miRTarBase - #MIRT000663 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAC1   
Synonyms MIG5, Rac-1, TC-25, p21-Rac1
Description Rac family small GTPase 1
Transcript NM_006908   
Other Transcripts NM_018890   
Expression
Putative miRNA Targets on RAC1
3'UTR of RAC1
(miRNA target sites are highlighted)
>RAC1|NM_006908|3'UTR
   1 ATGTCTCAGCCCCTCGTTCTTGGTCCTGTCCCTTGGAACCTTTGTACGCTTTGCTCAAAAAAAAACAAAAAAAAAAAACA
  81 AAAAAAAAAAACAACGGTGGAGCCTTCGCACTCAATGCCAACTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTT
 161 TGAACCAATCAGTAATTTTAAGGTTTTGTTTGTTCTAAATGTAAGAGTTCAGACTCACATTCTATTAAAATTTAGCCCTA
 241 AAATGACAAGCCTTCTTAAAGCCTTATTTTTCAAAAGCGCCCCCCCCATTCTTGTTCAGATTAAGAGTTGCCAAAATACC
 321 TTCTGAACTACACTGCATTGTTGTGCCGAGAACACCGAGCACTGAACTTTGCAAAGACCTTCGTCTTTGAGAAGACGGTA
 401 GCTTCTGCAGTTAGGAGGTGCAGACACTTGCTCTCCTATGTAGTTCTCAGATGCGTAAAGCAGAACAGCCTCCCGAATGA
 481 AGCGTTGCCATTGAACTCACCAGTGAGTTAGCAGCACGTGTTCCCGACATAACATTGTACTGTAATGGAGTGAGCGTAGC
 561 AGCTCAGCTCTTTGGATCAGTCTTTGTGATTTCATAGCGAGTTTTCTGACCAGCTTTTGCGGAGATTTTGAACAGAACTG
 641 CTATTTCCTCTAATGAAGAATTCTGTTTAGCTGTGGGTGTGCCGGGTGGGGTGTGTGTGATCAAAGGACAAAGACAGTAT
 721 TTTGACAAAATACGAAGTGGAGATTTACACTACATTGTACAAGGAATGAAAGTGTCACGGGTAAAAACTCTAAAAGGTTA
 801 ATTTCTGTCAAATGCAGTAGATGATGAAAGAAAGGTTGGTATTATCAGGAAATGTTTTCTTAAGCTTTTCCTTTCTCTTA
 881 CACCTGCCATGCCTCCCCAAATTGGGCATTTAATTCATCTTTAAACTGGTTGTTCTGTTAGTCGCTAACTTAGTAAGTGC
 961 TTTTCTTATAGAACCCCTTCTGACTGAGCAATATGCCTCCTTGTATTATAAAATCTTTCTGATAATGCATTAGAAGGTTT
1041 TTTTGTCGATTAGTAAAAGTGCTTTCCATGTTACTTTATTCAGAGCTAATAAGTGCTTTCCTTAGTTTTCTAGTAACTAG
1121 GTGTAAAAATCATGTGTTGCAGCTTTATAGTTTTTAAAATATTTTAGATAATTCTTAAACTATGAACCTTCTTAACATCA
1201 CTGTCTTGCCAGATTACCGACACTGTCACTTGACCAATACTGACCCTCTTTACCTCGCCCACGCGGACACACGCCTCCTG
1281 TAGTCGCTTTGCCTATTGATGTTCCTTTGGGTCTGTGAGGTTCTGTAAACTGTGCTAGTGCTGACGATGTTCTGTACAAC
1361 TTAACTCACTGGCGAGAATACAGCGTGGGACCCTTCAGCCACTACAACAGAATTTTTTAAATTGACAGTTGCAGAATTGT
1441 GGAGTGTTTTTACATTGATCTTTTGCTAATGCAATTAGCATTATGTTTTGCATGTATGACTTAATAAATCCTTGAATCAT
1521 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC------AGUGUGAGgu 5'
            |||| |: ||      ||:|||||  
Target 5' aaAACAACGGTGGAGCCTTCGCACTCaa 3'
88 - 115 126.00 -14.40
2
miRNA  3' guUUGUGGUA-AC--AGUGUGAGGu 5'
            ||:||| | ||   :||||| | 
Target 5' aaAATACCTTCTGAACTACACTGCa 3'
313 - 337 126.00 -14.80
3
miRNA  3' guUUGU--GGUAACAGUGUGAGGu 5'
            || |  :||   |||||:||: 
Target 5' gtAAGAGTTCAGACTCACATTCTa 3'
201 - 224 122.00 -14.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31505813 13 COSMIC
COSN30476381 52 COSMIC
COSN17432309 67 COSMIC
COSN20069945 67 COSMIC
COSN31535636 68 COSMIC
COSN30161944 76 COSMIC
COSN28729012 79 COSMIC
COSN16259428 80 COSMIC
COSN18731867 80 COSMIC
COSN20091511 81 COSMIC
COSN31532813 82 COSMIC
COSN20091512 84 COSMIC
COSN15605499 89 COSMIC
COSN8517428 90 COSMIC
COSN2533822 92 COSMIC
COSN20091513 93 COSMIC
COSN31518309 109 COSMIC
COSN26644067 129 COSMIC
COSN26640374 135 COSMIC
COSN31571666 279 COSMIC
COSN31532650 288 COSMIC
COSN6888601 315 COSMIC
COSN31550544 348 COSMIC
COSN31526506 349 COSMIC
COSN31579961 421 COSMIC
COSN31515916 476 COSMIC
COSN31521904 512 COSMIC
COSN28724803 520 COSMIC
COSN29044412 540 COSMIC
COSN26566795 907 COSMIC
COSN28727152 917 COSMIC
COSN20684842 974 COSMIC
COSN31555354 998 COSMIC
COSN8305666 1068 COSMIC
COSN15663032 1278 COSMIC
COSN31539651 1287 COSMIC
COSN22365392 1305 COSMIC
COSN22488813 1322 COSMIC
COSN24002372 1344 COSMIC
COSN31582515 1411 COSMIC
COSN31539327 1453 COSMIC
COSN24302246 1455 COSMIC
COSN31487449 1458 COSMIC
COSN31588302 1482 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1182478201 3 dbSNP
rs551209067 4 dbSNP
rs747446057 5 dbSNP
rs1416607213 11 dbSNP
rs34140491 12 dbSNP
rs774393501 15 dbSNP
rs970144899 16 dbSNP
rs201247499 17 dbSNP
rs780518597 20 dbSNP
rs866033200 22 dbSNP
rs916666566 23 dbSNP
rs555136675 24 dbSNP
rs775934071 28 dbSNP
rs566950515 31 dbSNP
rs771454358 31 dbSNP
rs748108279 33 dbSNP
rs757739241 35 dbSNP
rs1465138168 37 dbSNP
rs1279085861 48 dbSNP
rs1312724911 49 dbSNP
rs767081694 52 dbSNP
rs1381987413 53 dbSNP
rs1244028985 55 dbSNP
rs1377555716 55 dbSNP
rs1166104605 56 dbSNP
rs1304278830 56 dbSNP
rs1409488013 56 dbSNP
rs1417391229 56 dbSNP
rs1424239966 56 dbSNP
rs796691511 56 dbSNP
rs1231871206 57 dbSNP
rs1293190817 57 dbSNP
rs1484553436 57 dbSNP
rs763876723 57 dbSNP
rs867936578 57 dbSNP
rs1303653047 58 dbSNP
rs946552096 58 dbSNP
rs1043576518 59 dbSNP
rs1331046577 59 dbSNP
rs1352971070 59 dbSNP
rs1164068150 60 dbSNP
rs1401001083 60 dbSNP
rs1474120284 60 dbSNP
rs1182099611 61 dbSNP
rs1415607359 61 dbSNP
rs1465552463 61 dbSNP
rs1200035787 62 dbSNP
rs1230785604 62 dbSNP
rs1457781539 62 dbSNP
rs1212290485 63 dbSNP
rs1273141109 63 dbSNP
rs1323888791 63 dbSNP
rs200708039 64 dbSNP
rs756522639 64 dbSNP
rs773357267 64 dbSNP
rs1311715857 65 dbSNP
rs571090671 65 dbSNP
rs1370289499 66 dbSNP
rs59685280 66 dbSNP
rs1456277019 67 dbSNP
rs2303366 67 dbSNP
rs902427752 67 dbSNP
rs1165269331 68 dbSNP
rs749525692 68 dbSNP
rs1266519060 69 dbSNP
rs1439775798 69 dbSNP
rs999372877 69 dbSNP
rs1215588269 70 dbSNP
rs908346557 70 dbSNP
rs1301414312 71 dbSNP
rs1369699677 71 dbSNP
rs1388588575 71 dbSNP
rs1059223 72 dbSNP
rs1293989720 72 dbSNP
rs1394094306 73 dbSNP
rs1434377732 73 dbSNP
rs764941203 73 dbSNP
rs1268696847 74 dbSNP
rs567222182 74 dbSNP
rs577869801 74 dbSNP
rs1485101417 75 dbSNP
rs538417726 75 dbSNP
rs932429182 75 dbSNP
rs1217790976 76 dbSNP
rs1278430350 76 dbSNP
rs35359875 76 dbSNP
rs1312805789 77 dbSNP
rs557217236 77 dbSNP
rs1188189625 78 dbSNP
rs1008439681 79 dbSNP
rs61124997 79 dbSNP
rs1170377612 80 dbSNP
rs1377633444 80 dbSNP
rs1400344304 80 dbSNP
rs1467164933 80 dbSNP
rs1477162136 80 dbSNP
rs2303367 80 dbSNP
rs1426407280 81 dbSNP
rs866074948 81 dbSNP
rs1053799259 82 dbSNP
rs1225323747 82 dbSNP
rs891935382 83 dbSNP
rs951809960 83 dbSNP
rs1354544439 84 dbSNP
rs372877887 84 dbSNP
rs1397360010 85 dbSNP
rs560677179 85 dbSNP
rs1297169960 86 dbSNP
rs561883842 86 dbSNP
rs1403112556 87 dbSNP
rs1001610002 88 dbSNP
rs1475086944 89 dbSNP
rs1017136867 90 dbSNP
rs1424681356 90 dbSNP
rs777572979 90 dbSNP
rs1491166978 91 dbSNP
rs960317646 91 dbSNP
rs1491572747 92 dbSNP
rs992059776 92 dbSNP
rs1015912154 93 dbSNP
rs1263518009 96 dbSNP
rs961340166 96 dbSNP
rs1173614344 97 dbSNP
rs1156644036 104 dbSNP
rs1340740963 105 dbSNP
rs973896905 108 dbSNP
rs1443974023 109 dbSNP
rs1425157281 111 dbSNP
rs919792249 112 dbSNP
rs1320741095 116 dbSNP
rs960952155 122 dbSNP
rs16871368 128 dbSNP
rs1435307273 131 dbSNP
rs932355591 133 dbSNP
rs1165399679 140 dbSNP
rs1409664621 155 dbSNP
rs1363467193 156 dbSNP
rs1176964405 166 dbSNP
rs1362319411 166 dbSNP
rs1442539875 167 dbSNP
rs370215539 183 dbSNP
rs1193073455 192 dbSNP
rs368834331 196 dbSNP
rs36030054 197 dbSNP
rs1287605486 198 dbSNP
rs1211469159 201 dbSNP
rs990877710 202 dbSNP
rs1356737276 208 dbSNP
rs985208678 209 dbSNP
rs912208125 211 dbSNP
rs1355386383 214 dbSNP
rs1344269759 220 dbSNP
rs761465378 221 dbSNP
rs764853005 223 dbSNP
rs1286026073 224 dbSNP
rs1329643086 236 dbSNP
rs1208272882 238 dbSNP
rs1052818282 247 dbSNP
rs1246440211 252 dbSNP
rs892024550 253 dbSNP
rs947704541 254 dbSNP
rs1043200445 255 dbSNP
rs1384623428 258 dbSNP
rs1157098780 262 dbSNP
rs539906640 267 dbSNP
rs1421818528 275 dbSNP
rs906050171 279 dbSNP
rs1001536228 280 dbSNP
rs201711136 280 dbSNP
rs923745507 280 dbSNP
rs935185168 280 dbSNP
rs1040653467 282 dbSNP
rs901796664 283 dbSNP
rs1286252667 285 dbSNP
rs1469868891 286 dbSNP
rs1035748704 287 dbSNP
rs114923537 288 dbSNP
rs1402205304 293 dbSNP
rs1361467748 294 dbSNP
rs9374 295 dbSNP
rs1014963656 296 dbSNP
rs1160827940 297 dbSNP
rs1427286948 298 dbSNP
rs1413068445 300 dbSNP
rs1478352671 303 dbSNP
rs961581808 303 dbSNP
rs1014695653 306 dbSNP
rs961505468 308 dbSNP
rs1489118656 309 dbSNP
rs1263491403 315 dbSNP
rs1457054129 317 dbSNP
rs973993462 324 dbSNP
rs1208911158 326 dbSNP
rs1440214794 331 dbSNP
rs1026780077 333 dbSNP
rs953876837 334 dbSNP
rs950958927 337 dbSNP
rs1280202185 338 dbSNP
rs1157937761 339 dbSNP
rs994350428 342 dbSNP
rs985181066 348 dbSNP
rs1220873646 349 dbSNP
rs1387975330 350 dbSNP
rs1292920269 355 dbSNP
rs12977 357 dbSNP
rs569519190 358 dbSNP
rs943826535 363 dbSNP
rs916605897 368 dbSNP
rs751417028 369 dbSNP
rs1434158488 375 dbSNP
rs1281217216 378 dbSNP
rs988881290 379 dbSNP
rs1227623151 380 dbSNP
rs979450314 383 dbSNP
rs1181057782 384 dbSNP
rs912933812 386 dbSNP
rs947608448 395 dbSNP
rs1238815338 397 dbSNP
rs1266470787 398 dbSNP
rs1337277872 403 dbSNP
rs34625328 405 dbSNP
rs1256751467 411 dbSNP
rs927443723 414 dbSNP
rs1319193151 422 dbSNP
rs937495638 424 dbSNP
rs539108343 426 dbSNP
rs1381677312 427 dbSNP
rs1449973769 427 dbSNP
rs1284949732 431 dbSNP
rs895883866 432 dbSNP
rs1374668150 433 dbSNP
rs1184521662 434 dbSNP
rs1005000440 436 dbSNP
rs1036738067 438 dbSNP
rs899167662 439 dbSNP
rs1400939509 440 dbSNP
rs781547027 446 dbSNP
rs1026917635 455 dbSNP
rs548626083 456 dbSNP
rs1163439153 462 dbSNP
rs836552 468 dbSNP
rs1235888347 469 dbSNP
rs1179965931 473 dbSNP
rs1163513848 476 dbSNP
rs1246614964 479 dbSNP
rs887414228 484 dbSNP
rs1019483691 485 dbSNP
rs941685798 490 dbSNP
rs534300530 491 dbSNP
rs1311646583 496 dbSNP
rs1351770504 496 dbSNP
rs965495464 500 dbSNP
rs988589302 503 dbSNP
rs1447573236 506 dbSNP
rs774626708 510 dbSNP
rs1374034015 511 dbSNP
rs559042866 515 dbSNP
rs1434072990 518 dbSNP
rs897613835 519 dbSNP
rs994738680 522 dbSNP
rs1378064243 524 dbSNP
rs769811766 526 dbSNP
rs1439718949 527 dbSNP
rs576097646 528 dbSNP
rs1035225811 529 dbSNP
rs968376081 530 dbSNP
rs1247718447 531 dbSNP
rs978425027 533 dbSNP
rs1216343303 542 dbSNP
rs896713851 545 dbSNP
rs1245748203 551 dbSNP
rs1012478753 552 dbSNP
rs1240994553 556 dbSNP
rs927529916 557 dbSNP
rs967980661 558 dbSNP
rs937631392 565 dbSNP
rs979440387 571 dbSNP
rs1303575855 578 dbSNP
rs777835910 582 dbSNP
rs1283829821 583 dbSNP
rs1057481186 595 dbSNP
rs749756940 599 dbSNP
rs917431685 600 dbSNP
rs1173331757 601 dbSNP
rs11540454 607 dbSNP
rs956839787 614 dbSNP
rs940731630 621 dbSNP
rs1036465748 622 dbSNP
rs1477018767 623 dbSNP
rs1275932473 625 dbSNP
rs1265654864 626 dbSNP
rs899135374 631 dbSNP
rs571397435 640 dbSNP
rs1050442005 655 dbSNP
rs1254406866 655 dbSNP
rs1259998381 662 dbSNP
rs1313930856 667 dbSNP
rs1217815281 669 dbSNP
rs1283790828 669 dbSNP
rs889704483 674 dbSNP
rs1338058947 680 dbSNP
rs774560309 684 dbSNP
rs538816597 685 dbSNP
rs1187743508 686 dbSNP
rs557006972 687 dbSNP
rs1384247787 690 dbSNP
rs1300612651 691 dbSNP
rs1467116114 691 dbSNP
rs1407506599 699 dbSNP
rs965246899 703 dbSNP
rs760010477 707 dbSNP
rs1426158556 712 dbSNP
rs141377991 714 dbSNP
rs36059496 714 dbSNP
rs897558664 715 dbSNP
rs1020047318 716 dbSNP
rs551435881 717 dbSNP
rs1057305364 726 dbSNP
rs1483596324 727 dbSNP
rs575473267 734 dbSNP
rs1428976751 735 dbSNP
rs1012370229 746 dbSNP
rs543502045 749 dbSNP
rs968461700 757 dbSNP
rs1023838589 760 dbSNP
rs904145449 761 dbSNP
rs542485609 768 dbSNP
rs1397302393 769 dbSNP
rs1333745731 772 dbSNP
rs926992932 779 dbSNP
rs1230668599 780 dbSNP
rs1168902265 781 dbSNP
rs112102014 783 dbSNP
rs956940129 791 dbSNP
rs976163614 793 dbSNP
rs1167095199 798 dbSNP
rs1341583175 802 dbSNP
rs554159470 806 dbSNP
rs1237706163 812 dbSNP
rs1176848828 814 dbSNP
rs1456421406 815 dbSNP
rs879032072 819 dbSNP
rs200099418 820 dbSNP
rs60010350 820 dbSNP
rs1224489002 824 dbSNP
rs776663992 826 dbSNP
rs1355334590 827 dbSNP
rs572460244 831 dbSNP
rs569685951 835 dbSNP
rs556508707 838 dbSNP
rs768175198 844 dbSNP
rs1307983285 845 dbSNP
rs917381640 846 dbSNP
rs1190139511 848 dbSNP
rs539986428 849 dbSNP
rs770607361 853 dbSNP
rs1330094777 854 dbSNP
rs1386568208 858 dbSNP
rs1388948258 862 dbSNP
rs1295635252 866 dbSNP
rs1448357345 869 dbSNP
rs1425604570 871 dbSNP
rs1379880929 872 dbSNP
rs1156986858 876 dbSNP
rs1441573006 880 dbSNP
rs972669602 882 dbSNP
rs1365500799 893 dbSNP
rs909122683 897 dbSNP
rs373871719 901 dbSNP
rs1490425151 917 dbSNP
rs1379363573 929 dbSNP
rs6951997 932 dbSNP
rs1171846233 935 dbSNP
rs1050409572 944 dbSNP
rs556311804 945 dbSNP
rs938361852 946 dbSNP
rs532631334 950 dbSNP
rs1437467008 952 dbSNP
rs761562585 954 dbSNP
rs1321505488 957 dbSNP
rs1360160056 965 dbSNP
rs544771570 970 dbSNP
rs199612194 971 dbSNP
rs1421600954 976 dbSNP
rs1385688207 978 dbSNP
rs915682651 979 dbSNP
rs1172055805 985 dbSNP
rs1433051231 985 dbSNP
rs1477696887 986 dbSNP
rs759631104 988 dbSNP
rs1201342249 998 dbSNP
rs1480616981 1014 dbSNP
rs1045235905 1016 dbSNP
rs1313364067 1018 dbSNP
rs1448353180 1024 dbSNP
rs1040986189 1027 dbSNP
rs900974469 1029 dbSNP
rs139209076 1032 dbSNP
rs35850876 1032 dbSNP
rs1276557612 1038 dbSNP
rs1285695887 1038 dbSNP
rs1340220591 1038 dbSNP
rs562915357 1038 dbSNP
rs530441112 1047 dbSNP
rs904271163 1048 dbSNP
rs999907435 1049 dbSNP
rs1210158005 1053 dbSNP
rs1400018956 1057 dbSNP
rs1248278864 1059 dbSNP
rs1178416183 1067 dbSNP
rs1464027614 1069 dbSNP
rs1422723721 1083 dbSNP
rs892432313 1087 dbSNP
rs1033936578 1090 dbSNP
rs958384191 1102 dbSNP
rs1242313405 1104 dbSNP
rs1186257587 1114 dbSNP
rs1186202343 1122 dbSNP
rs1440160130 1131 dbSNP
rs761242391 1132 dbSNP
rs1204806407 1134 dbSNP
rs1317829996 1140 dbSNP
rs997928641 1149 dbSNP
rs1340383961 1151 dbSNP
rs1433646584 1151 dbSNP
rs993458281 1155 dbSNP
rs1337454632 1160 dbSNP
rs1342281971 1160 dbSNP
rs1453366164 1162 dbSNP
rs183208469 1169 dbSNP
rs1168330132 1172 dbSNP
rs1411398393 1176 dbSNP
rs976621022 1176 dbSNP
rs1162213396 1177 dbSNP
rs1471533746 1182 dbSNP
rs1007387727 1183 dbSNP
rs1016130940 1188 dbSNP
rs1457742662 1188 dbSNP
rs1236862963 1204 dbSNP
rs1207100963 1209 dbSNP
rs1024546694 1213 dbSNP
rs749974320 1219 dbSNP
rs566872985 1220 dbSNP
rs762960704 1221 dbSNP
rs766381651 1226 dbSNP
rs1361851231 1229 dbSNP
rs919168444 1231 dbSNP
rs1239485347 1236 dbSNP
rs959728138 1238 dbSNP
rs1296340679 1244 dbSNP
rs930681808 1246 dbSNP
rs112118570 1247 dbSNP
rs1295420808 1249 dbSNP
rs1322636716 1255 dbSNP
rs1403317750 1257 dbSNP
rs35197465 1257 dbSNP
rs1386678327 1258 dbSNP
rs910534664 1262 dbSNP
rs944738632 1263 dbSNP
rs1438492756 1264 dbSNP
rs1040807424 1265 dbSNP
rs901085296 1266 dbSNP
rs34144836 1267 dbSNP
rs554210282 1267 dbSNP
rs1352659166 1269 dbSNP
rs1246554258 1273 dbSNP
rs936849545 1274 dbSNP
rs1052662573 1278 dbSNP
rs1292711862 1280 dbSNP
rs1328126722 1281 dbSNP
rs1213234159 1282 dbSNP
rs368738077 1283 dbSNP
rs1266627882 1286 dbSNP
rs373918915 1287 dbSNP
rs1190505177 1288 dbSNP
rs945987849 1293 dbSNP
rs997520612 1294 dbSNP
rs754860731 1296 dbSNP
rs1473432147 1309 dbSNP
rs1402851907 1310 dbSNP
rs889188425 1312 dbSNP
rs1303308175 1318 dbSNP
rs1182717754 1322 dbSNP
rs760743675 1325 dbSNP
rs1418571799 1331 dbSNP
rs904366046 1332 dbSNP
rs1007626742 1336 dbSNP
rs1420246919 1336 dbSNP
rs999877880 1338 dbSNP
rs780862406 1344 dbSNP
rs894244138 1347 dbSNP
rs1350497784 1350 dbSNP
rs527680624 1351 dbSNP
rs1457486431 1352 dbSNP
rs1292265567 1358 dbSNP
rs1269877403 1359 dbSNP
rs14627 1360 dbSNP
rs1410817951 1363 dbSNP
rs1487423839 1363 dbSNP
rs1262636807 1366 dbSNP
rs570907419 1374 dbSNP
rs1026221013 1375 dbSNP
rs188629172 1377 dbSNP
rs972734797 1379 dbSNP
rs550772240 1385 dbSNP
rs992486547 1386 dbSNP
rs1022562528 1389 dbSNP
rs952210641 1394 dbSNP
rs1290168510 1397 dbSNP
rs1453790059 1400 dbSNP
rs1359124840 1401 dbSNP
rs986187329 1405 dbSNP
rs1174818794 1408 dbSNP
rs1471169778 1409 dbSNP
rs1321772252 1411 dbSNP
rs910628001 1412 dbSNP
rs1220239687 1419 dbSNP
rs1476987728 1428 dbSNP
rs978447791 1430 dbSNP
rs34737129 1431 dbSNP
rs976099912 1436 dbSNP
rs1482946100 1439 dbSNP
rs913897124 1443 dbSNP
rs572403740 1445 dbSNP
rs1205798690 1447 dbSNP
rs988749025 1449 dbSNP
rs1250710399 1454 dbSNP
rs1041635030 1455 dbSNP
rs1305427550 1458 dbSNP
rs146672210 1467 dbSNP
rs1414855276 1468 dbSNP
rs191733007 1475 dbSNP
rs1377740353 1480 dbSNP
rs1162845179 1482 dbSNP
rs1055575581 1493 dbSNP
rs1455116963 1494 dbSNP
rs894224045 1497 dbSNP
rs1392120508 1501 dbSNP
rs762280506 1505 dbSNP
rs1170477466 1510 dbSNP
rs183171680 1511 dbSNP
rs1307997335 1518 dbSNP
rs187853103 1520 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Zhang H; Li Y; Lai M
- Oncogene, 2010
Metastasis is the most significant process affecting the clinical management of cancer patients and occurs in multiple sequential steps. However, the molecular pathways underlying each step still remain obscure. Recent research has shown that there is a microRNA (miRNA) network that functions as a regulator of tumor metastasis. In this paper, we review the role of miRNAs in tumor metastasis, including control of epithelial-mesenchymal transition, regulation of metastasis-associated genes and epigenetic alterations. More information on miRNAs will promote a better understanding of the molecular mechanism of metastasis.
LinkOut: [PMID: 19935707]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LNCaP , C4-2 , CWR22Rv1 , PC-3 , DU-145
Disease Castration-resistant prostate cancer
Tools used in this research ExprTargetDB , HOCTAR , starBase
Original Description (Extracted from the article) ... Western blot analyses revealed that upon transfection of miR-218, miR-122, miR-197, or let7b, their target proteins were altered significantly (Figure 6B–6E) ...

- Zhu J; Wang S; Zhang W; Qiu J; Shan Y; Yang et al., 2015, Oncotarget.

Article - Zhu J; Wang S; Zhang W; Qiu J; Shan Y; Yang et al.
- Oncotarget, 2015
High-throughput methods have been used to explore the mechanisms by which androgen-sensitive prostate cancer (ASPC) develops into castration-resistant prostate cancer (CRPC). However, it is difficult to interpret cryptic results by routine experimental methods. In this study, we performed systematic and integrative analysis to detect key miRNAs that contribute to CRPC development. From three DNA microarray datasets, we retrieved 11 outlier microRNAs (miRNAs) that had expression discrepancies between ASPC and CRPC using a specific algorithm. Two of the miRNAs (miR-125b and miR-124) have previously been shown to be related to CRPC. Seven out of the other nine miRNAs were confirmed by quantitative PCR (Q-PCR) analysis. MiR-210, miR-218, miR-346, miR-197, and miR-149 were found to be over-expressed, while miR-122, miR-145, and let-7b were under-expressed in CRPC cell lines. GO and KEGG pathway analyses revealed that miR-218, miR-197, miR-145, miR-122, and let-7b, along with their target genes, were found to be involved in the PI3K and AKT3 signaling network, which is known to contribute to CRPC development. We then chose five miRNAs to verify the accuracy of the analysis. The target genes of each miRNA were altered significantly upon transfection of specific miRNA mimics in the C4-2 CRPC cell line, which was consistent with our pathway analysis results. Finally, we hypothesized that miR-218, miR-145, miR-197, miR-149, miR-122, and let-7b may contribute to the development of CRPC through the influence of Ras, Rho proteins, and the SCF complex. Further investigation is needed to verify the functions of the identified novel pathways in CRPC development.
LinkOut: [PMID: 26540468]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*