSNP
rs1003155778 1223 dbSNP
rs1372496804 1225 dbSNP
rs1034687219 1227 dbSNP
rs1198866688 1228 dbSNP
rs187193143 1229 dbSNP
rs886051573 1230 dbSNP
rs552573684 1239 dbSNP
rs967883438 1249 dbSNP
rs1249101681 1250 dbSNP
rs1197988593 1254 dbSNP
rs975675431 1257 dbSNP
rs1183216263 1259 dbSNP
rs1235041489 1259 dbSNP
rs1338016254 1259 dbSNP
rs1350184027 1259 dbSNP
rs397772788 1259 dbSNP
rs886051574 1259 dbSNP
rs1482999815 1260 dbSNP
rs1301392576 1261 dbSNP
rs886051575 1263 dbSNP
rs1041790839 1268 dbSNP
rs1200685989 1268 dbSNP
rs1440414555 1268 dbSNP
rs1330629435 1271 dbSNP
rs1389463738 1272 dbSNP
rs1395608598 1273 dbSNP
rs903018872 1275 dbSNP
rs1436000868 1284 dbSNP
rs1479628870 1285 dbSNP
rs1172534391 1286 dbSNP
rs1175634262 1288 dbSNP
rs1373817548 1291 dbSNP
rs1463609213 1292 dbSNP
rs1166207324 1294 dbSNP
rs1395736736 1298 dbSNP
rs1000010021 1299 dbSNP
rs570747506 1306 dbSNP
rs1343422294 1312 dbSNP
rs921176328 1319 dbSNP
rs955505031 1322 dbSNP
rs1250374469 1327 dbSNP
rs894420581 1328 dbSNP
rs1295881282 1331 dbSNP
rs886051576 1331 dbSNP
rs987465085 1335 dbSNP
rs1012767296 1339 dbSNP
rs1233743346 1341 dbSNP
rs1351585906 1348 dbSNP
rs1308874569 1349 dbSNP
rs535387838 1352 dbSNP
rs564068661 1361 dbSNP
rs886051577 1362 dbSNP
rs1250267522 1364 dbSNP
rs763459017 1367 dbSNP
rs1416525945 1369 dbSNP
rs773305365 1373 dbSNP
rs1311742084 1375 dbSNP
rs940686717 1376 dbSNP
rs1036426701 1381 dbSNP
rs1325912499 1383 dbSNP
rs531446958 1384 dbSNP
rs930814276 1385 dbSNP
rs1045674517 1393 dbSNP
rs1363561112 1394 dbSNP
rs1189165452 1397 dbSNP
rs1262754245 1397 dbSNP
rs1256025339 1399 dbSNP
rs768798339 1400 dbSNP
rs1210174605 1405 dbSNP
rs973628190 1406 dbSNP
rs1286554922 1407 dbSNP
rs1203587110 1409 dbSNP
rs1350297683 1411 dbSNP
rs1293669503 1413 dbSNP
rs1234983784 1416 dbSNP
rs1353414138 1421 dbSNP
rs1292613554 1422 dbSNP
rs568728361 1423 dbSNP
rs34237671 1426 dbSNP
rs1315668631 1428 dbSNP
rs1003712863 1435 dbSNP
rs932262470 1438 dbSNP
rs368373122 1439 dbSNP
rs911904498 1445 dbSNP
rs1416261834 1451 dbSNP
rs1187901208 1453 dbSNP
rs944651525 1468 dbSNP
rs1243900545 1470 dbSNP
rs892101630 1473 dbSNP
rs1425310623 1474 dbSNP
rs1165396713 1475 dbSNP
rs1215271512 1481 dbSNP
rs776748021 1487 dbSNP
rs1332445086 1492 dbSNP
rs1042212608 1499 dbSNP
rs1215065547 1502 dbSNP
rs1423827830 1507 dbSNP
rs1364059946 1512 dbSNP
rs761746135 1513 dbSNP
rs886051578 1514 dbSNP
rs936070303 1515 dbSNP
rs35499594 1517 dbSNP
rs1463304020 1519 dbSNP
rs1294339152 1520 dbSNP
rs1054319060 1521 dbSNP
rs1411006829 1522 dbSNP
rs1422359687 1524 dbSNP
rs1184793788 1525 dbSNP
rs894296439 1528 dbSNP
rs557247249 1531 dbSNP
rs968228586 1532 dbSNP
rs996681967 1535 dbSNP
rs192125453 1544 dbSNP
rs543136473 1545 dbSNP
rs372831031 1548 dbSNP
rs558567171 1549 dbSNP
rs1270810552 1551 dbSNP
rs1357896119 1558 dbSNP
rs1213422249 1565 dbSNP
rs569497481 1570 dbSNP
rs576763044 1571 dbSNP
rs773215731 1572 dbSNP
rs886051579 1573 dbSNP
rs1293306911 1574 dbSNP
rs953493286 1579 dbSNP
rs986384919 1581 dbSNP
rs1168983127 1586 dbSNP
rs540579334 1588 dbSNP
rs1185476270 1595 dbSNP
rs764644785 1596 dbSNP
rs1175666578 1597 dbSNP
rs912126048 1599 dbSNP
rs181790105 1601 dbSNP
rs944703588 1602 dbSNP
rs920682494 1603 dbSNP
rs930762904 1608 dbSNP
rs1045158697 1611 dbSNP
rs867357964 1612 dbSNP
rs1485985145 1613 dbSNP
rs1231533121 1615 dbSNP
rs1281828188 1615 dbSNP
rs926751570 1616 dbSNP
rs762997187 1619 dbSNP
rs1307283770 1625 dbSNP
rs766262256 1630 dbSNP
rs1376023656 1632 dbSNP
rs529909257 1641 dbSNP
rs1206478622 1649 dbSNP
rs1296850651 1652 dbSNP
rs1409729997 1653 dbSNP
rs936138005 1656 dbSNP
rs1314749769 1661 dbSNP
rs541647710 1669 dbSNP
rs751376408 1671 dbSNP
rs1319510129 1672 dbSNP
rs939533678 1675 dbSNP
rs1405489489 1678 dbSNP
rs563320260 1682 dbSNP
rs915750719 1688 dbSNP
rs531074456 1695 dbSNP
rs1056617821 1697 dbSNP
rs948515343 1698 dbSNP
rs1045639578 1704 dbSNP
rs1381307094 1708 dbSNP
rs1305301245 1711 dbSNP
rs1228168445 1714 dbSNP
rs1228234850 1715 dbSNP
rs1308262275 1716 dbSNP
rs1412964978 1718 dbSNP
rs1319106856 1721 dbSNP
rs1455526631 1724 dbSNP
rs34718548 1725 dbSNP
rs1158062658 1727 dbSNP
rs1461783385 1728 dbSNP
rs1469216188 1729 dbSNP
rs151043735 1731 dbSNP
rs530384919 1732 dbSNP
rs1043815112 1741 dbSNP
rs903597361 1743 dbSNP
rs1461921439 1744 dbSNP
rs1187823995 1747 dbSNP
rs898148585 1747 dbSNP
rs1267116442 1748 dbSNP
rs1208445806 1749 dbSNP
rs1275482146 1751 dbSNP
rs1335953435 1751 dbSNP
rs1028451939 1753 dbSNP
rs1191260700 1753 dbSNP
rs1296381978 1753 dbSNP
rs760831806 1753 dbSNP
rs886051580 1753 dbSNP
rs996960045 1755 dbSNP
rs185988373 1757 dbSNP
rs953545837 1760 dbSNP
rs1162589655 1761 dbSNP
rs1457335012 1762 dbSNP
rs1019110738 1764 dbSNP
rs1373576778 1764 dbSNP
rs566846860 1764 dbSNP
rs886051581 1764 dbSNP
rs397836918 1765 dbSNP
rs533982384 1766 dbSNP
rs1015509367 1768 dbSNP
rs1208495373 1773 dbSNP
rs1356186022 1780 dbSNP
rs34756950 1784 dbSNP
rs536133709 1787 dbSNP
rs924668833 1788 dbSNP
rs1297013639 1789 dbSNP
rs1441890442 1790 dbSNP
rs972088959 1791 dbSNP
rs957566731 1794 dbSNP
rs1028029888 1799 dbSNP
rs377247844 1800 dbSNP
rs981233780 1801 dbSNP
rs1460439441 1806 dbSNP
rs926727333 1808 dbSNP
rs1173779326 1819 dbSNP
rs139984519 1824 dbSNP
rs992315019 1827 dbSNP
rs1197134172 1835 dbSNP
rs143945545 1838 dbSNP
rs1251825993 1840 dbSNP
rs1358080854 1840 dbSNP
rs945670639 1849 dbSNP
rs1058696 1857 dbSNP
rs1482389173 1861 dbSNP
rs903482893 1862 dbSNP
rs932354829 1873 dbSNP
rs1299270161 1879 dbSNP
rs1376102120 1881 dbSNP
rs928470890 1885 dbSNP
rs34530803 1886 dbSNP
rs1232205770 1892 dbSNP
rs1336096053 1897 dbSNP
rs534336774 1898 dbSNP
rs1407905686 1901 dbSNP
rs1008056636 1902 dbSNP
rs1015478235 1903 dbSNP
rs552527961 1904 dbSNP
rs886051582 1905 dbSNP
rs1171670436 1912 dbSNP
rs1470331506 1913 dbSNP
rs1184499946 1915 dbSNP
rs1311711521 1919 dbSNP
rs1026918462 1922 dbSNP
rs538339778 1926 dbSNP
rs574422885 1927 dbSNP
rs980817975 1928 dbSNP
rs1007961833 1930 dbSNP
rs1019163776 1931 dbSNP
rs886051583 1932 dbSNP
rs769082369 1933 dbSNP
rs1293855533 1934 dbSNP
rs1269316405 1935 dbSNP
rs1033710543 1936 dbSNP
rs960809693 1938 dbSNP
rs966191408 1941 dbSNP
rs999123701 1942 dbSNP
rs182813975 1943 dbSNP
rs1032299555 1944 dbSNP
rs374057431 1946 dbSNP
rs990525301 1947 dbSNP
rs915897747 1949 dbSNP
rs1476498893 1958 dbSNP
rs914032389 1959 dbSNP
rs970157844 1967 dbSNP
rs1187011663 1968 dbSNP
rs1410061200 1970 dbSNP
rs981486635 1976 dbSNP
rs1286625137 1985 dbSNP
rs1206538394 1986 dbSNP
rs1356860301 1987 dbSNP
rs750570536 1991 dbSNP
rs567057800 1992 dbSNP
rs925582289 1994 dbSNP
rs375489999 2000 dbSNP
rs932297058 2008 dbSNP
rs1430832942 2010 dbSNP
rs972695181 2013 dbSNP
rs1433952500 2014 dbSNP
rs1049440427 2015 dbSNP
rs1166169902 2016 dbSNP
rs545941215 2022 dbSNP
rs1407570681 2024 dbSNP
rs890876903 2027 dbSNP
rs943731977 2035 dbSNP
rs535922366 2036 dbSNP
rs889451678 2037 dbSNP
rs1464654101 2041 dbSNP
rs896963651 2043 dbSNP
rs1215281143 2045 dbSNP
rs1215409281 2046 dbSNP
rs1319789280 2048 dbSNP
rs881287 2053 dbSNP
rs187140703 2057 dbSNP
rs902011303 2058 dbSNP
rs1294824859 2062 dbSNP
rs886051584 2065 dbSNP
rs999402789 2066 dbSNP
rs1204360554 2069 dbSNP
rs1371365303 2070 dbSNP
rs1326917371 2071 dbSNP
rs1031933295 2072 dbSNP
rs528569542 2081 dbSNP
rs1323519893 2083 dbSNP
rs1348596914 2083 dbSNP
rs1411056526 2084 dbSNP
rs756283974 2087 dbSNP
rs146881302 2088 dbSNP
rs905807716 2093 dbSNP
rs969998807 2094 dbSNP
rs1196955430 2095 dbSNP
rs189858462 2098 dbSNP
rs1245949418 2099 dbSNP
rs1035715550 2100 dbSNP
rs1439547014 2101 dbSNP
rs781228624 2106 dbSNP
rs529655908 2108 dbSNP
rs1348082991 2117 dbSNP
rs960697631 2118 dbSNP
rs1221252890 2120 dbSNP
rs973007273 2122 dbSNP
rs1274684559 2123 dbSNP
rs555911717 2124 dbSNP
rs879455782 2127 dbSNP
rs1021007820 2128 dbSNP
rs985365775 2128 dbSNP
rs574307720 2129 dbSNP
rs943645456 2131 dbSNP
rs1178463374 2135 dbSNP
rs979654181 2137 dbSNP
rs1168551213 2144 dbSNP
rs1424186448 2147 dbSNP
rs925519576 2151 dbSNP
rs902229264 2153 dbSNP
rs780360107 2155 dbSNP
rs1408798075 2159 dbSNP
rs569489478 2160 dbSNP
rs1427003731 2163 dbSNP
rs954359685 2164 dbSNP
rs985715633 2186 dbSNP
rs1207561967 2187 dbSNP
rs1349582741 2190 dbSNP
rs539657428 2191 dbSNP
rs777140551 2192 dbSNP
rs912199750 2195 dbSNP
rs753611544 2198 dbSNP
rs1272085017 2200 dbSNP
rs1287030303 2200 dbSNP
rs943700717 2201 dbSNP
rs1011792930 2205 dbSNP
rs1023136490 2210 dbSNP
rs1358802815 2211 dbSNP
rs79862306 2213 dbSNP
rs1002801345 2220 dbSNP
rs1409608447 2221 dbSNP
rs1181321537 2224 dbSNP
rs886051585 2225 dbSNP
rs918365301 2230 dbSNP
rs931125254 2233 dbSNP
rs570237813 2234 dbSNP
rs905770589 2235 dbSNP
rs1482688573 2242 dbSNP
rs145822592 2245 dbSNP
rs1209699343 2246 dbSNP
rs1361473772 2256 dbSNP
rs1331699131 2258 dbSNP
rs1056984140 2270 dbSNP
rs1266675929 2273 dbSNP
rs1418723260 2284 dbSNP
rs1228302503 2285 dbSNP
rs896461719 2287 dbSNP
rs1336191527 2289 dbSNP
rs1288865259 2290 dbSNP
rs1013557933 2292 dbSNP
rs553698051 2293 dbSNP
rs1217502839 2294 dbSNP
rs552589054 2297 dbSNP
rs1239968995 2305 dbSNP
rs1386157447 2308 dbSNP
rs985377193 2317 dbSNP
rs1020983425 2319 dbSNP
rs911117598 2328 dbSNP
rs1162027106 2330 dbSNP
rs1183648551 2332 dbSNP
rs1422753949 2334 dbSNP
rs1261950205 2338 dbSNP
rs1190079710 2342 dbSNP
rs182632804 2344 dbSNP
rs886051586 2345 dbSNP
rs1208494887 2347 dbSNP
rs976441030 2347 dbSNP
rs145496131 2351 dbSNP
rs1001438672 2353 dbSNP
rs558625650 2357 dbSNP
rs763223428 2359 dbSNP
rs1032472666 2369 dbSNP
rs1413537051 2373 dbSNP
rs556984393 2374 dbSNP
rs1230871685 2375 dbSNP
rs1363378008 2378 dbSNP
rs1319567328 2379 dbSNP
rs188827931 2380 dbSNP
rs1053509029 2389 dbSNP
rs1386664191 2391 dbSNP
rs914729048 2392 dbSNP
rs748086573 2393 dbSNP
rs1373137005 2395 dbSNP
rs1170010936 2397 dbSNP
rs1447211956 2398 dbSNP
rs545702374 2403 dbSNP
rs1044642634 2405 dbSNP
rs1188270745 2410 dbSNP
rs1187713192 2413 dbSNP
rs1269963234 2413 dbSNP
rs1434149464 2413 dbSNP
rs1491050680 2413 dbSNP
rs398028512 2413 dbSNP
rs879167233 2413 dbSNP
rs75067194 2414 dbSNP
rs1337433949 2415 dbSNP
rs1207387639 2418 dbSNP
rs1340234038 2419 dbSNP
rs1297176902 2424 dbSNP
rs1384980704 2425 dbSNP
rs1003061169 2427 dbSNP
rs397959322 2427 dbSNP
rs866616115 2427 dbSNP
rs1157133550 2428 dbSNP
rs886051587 2428 dbSNP
rs1057451799 2429 dbSNP
rs1351173406 2429 dbSNP
rs886051588 2429 dbSNP
rs564251826 2431 dbSNP
rs912837865 2433 dbSNP
rs1225213946 2434 dbSNP
rs965022172 2435 dbSNP
rs972418855 2436 dbSNP
rs1265911499 2438 dbSNP
rs1464140303 2439 dbSNP
rs1203829377 2442 dbSNP
rs1244429737 2443 dbSNP
rs1184380821 2444 dbSNP
rs1482134465 2444 dbSNP
rs531640827 2444 dbSNP
rs886051589 2444 dbSNP
rs1459542357 2445 dbSNP
rs749897040 2450 dbSNP
rs1368356020 2451 dbSNP
rs1470730006 2454 dbSNP
rs1232273655 2455 dbSNP
rs1350977986 2456 dbSNP
rs918321897 2462 dbSNP
rs1410082106 2475 dbSNP
rs1027031408 2476 dbSNP
rs879158544 2480 dbSNP
rs931114691 2484 dbSNP
rs1313017508 2485 dbSNP
rs755773250 2488 dbSNP
rs1048620913 2511 dbSNP
rs1177347869 2513 dbSNP
rs1465876505 2524 dbSNP
rs1413294051 2527 dbSNP
rs531170032 2527 dbSNP
rs754820220 2527 dbSNP
rs764931704 2527 dbSNP
rs1226483930 2529 dbSNP
rs1269836691 2529 dbSNP
rs1284206094 2529 dbSNP
rs1328479620 2529 dbSNP
rs1329563013 2529 dbSNP
rs1365890598 2529 dbSNP
rs1491556758 2529 dbSNP
rs398058004 2529 dbSNP
rs748070701 2529 dbSNP
rs952541500 2530 dbSNP
rs1408396222 2531 dbSNP
rs200293366 2531 dbSNP
rs927113551 2532 dbSNP
rs1333133306 2533 dbSNP
rs1435417166 2533 dbSNP
rs1389819266 2534 dbSNP
rs937187876 2536 dbSNP
rs1394324388 2537 dbSNP
rs1333458183 2539 dbSNP
rs1336260363 2541 dbSNP
rs1411887515 2542 dbSNP
rs72752899 2542 dbSNP
rs1221678611 2544 dbSNP
rs146355655 2544 dbSNP
rs1163860482 2549 dbSNP
rs1444167162 2550 dbSNP
rs1473833655 2550 dbSNP
rs1006697509 2552 dbSNP
rs895767026 2552 dbSNP
rs1286223979 2553 dbSNP
rs1013533440 2554 dbSNP
rs1249656546 2561 dbSNP
rs965311113 2564 dbSNP
rs573409646 2566 dbSNP
rs1264536837 2567 dbSNP
rs1342295290 2568 dbSNP
rs1353611404 2571 dbSNP
rs923612363 2572 dbSNP
rs1042430679 2575 dbSNP
rs1256128669 2576 dbSNP
rs540722238 2577 dbSNP
rs989656055 2578 dbSNP
rs35070251 2582 dbSNP
rs562113706 2583 dbSNP
rs1407620594 2586 dbSNP
rs902515278 2593 dbSNP
rs1163086686 2595 dbSNP
rs1044565789 2596 dbSNP
rs1186385552 2596 dbSNP
rs1392272556 2596 dbSNP
rs1448680022 2596 dbSNP
rs927464823 2596 dbSNP
rs529310491 2597 dbSNP
rs550915475 2601 dbSNP
rs889940093 2604 dbSNP
rs1288527420 2605 dbSNP
rs773179244 2608 dbSNP
rs886051590 2608 dbSNP
rs1431657844 2610 dbSNP
rs1343789487 2614 dbSNP
rs1007088610 2619 dbSNP
rs1294985412 2623 dbSNP
rs1057351190 2627 dbSNP
rs1019863688 2628 dbSNP
rs1275869957 2630 dbSNP
rs1439216327 2630 dbSNP
rs897149247 2630 dbSNP
rs994158123 2634 dbSNP
rs1397212842 2635 dbSNP
rs1048969892 2638 dbSNP
rs762978810 2640 dbSNP
rs1372602500 2641 dbSNP
rs796932358 2642 dbSNP
rs1166914980 2644 dbSNP
rs1409661498 2645 dbSNP
rs1306043366 2651 dbSNP
rs1425594343 2652 dbSNP
rs1192777456 2653 dbSNP
rs1476964454 2655 dbSNP
rs1349653695 2657 dbSNP
rs1182215546 2664 dbSNP
rs972387662 2665 dbSNP
rs1025267342 2668 dbSNP
rs193223610 2669 dbSNP
rs1284826011 2674 dbSNP
rs1328976557 2680 dbSNP
rs1018158265 2682 dbSNP
rs1279699530 2683 dbSNP
rs1221307540 2685 dbSNP
rs1366048913 2689 dbSNP
rs1406470399 2691 dbSNP
rs367623672 2692 dbSNP
rs371171245 2697 dbSNP
rs771033598 2698 dbSNP
rs1177902603 2707 dbSNP
rs1412573464 2710 dbSNP
rs1428382900 2710 dbSNP
rs965197665 2715 dbSNP
rs1207928951 2717 dbSNP
rs533651741 2719 dbSNP
rs1248978079 2720 dbSNP
rs1176129122 2721 dbSNP
rs1483339630 2722 dbSNP
rs1238865903 2726 dbSNP
rs1273060594 2727 dbSNP
rs1482946714 2730 dbSNP
rs1200578131 2731 dbSNP
rs148859829 2744 dbSNP
rs1331932378 2750 dbSNP
rs1286464043 2754 dbSNP
rs566712645 2763 dbSNP
rs1431655064 2770 dbSNP
rs992656343 2772 dbSNP
rs917163213 2776 dbSNP
rs945929066 2781 dbSNP
rs1304774522 2786 dbSNP
rs1030896415 2787 dbSNP
rs1042034603 2789 dbSNP
rs956589612 2789 dbSNP
rs116869031 2791 dbSNP
rs1157674597 2795 dbSNP
rs759205789 2795 dbSNP
rs1423922195 2796 dbSNP
rs546291988 2803 dbSNP
rs865948646 2809 dbSNP
rs1053858243 2813 dbSNP
rs1166669303 2814 dbSNP
rs889901743 2820 dbSNP
rs969150017 2829 dbSNP
rs1425119506 2835 dbSNP
rs1209758112 2844 dbSNP
rs567774511 2848 dbSNP
rs1304697112 2849 dbSNP
rs751564875 2850 dbSNP
rs771129716 2850 dbSNP
rs1382313874 2851 dbSNP
rs1437037333 2851 dbSNP
rs1452112097 2851 dbSNP
rs765735700 2851 dbSNP
rs980482241 2851 dbSNP
rs927474773 2853 dbSNP
rs1288185623 2854 dbSNP
rs1351104927 2854 dbSNP
rs1388214163 2854 dbSNP
rs1162170884 2855 dbSNP
rs1156409779 2856 dbSNP
rs1443564935 2856 dbSNP
rs375554267 2856 dbSNP
rs756345680 2856 dbSNP
rs1491390352 2857 dbSNP
rs397836919 2858 dbSNP
rs200267274 2859 dbSNP
rs869069500 2859 dbSNP
rs1007054109 2862 dbSNP
rs918816565 2863 dbSNP
rs1225483671 2864 dbSNP
rs1205043488 2867 dbSNP
rs1296107570 2869 dbSNP
rs1489130672 2871 dbSNP
rs1342039211 2873 dbSNP
rs1019831990 2877 dbSNP
rs1267594648 2880 dbSNP
rs185462794 2881 dbSNP
rs1209469979 2882 dbSNP
rs1275660286 2885 dbSNP
rs1358935031 2885 dbSNP
rs994387378 2889 dbSNP
rs572294016 2895 dbSNP
rs1387275721 2896 dbSNP
rs952389159 2903 dbSNP
rs984216631 2905 dbSNP
rs1423481451 2908 dbSNP
rs1370750696 2912 dbSNP
rs1170068178 2914 dbSNP
rs1034095702 2916 dbSNP
rs1262643511 2917 dbSNP
rs1371694127 2930 dbSNP
rs573123651 2931 dbSNP
rs888444624 2934 dbSNP
rs958488467 2935 dbSNP
rs1197313723 2936 dbSNP
rs1275507211 2941 dbSNP
rs1490198203 2941 dbSNP
rs1207546931 2944 dbSNP
rs556887325 2947 dbSNP
rs569085428 2949 dbSNP
rs1445162815 2951 dbSNP
rs886051591 2953 dbSNP
rs1366502777 2954 dbSNP
rs1233726059 2955 dbSNP
rs917047137 2955 dbSNP
rs539704393 2957 dbSNP
rs1457185397 2958 dbSNP
rs942794796 2959 dbSNP
rs1404303594 2973 dbSNP
rs535350747 2977 dbSNP
rs1386655977 2978 dbSNP
rs1407539878 2983 dbSNP
rs1432316222 2987 dbSNP
rs1395339750 2993 dbSNP
rs187491896 2999 dbSNP
rs1365182795 3001 dbSNP
rs901025939 3003 dbSNP
rs1480430673 3004 dbSNP
rs1252623506 3008 dbSNP
rs998002958 3009 dbSNP
rs977345126 3011 dbSNP
rs573072285 3012 dbSNP
rs1200784727 3017 dbSNP
rs1261042621 3018 dbSNP
rs867882580 3018 dbSNP
rs1320324100 3020 dbSNP
rs397824885 3020 dbSNP
rs1329853585 3021 dbSNP
rs1289666516 3025 dbSNP
rs936673963 3028 dbSNP
rs1054229388 3030 dbSNP
rs1011237820 3035 dbSNP
rs143435552 3036 dbSNP
rs1206979290 3038 dbSNP
rs555908292 3040 dbSNP
rs574048147 3041 dbSNP
rs746598022 3041 dbSNP
rs1461778822 3042 dbSNP
rs1183560574 3043 dbSNP
rs968993170 3049 dbSNP
rs1161430236 3055 dbSNP
rs1041156531 3057 dbSNP
rs1336464742 3063 dbSNP
rs1034706764 3067 dbSNP
rs980490584 3067 dbSNP
rs1253938001 3070 dbSNP
rs1423078666 3072 dbSNP
rs115803157 3073 dbSNP
rs2002880 3075 dbSNP
rs1455309017 3077 dbSNP
rs1047291177 3078 dbSNP
rs1157886556 3082 dbSNP
rs993039834 3085 dbSNP
rs1203350419 3089 dbSNP
rs1349275283 3093 dbSNP
rs1284292146 3096 dbSNP
rs1246445440 3097 dbSNP
rs1380206269 3098 dbSNP
rs1449528474 3100 dbSNP
rs1305132657 3102 dbSNP
rs888724591 3104 dbSNP
rs1005216453 3105 dbSNP
rs760336796 3106 dbSNP
rs533495001 3110 dbSNP
rs1384266878 3111 dbSNP
rs1163980622 3113 dbSNP
rs958372963 3114 dbSNP
rs1383672402 3118 dbSNP
rs918730125 3120 dbSNP
rs868566529 3123 dbSNP
rs1024028546 3124 dbSNP
rs545679248 3125 dbSNP
rs1211172918 3126 dbSNP
rs2016347 3130 dbSNP
rs1228718082 3132 dbSNP
rs942655787 3142 dbSNP
rs1272298212 3145 dbSNP
rs753416925 3146 dbSNP
rs1326420472 3147 dbSNP
rs1267668549 3150 dbSNP
rs925882566 3151 dbSNP
rs1324400619 3156 dbSNP
rs1212308861 3159 dbSNP
rs1363825992 3160 dbSNP
rs1163120912 3161 dbSNP
rs1430661228 3163 dbSNP
rs9282715 3166 dbSNP
rs901289114 3167 dbSNP
rs1475035190 3170 dbSNP
rs780371813 3173 dbSNP
rs1247265871 3174 dbSNP
rs986065634 3177 dbSNP
rs934054027 3178 dbSNP
rs1482885718 3179 dbSNP
rs911189508 3180 dbSNP
rs892286075 3191 dbSNP
rs549132136 3193 dbSNP
rs567836075 3194 dbSNP
rs541985175 3197 dbSNP
rs563331348 3198 dbSNP
rs886051592 3200 dbSNP
rs1275921483 3201 dbSNP
rs1047719231 3202 dbSNP
rs1343654991 3204 dbSNP
rs1371915283