miRTarBase - #MIRT000804 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB9B   
Synonyms RAB9L, Rab-9L
Description RAB9B, member RAS oncogene family
Transcript NM_016370   
Expression
Putative miRNA Targets on RAB9B
3'UTR of RAB9B
(miRNA target sites are highlighted)
>RAB9B|NM_016370|3'UTR
   1 AGATAGGGAGCCTTTTAAAAATGTGCCCCAAATTGATCAGTCAGTAGTGTAAGAATAACTGTGCCCCTCTAAGAGTGCAC
  81 ACACACGCACACAAGAGGGTAAGAGACAAGGTTCTGATTGTGAAACAGAGCCTTTCAAATTGAAGTGTAGATTGATTTAA
 161 AAAAATTAAAAATTAAAAAAAATGAAGCTCTATCAAGCCAAGTGTATTTTGCGTGATTTCTGCTATTTCCCCTTCTTGTG
 241 TGTCTCAGGACATATCAGAAAATTTTAGTCCTGAGACAGTTAAATATTTTTTAAATCACAGTTTAAACCTAGAACCCAGC
 321 TGCATGAAGGAGTTAAAGAGCTACAACTATTTCTTAAAGTGTTCCATTAATCAACTAACAAATGTCACTATCAGACTCTT
 401 GCCAAGCAGTTTCTGACATTTCTGCCAAAGGGGAAAAAAATCAGACTTTGAGCTGTATTACAATAAAAATAATAATGCAA
 481 ATAAGGATTCCTAGGCTTGAATTAAAGAAGTTGTAATGATTAGGAGTGCAAAAGTATAATGATATACACTGACTTGTTTA
 561 AATCCTTATGTATGGTTCGCTCCCATCTGAGCTTTTCAAAAAATCCCATCTCAATAAGAGATACTCTAATGACACTGGCA
 641 ATTGATTATACTTCTTGTGTTTGAAGTCATAGGATACTAGTGAATGGATTATGCTTAAATATGCCAACCACCTTTGCAAA
 721 TAAATGGTTGGTCTGCTTTTAATTCCTAAGTCTACTTTTGCTGCATAGAGATGTTGCTTCTCTGACAACCTCTTACCAAT
 801 TTAGCAATGCTGCTTAGTATATGAATTTGGATGCAGTGCTCTCTGCTCATCATTTAGATGGTCCTTTGATCCAACATGCT
 881 GGGCTCATGGAGAAGGCTTCATAAAAGATTGGGGGATAATGAACTTTTCTCACAAGGCTCCTTAACTCAAATATTTATTG
 961 CAGAAGAAGGAACTGGTTTCTTATATGTTGCACTGTATGTTCAACTAGCCTAATTAGGACATTGAAAGTGACAGAAGAGC
1041 AGATCTTAACCCAGTGTTAGAATGAATTTCCCATAAACAGAGTTGTCCAACAGTGGAATGGACTGCCTTAATAGTGAGCT
1121 CCCTGCCTCTGAAAATATTCACTGGATGACCATCTGTTAGAATACCATAAAAAGATTTTCTGTGCTGGCTACATGTTCAA
1201 TATAAAGTCCTTTCTGGCTCTAAGTTCTATGAATATATAAACTACATCAGTGCCATGCTGTGGTTAGATTTATCTGATGA
1281 TAACAGCTAAGACTATGGAGAGGGACTTTAAAAATTCTCAAACCATTCTGTGATCAATCTTTAACAGCAACTACATAGCT
1361 CTTCCTTTTGCTTTTGCACTGTGGCAGGAAAAATTCTTGAGCTCTGAGTAATCTTTATGTGACTGATAAAAAACATCTTA
1441 AAGCTCCCATGTTAAAATATAAAAATGGTTTGACAATTTTTGATTACCATGACTGTCAGTTATATACTATATTATGAATA
1521 TGCAGTGTGGTTCTTGTTGGTTGATCTGTTTACCCTGCATAGATTTTAATCTGTACTTTAAAACATCTATGATAAAAATA
1601 GTGACAGACAGAAATTACCCCAAAAAGAGACCTAGGCCAGGAAGGGGGTGGGAGCTTTCATAGGAATACAGCCTAGAACT
1681 CTCCATTGTAGCCACGTATGGAATCAGCCTTACTTACATGTAGGACCTTTGTGCTTTAAGAGCTCTGGGACATATTGGCC
1761 AAATAGAAAAGAAGAGGACAGTATTTCAACTCAGTCATACTCAATATTTCCAATTAAGATATAATCCTGACACCATTGTT
1841 CAATTAACTTTGACGCCAGAAGTCAAAGCCAGAACTGGGACCCCACAGCTCTTAAGTACTGGTCCCTATCCTGCCTATGC
1921 CTATAGCCAGCCACACTGGTTTCCAAGTTCTGTGATCATTTTGCTACAATCATGTTAGGGTGAAAATCTGTACGTCAGAA
2001 CTGTTAAATGCTAATTATTTTTAAGTGCATGAGACCTGGGGCCTTCTCTTTCTACTTGCACTCTGCTTATACTAGTTTCT
2081 ATTTGTAGATCTCAGGCCTTCATCATAAAGACCTCTATCAACTCACAAAAGTATTTGTCTCTATTAGAGTGGCATGTGGT
2161 CATTTGAGTAAAAAAAAAAAAATTACATGGGTATCGGATTCATAGGCATCCTGTCCATCTAAGACAAGTGTTAATTTTAT
2241 TGGCCCATCAGCTGGAGCCCCTTTCCTCTTAGCCATACCATTGTTTTCTACCAAATTACCACTCAATATCTTAATGAAAG
2321 CACTCAACATTAAGTGACATAAACAGTGGCATTTGGGTAAGCAACACTCAGTGGGGTGCTGACATACAGTTTGGGTAAGA
2401 TTAAAAAACACCAAAGGCTGAAATCTGTGAGTACCAAGAACTGTGCATATAGGTTTAGAAATTGACTGTGTACCCTAGAA
2481 TGTGCAGTGTAATATTTTCAATAGGTGTTTTTTTAAAGAACACTAGATTTTTGGAATAATATATTTCTAATTAGGACTAT
2561 ACTGTTTTTCAATGGTCTGTTAAAACATCATACAGAATATTTATTTAGTTTATTGTCATGTATTGGCTAACTTTCAGGGG
2641 CCTCAGATTCCATATGTCTTCAGTGGATTGATGAATATCAGGTTAATTTGTGCCTGCCCCAGCCATCTCTACTTTATTCT
2721 GAGGTATTCCACAATCCTCTTGTTGCAGGTGCTGCTAAAAAAAACTCAAAATTGTGTATCAAATATTTTCTTTCAACTGT
2801 AAAAAATCATCTGTGTTAAAGTGAATAAAAAGTGCATTTTGAATAACCAGCACACAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGG----UAA--UACACGACGAu 5'
            ||| ||    :||  | |||||||| 
Target 5' caCAATCCTCTTGTTGCAGGTGCTGCTa 3'
2730 - 2757 156.00 -18.50
2
miRNA  3' guguuUGGU--AAUAC---ACGACGAu 5'
               ||||  ||| |   ||||||| 
Target 5' ctcttACCAATTTA-GCAATGCTGCTt 3'
790 - 815 150.00 -12.40
3
miRNA  3' guGUUU-GGUAAUACACGACGau 5'
            :||: |:| | | ||||||  
Target 5' ccTAAGTCTACT-TTTGCTGCat 3'
745 - 766 131.00 -9.00
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768904031 1 dbSNP
rs1451775618 5 dbSNP
rs1200576674 6 dbSNP
rs1165699782 10 dbSNP
rs749040974 14 dbSNP
rs779844580 21 dbSNP
rs200974641 27 dbSNP
rs1450238620 35 dbSNP
rs375103308 39 dbSNP
rs745819137 40 dbSNP
rs1185311414 46 dbSNP
rs1489649992 47 dbSNP
rs1490948061 51 dbSNP
rs1382082037 69 dbSNP
rs536203957 82 dbSNP
rs747517766 86 dbSNP
rs2232731 87 dbSNP
rs1176642829 90 dbSNP
rs1469638729 118 dbSNP
rs1388697141 131 dbSNP
rs775895467 131 dbSNP
rs1427700960 132 dbSNP
rs1188644862 146 dbSNP
rs1376542275 146 dbSNP
rs1241326168 152 dbSNP
rs1311979510 158 dbSNP
rs772369204 159 dbSNP
rs1241980281 164 dbSNP
rs1017889341 165 dbSNP
rs1356452380 166 dbSNP
rs1009536299 175 dbSNP
rs890469866 175 dbSNP
rs1048154097 183 dbSNP
rs1457086565 183 dbSNP
rs746264761 183 dbSNP
rs923471304 190 dbSNP
rs1421946812 191 dbSNP
rs976268229 192 dbSNP
rs1462674406 199 dbSNP
rs1459516068 203 dbSNP
rs943627021 204 dbSNP
rs868162874 212 dbSNP
rs528584771 213 dbSNP
rs1203315628 229 dbSNP
rs772429059 232 dbSNP
rs1321642335 234 dbSNP
rs1377456811 243 dbSNP
rs916385204 252 dbSNP
rs1314071633 263 dbSNP
rs774102758 270 dbSNP
rs967713291 272 dbSNP
rs770708523 277 dbSNP
rs1269463928 284 dbSNP
rs1316890104 292 dbSNP
rs1198918439 302 dbSNP
rs927688279 307 dbSNP
rs1384313827 332 dbSNP
rs1482163303 340 dbSNP
rs1181147802 347 dbSNP
rs748748098 349 dbSNP
rs1425549744 355 dbSNP
rs1191554911 360 dbSNP
rs978152651 365 dbSNP
rs184273691 368 dbSNP
rs1466292144 373 dbSNP
rs1173107078 386 dbSNP
rs756072515 395 dbSNP
rs748074837 402 dbSNP
rs1465849662 407 dbSNP
rs56753127 413 dbSNP
rs370418328 441 dbSNP
rs754691627 441 dbSNP
rs781212862 441 dbSNP
rs1398740434 446 dbSNP
rs1022034151 452 dbSNP
rs779209962 454 dbSNP
rs1339304704 455 dbSNP
rs1218802865 457 dbSNP
rs1172996312 461 dbSNP
rs987874267 470 dbSNP
rs960442350 473 dbSNP
rs1310146103 478 dbSNP
rs751360978 484 dbSNP
rs1256406250 485 dbSNP
rs1484169507 496 dbSNP
rs1214386124 506 dbSNP
rs1262490987 508 dbSNP
rs1478191144 523 dbSNP
rs1017753615 525 dbSNP
rs1423311359 536 dbSNP
rs1446945491 538 dbSNP
rs1432868876 542 dbSNP
rs1009155148 569 dbSNP
rs1361292742 573 dbSNP
rs1243871793 575 dbSNP
rs1183045166 578 dbSNP
rs1460198290 599 dbSNP
rs1359277714 604 dbSNP
rs1400077875 604 dbSNP
rs1234746931 610 dbSNP
rs1365028124 612 dbSNP
rs1218306367 614 dbSNP
rs1206375558 618 dbSNP
rs1301653363 619 dbSNP
rs1349798505 626 dbSNP
rs1237780038 638 dbSNP
rs1285213031 659 dbSNP
rs1307810681 662 dbSNP
rs1034851165 669 dbSNP
rs1245097154 670 dbSNP
rs1002003656 672 dbSNP
rs905126766 685 dbSNP
rs1272242906 691 dbSNP
rs1192017822 698 dbSNP
rs1016823330 703 dbSNP
rs1438230540 707 dbSNP
rs1158494515 708 dbSNP
rs1005868564 722 dbSNP
rs993895394 724 dbSNP
rs1319668322 730 dbSNP
rs887799179 731 dbSNP
rs1361488009 732 dbSNP
rs1315222943 735 dbSNP
rs180823298 742 dbSNP
rs1293753229 767 dbSNP
rs757537068 773 dbSNP
rs1372807241 781 dbSNP
rs929407687 784 dbSNP
rs1444289002 792 dbSNP
rs1376539076 796 dbSNP
rs1308323331 804 dbSNP
rs901892855 819 dbSNP
rs1354289316 833 dbSNP
rs1225425056 841 dbSNP
rs1287755985 856 dbSNP
rs1040946789 857 dbSNP
rs899281651 868 dbSNP
rs1255122918 874 dbSNP
rs1456657198 882 dbSNP
rs1354364433 896 dbSNP
rs1037770835 898 dbSNP
rs188463807 901 dbSNP
rs910810704 902 dbSNP
rs1044013497 907 dbSNP
rs1161987940 909 dbSNP
rs894984351 911 dbSNP
rs1163011641 920 dbSNP
rs139789723 923 dbSNP
rs1055361159 924 dbSNP
rs913610376 937 dbSNP
rs927857436 948 dbSNP
rs768993458 953 dbSNP
rs768098729 963 dbSNP
rs780161733 964 dbSNP
rs184078614 973 dbSNP
rs1480412300 980 dbSNP
rs536958 1005 dbSNP
rs1316264842 1008 dbSNP
rs770694203 1018 dbSNP
rs1259037117 1019 dbSNP
rs914883042 1021 dbSNP
rs1185949290 1031 dbSNP
rs1414969533 1034 dbSNP
rs749013647 1040 dbSNP
rs1292337705 1047 dbSNP
rs1188006686 1063 dbSNP
rs1244636439 1072 dbSNP
rs910763583 1083 dbSNP
rs1419429583 1086 dbSNP
rs1463691483 1090 dbSNP
rs142499416 1100 dbSNP
rs1400676203 1105 dbSNP
rs1411447251 1106 dbSNP
rs951266719 1117 dbSNP
rs1332016444 1118 dbSNP
rs1026324369 1121 dbSNP
rs988040032 1143 dbSNP
rs1357009903 1144 dbSNP
rs1448724231 1154 dbSNP
rs1295164860 1166 dbSNP
rs1338529811 1191 dbSNP
rs993460044 1202 dbSNP
rs1218172916 1212 dbSNP
rs901948520 1215 dbSNP
rs1279070762 1230 dbSNP
rs955014379 1256 dbSNP
rs1026966443 1257 dbSNP
rs993742962 1260 dbSNP
rs963354403 1261 dbSNP
rs769138076 1266 dbSNP
rs1040433032 1267 dbSNP
rs1213670141 1272 dbSNP
rs1258933572 1281 dbSNP
rs1476558216 1302 dbSNP
rs1224045812 1308 dbSNP
rs1192387436 1309 dbSNP
rs1373278542 1310 dbSNP
rs1476219247 1317 dbSNP
rs750336380 1321 dbSNP
rs1401275987 1342 dbSNP
rs191840227 1345 dbSNP
rs1314649476 1350 dbSNP
rs1306634304 1351 dbSNP
rs1016177609 1369 dbSNP
rs1399462352 1371 dbSNP
rs1298931949 1379 dbSNP
rs1328391956 1396 dbSNP
rs1407072839 1400 dbSNP
rs1274579284 1402 dbSNP
rs1044282245 1405 dbSNP
rs1346167698 1416 dbSNP
rs1237059784 1417 dbSNP
rs1366747325 1422 dbSNP
rs1303021251 1423 dbSNP
rs1488284722 1424 dbSNP
rs1012992175 1428 dbSNP
rs1456483219 1432 dbSNP
rs1347078823 1434 dbSNP
rs1159897711 1436 dbSNP
rs1448334422 1443 dbSNP
rs894554408 1448 dbSNP
rs1295918198 1460 dbSNP
rs1054995723 1473 dbSNP
rs187425535 1475 dbSNP
rs1179766113 1477 dbSNP
rs947005468 1488 dbSNP
rs1175342692 1489 dbSNP
rs754957564 1490 dbSNP
rs914122533 1502 dbSNP
rs1378377693 1523 dbSNP
rs1269562425 1524 dbSNP
rs1052067128 1528 dbSNP
rs1419063726 1540 dbSNP
rs906342487 1542 dbSNP
rs746796942 1544 dbSNP
rs945242608 1586 dbSNP
rs1323146999 1592 dbSNP
rs779895705 1606 dbSNP
rs1215873570 1608 dbSNP
rs1315967993 1609 dbSNP
rs1307596810 1617 dbSNP
rs1286005399 1618 dbSNP
rs927606950 1622 dbSNP
rs757442446 1631 dbSNP
rs139184567 1645 dbSNP
rs1266210962 1652 dbSNP
rs1468679902 1654 dbSNP
rs909749078 1655 dbSNP
rs1438952867 1660 dbSNP
rs1182455240 1664 dbSNP
rs778075313 1669 dbSNP
rs1283006105 1673 dbSNP
rs1162802005 1677 dbSNP
rs951278082 1679 dbSNP
rs1364693095 1681 dbSNP
rs1463251065 1686 dbSNP
rs1329683473 1687 dbSNP
rs1376660623 1689 dbSNP
rs1392424584 1692 dbSNP
rs756104357 1695 dbSNP
rs1339282431 1696 dbSNP
rs1241953522 1699 dbSNP
rs1025545125 1700 dbSNP
rs955065926 1705 dbSNP
rs993512388 1708 dbSNP
rs1335030246 1709 dbSNP
rs1215199796 1710 dbSNP
rs966065490 1713 dbSNP
rs919406691 1725 dbSNP
rs1453071494 1727 dbSNP
rs1386755147 1750 dbSNP
rs1422038578 1764 dbSNP
rs1178800440 1767 dbSNP
rs1418707946 1769 dbSNP
rs972289806 1774 dbSNP
rs114375743 1776 dbSNP
rs1007682099 1780 dbSNP
rs1431439840 1782 dbSNP
rs184550640 1783 dbSNP
rs1263684467 1800 dbSNP
rs1300315241 1802 dbSNP
rs1400649734 1803 dbSNP
rs1395988185 1812 dbSNP
rs889192997 1826 dbSNP
rs1464013015 1831 dbSNP
rs958805102 1834 dbSNP
rs1316985109 1836 dbSNP
rs780872257 1839 dbSNP
rs1011004754 1843 dbSNP
rs767850146 1847 dbSNP
rs1002930306 1848 dbSNP
rs760178309 1854 dbSNP
rs756993174 1855 dbSNP
rs193213759 1859 dbSNP
rs1191687077 1862 dbSNP
rs1009527505 1864 dbSNP
rs766888120 1875 dbSNP
rs1376318328 1876 dbSNP
rs1465922962 1878 dbSNP
rs529980 1886 dbSNP
rs1377857979 1891 dbSNP
rs772960362 1901 dbSNP
rs1295853414 1906 dbSNP
rs947835199 1910 dbSNP
rs1214817426 1911 dbSNP
rs1029137401 1915 dbSNP
rs763805598 1920 dbSNP
rs983975325 1923 dbSNP
rs1381750442 1927 dbSNP
rs942999179 1928 dbSNP
rs929767459 1934 dbSNP
rs918411517 1936 dbSNP
rs1453722421 1947 dbSNP
rs769493177 1950 dbSNP
rs1486295305 1966 dbSNP
rs762582850 1969 dbSNP
rs965674090 1970 dbSNP
rs1432954018 1981 dbSNP
rs1018982311 1987 dbSNP
rs188751083 1993 dbSNP
rs184246769 1994 dbSNP
rs768477625 1997 dbSNP
rs764760740 2003 dbSNP
rs1344120061 2004 dbSNP
rs1430921632 2008 dbSNP
rs746992798 2009 dbSNP
rs1010931105 2013 dbSNP
rs779805770 2017 dbSNP
rs1303945990 2020 dbSNP
rs909449268 2021 dbSNP
rs1031124461 2037 dbSNP
rs1283570532 2038 dbSNP
rs1341859276 2040 dbSNP
rs1252217203 2046 dbSNP
rs1228372364 2048 dbSNP
rs1340637327 2054 dbSNP
rs1003784896 2063 dbSNP
rs771808795 2069 dbSNP
rs1263898464 2070 dbSNP
rs1488301627 2072 dbSNP
rs1194631433 2079 dbSNP
rs906743654 2091 dbSNP
rs376511441 2098 dbSNP
rs1438338504 2100 dbSNP
rs1178572868 2102 dbSNP
rs1044737158 2111 dbSNP
rs73258102 2115 dbSNP
rs888216474 2118 dbSNP
rs1347739805 2119 dbSNP
rs1326291329 2128 dbSNP
rs1444409182 2137 dbSNP
rs1278871305 2141 dbSNP
rs1332382908 2143 dbSNP
rs1394106236 2168 dbSNP
rs1398418556 2169 dbSNP
rs1048201740 2170 dbSNP
rs981936689 2175 dbSNP
rs190703858 2182 dbSNP
rs1388365915 2183 dbSNP
rs375234928 2183 dbSNP
rs59524156 2183 dbSNP
rs967485865 2183 dbSNP
rs773707503 2185 dbSNP
rs1388245237 2187 dbSNP
rs186781258 2189 dbSNP
rs1233958164 2191 dbSNP
rs1471472328 2192 dbSNP
rs1178385340 2195 dbSNP
rs1411040127 2199 dbSNP
rs976576323 2200 dbSNP
rs1444661731 2215 dbSNP
rs1165214684 2216 dbSNP
rs772328403 2218 dbSNP
rs943980067 2219 dbSNP
rs911092120 2221 dbSNP
rs1463863976 2233 dbSNP
rs762333580 2245 dbSNP
rs893753059 2247 dbSNP
rs1444321016 2257 dbSNP
rs1367561498 2260 dbSNP
rs1185010069 2268 dbSNP
rs953530483 2273 dbSNP
rs1354904361 2276 dbSNP
rs1234066425 2282 dbSNP
rs1032280851 2286 dbSNP
rs774841325 2295 dbSNP
rs1214316044 2299 dbSNP
rs1439168994 2301 dbSNP
rs989561534 2307 dbSNP
rs956779527 2310 dbSNP
rs1031136167 2315 dbSNP
rs1482365468 2321 dbSNP
rs1254701064 2323 dbSNP
rs1004079931 2325 dbSNP
rs971021300 2332 dbSNP
rs1223355101 2333 dbSNP
rs1355684186 2341 dbSNP
rs1416819880 2343 dbSNP
rs752702245 2347 dbSNP
rs143727150 2357 dbSNP
rs1167055153 2361 dbSNP
rs888134492 2367 dbSNP
rs1332129333 2369 dbSNP
rs1288822952 2371 dbSNP
rs1374833787 2373 dbSNP
rs544170226 2381 dbSNP
rs933097492 2388 dbSNP
rs1408931479 2394 dbSNP
rs749492808 2400 dbSNP
rs1368652135 2403 dbSNP
rs1304833804 2404 dbSNP
rs896876243 2411 dbSNP
rs897558494 2412 dbSNP
rs1217894029 2423 dbSNP
rs1425184676 2425 dbSNP
rs1389446257 2430 dbSNP
rs780030257 2431 dbSNP
rs1210952126 2434 dbSNP
rs942220692 2437 dbSNP
rs943846856 2440 dbSNP
rs909355805 2449 dbSNP
rs1242425286 2452 dbSNP
rs1476261706 2458 dbSNP
rs752159755 2466 dbSNP
rs1435315264 2474 dbSNP
rs139079958 2481 dbSNP
rs368670337 2489 dbSNP
rs763344260 2501 dbSNP
rs947320094 2509 dbSNP
rs928666879 2515 dbSNP
rs1319218165 2518 dbSNP
rs750813389 2523 dbSNP
rs1434726349 2533 dbSNP
rs915274123 2537 dbSNP
rs989405477 2541 dbSNP
rs967896734 2553 dbSNP
rs1271724336 2554 dbSNP
rs1237186130 2577 dbSNP
rs146333051 2582 dbSNP
rs761596599 2586 dbSNP
rs924002748 2590 dbSNP
rs1451518377 2593 dbSNP
rs1204095786 2595 dbSNP
rs982314250 2606 dbSNP
rs971333774 2608 dbSNP
rs1284510301 2619 dbSNP
rs182406843 2627 dbSNP
rs1252184107 2631 dbSNP
rs745806767 2644 dbSNP
rs952933138 2645 dbSNP
rs1026662289 2652 dbSNP
rs1351677939 2663 dbSNP
rs1453143679 2671 dbSNP
rs142460541 2681 dbSNP
rs760203900 2682 dbSNP
rs1227590794 2685 dbSNP
rs1325601420 2686 dbSNP
rs1372187498 2698 dbSNP
rs1443676750 2703 dbSNP
rs1307690295 2704 dbSNP
rs775363383 2709 dbSNP
rs957872461 2712 dbSNP
rs1348443270 2716 dbSNP
rs16984060 2728 dbSNP
rs1437177013 2729 dbSNP
rs745599845 2731 dbSNP
rs1352326917 2734 dbSNP
rs1041219747 2736 dbSNP
rs1007957339 2737 dbSNP
rs1330442814 2747 dbSNP
rs889655452 2751 dbSNP
rs1321013044 2761 dbSNP
rs1272254457 2764 dbSNP
rs751416545 2765 dbSNP
rs778823299 2765 dbSNP
rs1030437956 2767 dbSNP
rs947299398 2774 dbSNP
rs997171792 2782 dbSNP
rs914450406 2784 dbSNP
rs1474310324 2785 dbSNP
rs1385255103 2790 dbSNP
rs1157908890 2794 dbSNP
rs1164495550 2795 dbSNP
rs1053732142 2796 dbSNP
rs190181713 2806 dbSNP
rs1431965877 2807 dbSNP
rs966219975 2811 dbSNP
rs1463338571 2831 dbSNP
rs1296847909 2833 dbSNP
rs897459423 2834 dbSNP
rs1200587337 2847 dbSNP
rs1392498061 2848 dbSNP
rs923932122 2850 dbSNP
rs1337036458 2851 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*