miRTarBase - #MIRT000819 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ASXL2   
Synonyms ASXH2, SHAPNS
Description additional sex combs like 2, transcriptional regulator
Transcript NM_018263   
Expression
Putative miRNA Targets on ASXL2
3'UTR of ASXL2
(miRNA target sites are highlighted)
>ASXL2|NM_018263|3'UTR
   1 TGAGACTAGAAAGAGATACACTGTAAAGGAGGGGGAAGGGAAGGGTTGACCAGTTGGGTTTTTTGCGTCCTTTTGGAATC
  81 ACAGAAATAAACAAGTAGGTTTCAGTTGTCTTCAGAGACAAATGTTACTTAATCAGGAATACAAAGTACAGATTTTTTAC
 161 ATTTTAGAGGAAGAGCACCTTGTATAGTAAGTCTAAGTCAAGCAAGACTTTGTGAATTTGTGACAAGTTTGCACTTACAA
 241 AATCATGTAAATATGTCACATTTTGTTTAACATTATTTTTCCAAGTGTTTAGGTAATAATGTATTACTTTGAATTCAGAT
 321 TAATGTTCTACTACTTGTGACTGAGAAAAGTTTAATGCCGGCATGGTAAAAGGAAGCTGTCTCCCTTCTGACATTTCCTA
 401 GGAAGCTAGGAAAAGGAAAGTGAAGGAATGGTCTAAAGAAATGACCATTCACACTGATTTTGTCTGGACAGTCTGGCCGC
 481 AGGTTATTCATAGATTATTCAGCCTTTGCAGGACTTGGATTCAGGGTTTTACTCAGTCCCTTTACCTTAGGTGGAATCTT
 561 CTTAAATTGAAATTTTTGGTAAGGAATTCATTTCACAGGTAGTGTTTCAGACTCTGAAAGCCCTGACTTGGTTCTTGGCT
 641 TCTACTGTACTAGTTACTAGTTACTGGTACTGTTGCCAAGCAATCTGCTTGGAATTTGTGGATCCCTGCTGTTCCCTAAT
 721 CCCACCCCCTGCCCTGAGACAGTGAATGTAGTCCGTGAAGGGAGTGCCTCTCTGGGACCCCCTGTGTTGTTACAGGCTGT
 801 GCAGTGCAACAATTCCAGCAAAAATACCCTATCCCCGCACTTAGTCATTCGTGGTAACTAACAATTTTGAAATACTCATA
 881 TAAAATGAACAGGAAAGTGTTAGTGATTGGGTGATTTGAGCTACATCTTGTTGAGCAAGGGGAGTGAAACCACAGAAACT
 961 GTTAAATTGAACGTAAATAACTTTGGAAAACAGTTTTGACACTAGAACAAGGTCGCTTCTCTTTTCCTCTTCTCTCCCAA
1041 CCTGTTAACCTAGTGCTAGATAGTCAGCTGCTGTTGCAGGTAGAAAAGCTCACCAATGCCACATTTGTTCATTCTGTTCA
1121 ACCTGTTTTGACCTCCCAGGCATCTGAACAGGATGACATCATCTTATTATATCTTACTTTACACATACGTGTATGTACAC
1201 ACACACACACAATACAAGACATTTTTCCTGTTTTAGAAAATATAGCCCTTGTTTGGATTACTGCTGTCTGAGCACTAGAA
1281 ATTTCTAATGGAAAGAGGCCTCTGAATGGCTAAGGGAACATCTGGAAAGGAAGGAAAATGAGCCCTAAAGGTTTTTTGGT
1361 TGCTTGTTTTTGTTTCTTTTTCTTTCTTGTTTCCTTTTTTGTTTTTAAATCCTTCTCTAGTGACTGAAGAAATTGTGAGT
1441 ACATAATATTTAGGTCATGGTTAAGGAACATTAAAATAAACCTGCAGTTTAACAGAATTTTGTATTAAATGGGGGAGTGT
1521 CAATTTGCATCATTTGCATATTGATTTCAAGTCTCCTAATTTGGAATGGGTAAAGTACAAATGTTAATGCAACATAGTAC
1601 AGTTGTATTTGTCCTTCATATTCAGGATGTGATATTTACAAAATGCAGAACAGTTTAAACTTGTTAAGTCACATTCCAGA
1681 TTAGGAGAAAATGGGCAATAATCATCTCTGTTTTGCCCCCATTCTACTACCCACCACTGCCCACCCCACCCCCACATCAC
1761 ACACTCTTCGATGCTTTCCCACAGCCCCTGCTCCGCTCCTCTCCGTAAGAAACTCACTTCACTGTTTTTCACTTTTCACT
1841 TCTGGCTTTTTTGTGGCCCAAGGCCAATATAGGATTAATATCTGTGTTCCAGCTTCAGCCAGAACGATATGTCTGTCCAT
1921 CTTTCTCCTTTCTTCCAGCACACACAGCTAAGAGATAAGAAGGCTGCAAGGATTGGGGATAAGGAGTATATTTTCAAGCC
2001 AAGAACCAGTAGAAAACAGAAATAATGGTGCTCCCAAATATTCAGTACCTTGGGCAATCCAGGAAGGGTTTAAAGAGACC
2081 TGTTGCTGCATAGAACTCTCCCTGCCCTACCCCTTAACTCCACCTTAGTGCCAGGGCCGAGGGCTGGTCTGCATGCTGGA
2161 AGAGGTTGAGAGTTTTGGAATTGATTCCATGCTAAATGTCAGTTACCAGTTTGGATTGATGAAAGTGATTTTTCTGCTTT
2241 ACCTTTTTCCTGTCAGAAAGGTTTTCCTCTGTGCTACCCTTAACTTAGGGATGAACAGACTATAACTAGGAAAGGAGGAA
2321 AGGTATCAGGGATTTTTAAGTCCGTTTAGAGAGCAAACCATATTGTGCCTCTTCATCTTGACCCAGGCTCTTATAGATAG
2401 GTCCTAAACATTGCTGTTCACTAGATTATCTTAACAAATAATACTCAGCTAAATATTTGCATTTAGGAATACTCCTAAAA
2481 CAGATATTGCCAACTAGATACACTGCCTCAATCTTGACCAGACAAGAGAACAGTTAAGTTCTCTCAGTTGGGTAGTAACT
2561 TGAATACCAGTCTATTTATCAGTTGGTTTCAACACAGAGGTTTCAAGTGGAAAGCCATTCATCTTAAAAGCTGAACAGAA
2641 AAATTAAAAAAAAAAAAAACACATTACAATCTGGCCTTTTAGAAAATGAAGCAGTAGAAACAAAACCTTTATTAGTATGG
2721 TATTCCAGCAGCACCTTTAAAGCAATCTTTACCTTAGTTTTTTGAGTTGTTTTACCTTTCATCCCAATCTGAAAAGTTTT
2801 AATAAATGCTGAGCTTATTCTTAGGGTATGACCTGGCATTATTTCCAGTGACTAGTCAGGCATTATGCCTGATGCATACG
2881 CCTCCCGTGCACCCCTATCTAGCCTTCAGATGTCCTCCACTGCAGGTCACCCCAGGAGATAGCATCAATAATATAGTCTC
2961 AGTCTTGTTTATAAAGATTCTAAGTTGTCTAGTAAATAAGTCTCCCTGAATCTTAAATAATTTTGGAGAATTAGAATTCT
3041 CCATCCTATTAAACAGAAAGTAAAGCCAAATAGCCTGGAGTTGTTTGTCCTACTTGTTCCATAACCCCTATGCTCAAGAT
3121 ACTGAAGCTATCTGTGGTATTTCATGTAACATTTCTAAGAATAAGAGCTGGCAAATGGGAAACTTGGGGTGGAGAGAGCA
3201 TACTTATTGGGCTGTGAAGGCATACGGATGTACATGTTTTAGAGCTTATCTCAGATTTAAATAGCCAAAGGAAGACCTCA
3281 TTGCCTTCCAGGTGAAGGTGCAAAGTCATACATATTAATGACCTGACAGTTAACATTCTGTTGTTTATTATTGCCTTTCT
3361 CCACCTTAGAGAGCCATAAATAACTCTCTGGTGAAGTGATTTGCTATAATGGGGGTGAGGAGTGGGGAGACTTCTCTGGT
3441 CATTACACTGCTATTTATTTCTAGAACTCACTATCAGTGAGCAGTGCCAGAGTGTTTTCTCTTTGACCTAGAGGTTTCAC
3521 ATCATAGCAAGGAGGGAAAAGTCTCCCCATCTCCTTACAACTGTGTGCTAAGTAAGTAACTTGGCCAAGGGTAGTTTTCA
3601 GCTCAATTTATAGAATAGTCCAAAGAGACTTTGAGAAACATGGTGATAGGCAGGGGCCTTTCCTACCATGTTTCAATACC
3681 TACAAACCTATTGAAAGAGAACAGTAGGTAAAACATTTCCTAAAGTTGAAGCAATAGCTTCGTAGATTCTTGGTTACTTT
3761 ATTTTTTTTAATGCTTTACATTTGATACAACTATTGAAGATCAATTTTAAAAATAGCTTTCCAGTAATATATTTTAAGTA
3841 ATATATATTTTAATATCTGTAAAAAGTGACAGTGGAAGACTTTGAATTTCTCATATATGGTATGTTTGATGTAGGACCTC
3921 ACTGTTAAGGCACAAATTATTTCAAAGGAAGTTACTCTAAAGACACTCAGATTATTTCAGAAAAATGCAATAAGGGGAAT
4001 AGTTTTGGGGTTTATTTTTTATTTTAAAAGAAAATTGACTTATTTACCACAAGCTATTTTTTTCCCTTCTGGCTGTAAGG
4081 TTTGTACAGACTGGTTTGGTAAATGCTAAACTTTTGTGTCTTTTGCCTTTTTAAAGGAATTGTTAACATTGGAATTGAGG
4161 GTATGTACAGAGAAGTTGGTGTCAACACCATTTAAAAAGTCATATTTTTTCACAAATATAGAAAATCATTTTACATAAGA
4241 ATTTTAAGTATTTGCAATAAATATATGTATATAGATTGTATGTATTCCTATATTCTTATTTTTCATTTTATTATTAAGTA
4321 AAAGATCATTAAAAGTGAAAATAAAAACCTTGGAGTTTTTTGGTGAATCTTGAGGTTTAACATACATCTGAGAGTGGCGT
4401 GGGTAAGAGTCCTCAGTTACTGCCTTATACTCCTATGGGATGGTTCCCACAGATTGTATGGAAGAGAGTAAAATGAGGAA
4481 CTTGGTGATAAATCAGGGTAGTGTATTTCTTTTGGAATTTAAGTAAAACTGATTAAATTTTCCTTATCTGTCTGTCTCCA
4561 TGTTTTCTCCCTTAATCTGTTTTGTCTCCTAACCCCCTAACATTACTGGAAAAGTGAAGAAATGCGGTGCAGCCTCTTTA
4641 TTAATGTGCCCATTGTTTGCTCCTAAATCAAAGAATGGTAAGGAAATATCTCGGGGGAAAAAATAGGTTTTCCTTTCTCC
4721 ACAGTGGTTGACATTTACTGCCACCACTTTCCAGGCCTTAGGGGAGTGTGAAGAAATAGTTTCTTGAAGATGATAGAAAT
4801 TTTTTTTTTTCCGTTTCCCAGTTCTCTCAGAAGTGAGTTTCATAGCCAGTCATGTCCTTCCTGCCCGTCTAATCTGGAGA
4881 GGTCAAAGAGCAAGGAAAATAATGTGAAGAGAAACACCTGTGCCTTGATTAGGTTCTATTTCAGCATTTGACACTTGAAT
4961 TTTGAACTCCTCTGGGTCAGGAAGGGTAGCTATGGAAATGAGGTCTGAGCCAGTTGGTAGGAGAGGTTGTCTATGTTCCC
5041 ATACCGAGATTGCTGTCTAATCCACGAGAACTCATTTTGTGGCTGCAAAGTAAATACTTGATTTTAGGATATGATAGGAG
5121 CAAAATGGTGCCTACATCGTCTTTATAAAGAAAAGTATATAGCCCATTTTTTAACAAATGAATAATATATCGAATCATTG
5201 ATGACCTAAAAGAAAAATTGTTAAGGTCAGATTTTCGAGAGTGTATCTTGATGACCCATAAAACTGACTTTTTATTGTAG
5281 TTCACTAGTTCCCATAATTGCCCAGCTGTGGTTACTTTCACTGAAAAGAAAAAATATATTTTGGAAGTTAATGTAAGGAT
5361 ACATTGGCTTTTTTTTTTTTTCTTTACATTGGCTTTTTAAAAGACAGTTTTTATTTTTCAGATACTGGAATGTCAAGTAT
5441 CTGGGTTGTCCCAAGACGTTGGAGATAATTCAGCCTTCCAAGAGAACAGCAGTCTAGATCTTAGCTGAAAATGTGCTGTT
5521 TCTAAAGGAAGCTTCTTAAGTCTCAGGGGACATTAGCATCTTCATAATTTCCATATATAATAAGAATGAAGGTAAAATAT
5601 TTAAATGTGTATAAACTAATCCATAATGACCATTTACAAAGATTGACTCCCCATTTCTGGTACATATTTATCATTATTTA
5681 GATGGGTCTCCTATCTTGTGGGAAGATAAATTTATATTCAGGTGATGACATGGGTGCCTGCAAGTAGAGTTGGTCTGCAG
5761 CTGAGGGAGAAGGCAACATACCAGAAGACAAGGCAGCTTCAACCTGGATCCCCAGCTACCCTTTATTTACTTCACTGAGT
5841 CAGAAACCCGTGTTCATTGCTTCTGAGACTACTTGACCTCAGCTGGTCTTTAGAAGTCTGGTAACTTTTTATGTACAAAT
5921 CATGTTATTTACTAATTCAAGTATTTATAGAGCACCTACTGTGCACTAAGCACTAAAGTGCTGGTTATGCAAAGGTAAGC
6001 AAAAATAGTCATGTAAGTTGCAGAAAGGTTTTCCTAAAGTAGTGACTATACAGCATGTTTTTAGTTCTAGGCTCAAGGAG
6081 TAATACTACCTTTTTCCCAAGATAGGTTGAAAATTTAAATGAGTTATGAAATGGAAGTGTTTGAGACACTGGACACAGTA
6161 GTGGCAAATACATGAAGAAAGAAGGTCCCTAGATGAAAAAAGTGTGGAAATGAGGAGCCATATTAATAAAATGCACCTTT
6241 TTTGAGAACTATTGTTGGAATAGCTAAAGTTGTCTATAGAAATTTCAAGAAATCTCTTAACATCTAAATTAGAAGCAGGC
6321 CAACAGCAATCTCTGTCAGTAGTTAATTTAGGTCAGTAAGTTAGTGTTTTGTTAAACTAACCCTTTCAAACACAGTTGGG
6401 TAAATAATGCAGCTTTCCTGTCACTGTTCAAACCTAAAAGAAGCTAAAGGGAATTTTTCTTAAAACATGATTTTCATCTT
6481 ATAGATGATAAGTAACTGTATCTCTTCATTTGGAATTGTTGCATCCCAGTTTTTCTCCATAATGGATAAAATTACTTTTG
6561 TGTCCTTTTCTATTCTAATGTAGAAGTGGCTTTTCCTTTTTTCTCTTGAGTCACAACTTGAATTAAAAAGGGCTTCAGCA
6641 GGACTCTAGCGCTTTTTAAAGAAGAATTTGGTGTATTCCACTATGTAACGTAGTCTCTGTCCAGGAACCAGGAGGATGAG
6721 TGTCCTCAGTTTTCCTAATACTTGGTAACATTTAATAATAGATTGAGTTTTGCTTTTGTTTTTCATAGAGACTGTATAGA
6801 CTCTGTACTTCCATGTAACTTTCTGCCTTAACCTAAAAAGGCATTCCCTGGAAGGAGATCTTGTAACAGGAAGAAAAAGC
6881 GAAACCAGGAAAAGAGCCAGAAAGGATCAACTTGGAGATGGGCTGTGGCTAAATAGTGGGTTTTCCTGAAAAGTAACTGC
6961 AACCTTGCTTTTCGTGCTTCTTCAAACCCAAAAGAACCTAAAGGGAATTTTTAAAAATCCTGATTTTCTTCTTAATTGTA
7041 AAACCTAGAGGATGCCTTAGGGAGAAGAAAGATAACCTGGAATTTGGTTTTAAATGGATTTAAGTAAACTTTGAATTAAG
7121 TAGCTTATTCCATTTTTGAGAGATTTCTTTTTAAGATTTTAGATTCACTTAATGTAATGTTGAATTGCCATGAATGTAAC
7201 CTGGAGTTTGATTTGAGACATTCTGTGGGATAAGGAATAGTTTTCTATTGAACTGTGGTGGCTTTTGCCACTAATCAGGA
7281 TTTAGGGCTGTGCACCTCCATCTGTTAAGTGAAATGGAACTTGGCTTCCTAAACACTATATTAGACCAACTTGAGTCAAT
7361 ACTTTTATTAAGTTTAATCAGGGATTCTCAAAATATTTAGGATTCAAATTAGCCCAATTAGAAAGCAGTGCATTAAATGT
7441 TACCAAAATATCTGAAGATACTTTAGAACTATTTTACACAAAGCTTATGTCTTTCCTATGGAAAGTATCATACATAAAAT
7521 TTTACATTCTTTTAAAAAACAGAATCTAATGTCTTCAGATACCTAGAGCTTGGAAATTATAATAGAGTTGGGCTTTGACC
7601 CGAAGTCAGCAGTTCTTTTCATTTTAGATTTTCAGGCAAGTTTCAGTAGTTTGGAGACTTCTTCAGTAGTGACCCCAGCT
7681 TAACCTACATATAATCACTTTGCACACATTTTAAGTTAATCAGATGCTTCCAGAGTCTTGGATTTGGTTACCCCTTTGTT
7761 AGATAAGGAGACAGATTCTAGGTTGGGACAAACATCTTAATTTATTCTCTAATAATAAAGTACTGATTAAAGAGCAAGTT
7841 CTCAGAGAATTCACAAAATTTCTAGAATCCATGAAAGATCTAGAGAACATAACAAATGAAACTCTAGAAATTTGAAAGAA
7921 AAAAAAACACTTAGCTGTAAGTGCTTTGACCTATTTTTTTTAAAAAAAAAAAACCTGTCTTAATTCTGTGACTGCATTGC
8001 ACCCTTCACCAGCACTAAGAGAAGTCGGAATGGAAGAAATTACCGTATGTAATTCTTATTCACTTAAAATCTTTGTGCGC
8081 ATAGGCCTTAGCACTTTGACAAATAAACTCTGCCTTTTAGCTCCTCACTATTGTCTTCTTTCCTGTCACTTTTAGGCTGT
8161 TTCATTGGTCGTATAAAAACAACCTTCTTCGAAGTTGAATGTATGTTTCTGCACATAGACAAACCATATTTTACTGACTC
8241 ATTCTATGTTGAATAAAGGCATACAGTTTTACCCTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGG-UAAUACACGACGAu 5'
              |:|: |  ||||||||:| 
Target 5' tcttAGCTGAAAATGTGCTGTTt 3'
5499 - 5521 142.00 -12.80
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|:|: :| |  |||||:| 
Target 5' gcTAGATAGTCAGCTGCTGTTg 3'
1055 - 1076 136.00 -10.90
3
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||||:| |||| || 
Target 5' atgtgcCCATTGTTTGCTCCTa 3'
4644 - 4665 136.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30505186 18 COSMIC
COSN30509076 29 COSMIC
COSN31593806 50 COSMIC
COSN23092373 54 COSMIC
COSN30109822 58 COSMIC
COSN30136039 59 COSMIC
COSN6177040 83 COSMIC
COSN30102520 84 COSMIC
COSN30461766 88 COSMIC
COSN6177039 93 COSMIC
COSN31503003 103 COSMIC
COSN31486329 134 COSMIC
COSN8608986 139 COSMIC
COSN31579039 169 COSMIC
COSN7801755 414 COSMIC
COSN29133044 628 COSMIC
COSN1236937 683 COSMIC
COSN1834149 1111 COSMIC
COSN20723087 1114 COSMIC
COSN28117595 1196 COSMIC
COSN28050526 1197 COSMIC
COSN5501240 1242 COSMIC
COSN55047 1779 COSMIC
COSN22331689 1803 COSMIC
COSN16966141 1916 COSMIC
COSN21335541 2019 COSMIC
COSN7801754 2131 COSMIC
COSN25830658 2187 COSMIC
COSN7243212 2232 COSMIC
COSN32062749 3126 COSMIC
COSN1834148 3199 COSMIC
COSN7243211 3225 COSMIC
COSN1236936 3404 COSMIC
COSN1834147 3761 COSMIC
COSN9368594 3918 COSMIC
COSN22788045 4006 COSMIC
COSN30394303 4467 COSMIC
COSN7801753 4615 COSMIC
COSN7801752 4652 COSMIC
COSN22113492 4730 COSMIC
COSN15867745 5272 COSMIC
COSN29212001 5297 COSMIC
COSN27468539 5316 COSMIC
COSN19376736 5319 COSMIC
COSN1236935 5369 COSMIC
COSN15665305 5382 COSMIC
COSN7243209 5873 COSMIC
COSN21829121 6134 COSMIC
COSN9998008 6245 COSMIC
COSN24012442 6294 COSMIC
COSN1834146 6306 COSMIC
COSN24036259 6333 COSMIC
COSN7243208 6498 COSMIC
COSN9368593 6627 COSMIC
COSN7243207 6881 COSMIC
COSN32161382 7602 COSMIC
COSN7801751 7961 COSMIC
COSN25114577 7962 COSMIC
COSN27016212 7963 COSMIC
COSN22115271 8055 COSMIC
COSN9998007 8146 COSMIC
COSN9998006 8147 COSMIC
COSN1834145 8274 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs932346178 4 dbSNP
rs1160593538 6 dbSNP
rs1243558528 17 dbSNP
rs185477431 20 dbSNP
rs769748856 21 dbSNP
rs747981502 22 dbSNP
rs367974288 25 dbSNP
rs374936572 28 dbSNP
rs1180839481 32 dbSNP
rs746866976 35 dbSNP
rs779674038 40 dbSNP
rs1196327638 41 dbSNP
rs1316893048 43 dbSNP
rs906557790 53 dbSNP
rs1023642350 54 dbSNP
rs975426813 55 dbSNP
rs963584901 58 dbSNP
rs888612465 67 dbSNP
rs1048589026 70 dbSNP
rs1016441610 74 dbSNP
rs1228148474 79 dbSNP
rs930206682 88 dbSNP
rs112873109 93 dbSNP
rs1272204621 95 dbSNP
rs1327257876 96 dbSNP
rs1268517528 98 dbSNP
rs1431495638 103 dbSNP
rs1041711121 104 dbSNP
rs1217902298 112 dbSNP
rs910896270 122 dbSNP
rs1198585895 130 dbSNP
rs1254967245 134 dbSNP
rs753688750 146 dbSNP
rs1447232308 147 dbSNP
rs950847836 160 dbSNP
rs985206963 162 dbSNP
rs370279270 167 dbSNP
rs1477239023 170 dbSNP
rs1462965351 175 dbSNP
rs1036190571 182 dbSNP
rs1177769997 184 dbSNP
rs766193890 185 dbSNP
rs905898248 187 dbSNP
rs1163774657 193 dbSNP
rs1464801889 199 dbSNP
rs1426573829 211 dbSNP
rs767756646 212 dbSNP
rs1385884226 215 dbSNP
rs1022946064 222 dbSNP
rs1421189093 224 dbSNP
rs1186756223 227 dbSNP
rs1316546396 231 dbSNP
rs139932342 238 dbSNP
rs577212127 238 dbSNP
rs1283841747 241 dbSNP
rs1347324184 245 dbSNP
rs1230716430 247 dbSNP
rs1474757842 249 dbSNP
rs1245701597 251 dbSNP
rs1255213715 255 dbSNP
rs772458095 265 dbSNP
rs1206506073 268 dbSNP
rs1470195791 270 dbSNP
rs1487673714 286 dbSNP
rs956085857 289 dbSNP
rs558485239 290 dbSNP
rs1320303082 302 dbSNP
rs537167785 303 dbSNP
rs1364704138 311 dbSNP
rs576091963 318 dbSNP
rs368126212 328 dbSNP
rs1471388034 330 dbSNP
rs893070432 333 dbSNP
rs1215410855 341 dbSNP
rs1157064783 343 dbSNP
rs1341482992 355 dbSNP
rs1360201113 357 dbSNP
rs1052999970 359 dbSNP
rs934491331 360 dbSNP
rs1295470231 361 dbSNP
rs1443251606 363 dbSNP
rs112007704 364 dbSNP
rs755853607 365 dbSNP
rs890957798 367 dbSNP
rs981332443 381 dbSNP
rs1300567019 387 dbSNP
rs188996748 393 dbSNP
rs186630033 404 dbSNP
rs567310887 407 dbSNP
rs1352548947 408 dbSNP
rs1222527677 415 dbSNP
rs1428731934 421 dbSNP
rs1387979592 429 dbSNP
rs973778675 439 dbSNP
rs1174968879 447 dbSNP
rs1487244203 451 dbSNP
rs1209739800 454 dbSNP
rs1454379678 468 dbSNP
rs1251938994 472 dbSNP
rs1254111094 476 dbSNP
rs564330767 478 dbSNP
rs141131150 479 dbSNP
rs1165502297 480 dbSNP
rs1234983164 483 dbSNP
rs547814965 485 dbSNP
rs1482836017 489 dbSNP
rs1292866940 490 dbSNP
rs1397132331 496 dbSNP
rs1448646771 497 dbSNP
rs983633861 504 dbSNP
rs950918432 507 dbSNP
rs539278424 515 dbSNP
rs1035860390 523 dbSNP
rs1246222809 524 dbSNP
rs981956407 540 dbSNP
rs1314487446 545 dbSNP
rs1272841515 550 dbSNP
rs571158285 561 dbSNP
rs970151910 562 dbSNP
rs1348706119 568 dbSNP
rs1252330519 571 dbSNP
rs549775642 579 dbSNP
rs1197087121 587 dbSNP
rs1481913638 587 dbSNP
rs1300422780 595 dbSNP
rs1217438555 598 dbSNP
rs1023439853 600 dbSNP
rs1375195924 603 dbSNP
rs17047139 608 dbSNP
rs1008485243 614 dbSNP
rs1423254700 621 dbSNP
rs561001715 622 dbSNP
rs1373527643 627 dbSNP
rs764237396 634 dbSNP
rs182487740 644 dbSNP
rs1434720770 647 dbSNP
rs1304215792 650 dbSNP
rs2033173 652 dbSNP
rs1394885183 654 dbSNP
rs1295700316 659 dbSNP
rs1175912713 661 dbSNP
rs148225214 664 dbSNP
rs1217303944 666 dbSNP
rs1258034345 670 dbSNP
rs1050937651 671 dbSNP
rs1324712160 679 dbSNP
rs1053293449 680 dbSNP
rs190316584 683 dbSNP
rs899599633 695 dbSNP
rs868385699 696 dbSNP
rs184637100 705 dbSNP
rs1263909006 707 dbSNP
rs1038489457 708 dbSNP
rs941039863 711 dbSNP
rs867873811 725 dbSNP
rs1048005146 731 dbSNP
rs1177978951 732 dbSNP
rs1357021731 733 dbSNP
rs969982265 744 dbSNP
rs1289129188 747 dbSNP
rs1341811575 752 dbSNP
rs929541983 753 dbSNP
rs916566733 754 dbSNP
rs928824371 755 dbSNP
rs546230209 763 dbSNP
rs952839230 765 dbSNP
rs1221247607 766 dbSNP
rs1486017720 774 dbSNP
rs1276991944 778 dbSNP
rs1312021930 788 dbSNP
rs1216747183 792 dbSNP
rs981644840 796 dbSNP
rs1288500005 812 dbSNP
rs1487344692 813 dbSNP
rs1255513022 816 dbSNP
rs1215986401 817 dbSNP
rs1208173449 825 dbSNP
rs564950656 827 dbSNP
rs970605802 830 dbSNP
rs765197550 836 dbSNP
rs543442472 837 dbSNP
rs1159362939 838 dbSNP
rs1348401932 839 dbSNP
rs915998253 841 dbSNP
rs961526108 850 dbSNP
rs3769672 851 dbSNP
rs1366693774 852 dbSNP
rs1439187473 869 dbSNP
rs957399443 871 dbSNP
rs1008473833 875 dbSNP
rs1300532114 879 dbSNP
rs3769673 881 dbSNP
rs1454956862 883 dbSNP
rs1347453983 885 dbSNP
rs565211724 890 dbSNP
rs1160574088 893 dbSNP
rs890067053 896 dbSNP
rs1351797103 901 dbSNP
rs545335479 910 dbSNP
rs144710926 929 dbSNP
rs377639438 935 dbSNP
rs955331295 942 dbSNP
rs1453439353 944 dbSNP
rs1029970065 945 dbSNP
rs140896685 951 dbSNP
rs538985911 952 dbSNP
rs571876229 957 dbSNP
rs928480177 967 dbSNP
rs1045570350 972 dbSNP
rs1406662011 973 dbSNP
rs1322145420 974 dbSNP
rs1349810831 984 dbSNP
rs1443306453 990 dbSNP
rs1038118481 1000 dbSNP
rs1005255310 1005 dbSNP
rs138078147 1014 dbSNP
rs773706646 1015 dbSNP
rs1316053302 1026 dbSNP
rs1358545389 1026 dbSNP
rs537869848 1027 dbSNP
rs928918867 1029 dbSNP
rs1180177627 1030 dbSNP
rs919921987 1032 dbSNP
rs1239742925 1034 dbSNP
rs1046364383 1037 dbSNP
rs948921636 1040 dbSNP
rs1237765936 1050 dbSNP
rs1473457848 1053 dbSNP
rs1160959317 1056 dbSNP
rs191449417 1061 dbSNP
rs1413641617 1066 dbSNP
rs1173501698 1068 dbSNP
rs990258282 1080 dbSNP
rs1398527392 1090 dbSNP
rs957432081 1093 dbSNP
rs549141964 1096 dbSNP
rs972837713 1098 dbSNP
rs1342500023 1107 dbSNP
rs961791391 1119 dbSNP
rs1283708422 1120 dbSNP
rs1476482139 1122 dbSNP
rs1261170944 1127 dbSNP
rs1362800922 1128 dbSNP
rs1219147469 1132 dbSNP
rs1259984599 1135 dbSNP
rs527342302 1142 dbSNP
rs1208059958 1149 dbSNP
rs566554410 1157 dbSNP
rs551517469 1158 dbSNP
rs532964624 1159 dbSNP
rs879857369 1159 dbSNP
rs879761583 1160 dbSNP
rs1233715260 1163 dbSNP
rs1184725069 1164 dbSNP
rs1236349583 1165 dbSNP
rs1339506447 1166 dbSNP
rs1028545616 1171 dbSNP
rs1422190661 1173 dbSNP
rs1465369891 1173 dbSNP
rs1310215060 1182 dbSNP
rs1383359869 1183 dbSNP
rs753872629 1189 dbSNP
rs111271284 1193 dbSNP
rs879268119 1194 dbSNP
rs767582124 1199 dbSNP
rs1321763553 1208 dbSNP
rs1338357154 1210 dbSNP
rs150847324 1212 dbSNP
rs759654245 1212 dbSNP
rs763204570 1212 dbSNP
rs892802267 1212 dbSNP
rs374657486 1213 dbSNP
rs1387158565 1218 dbSNP
rs977438800 1218 dbSNP
rs955516674 1220 dbSNP
rs1167513541 1222 dbSNP
rs998601721 1223 dbSNP
rs559700760 1226 dbSNP
rs997160734 1232 dbSNP
rs544095851 1242 dbSNP
rs188133743 1243 dbSNP
rs117108810 1245 dbSNP
rs747735313 1261 dbSNP
rs1172211587 1272 dbSNP
rs542757312 1275 dbSNP
rs1361420872 1279 dbSNP
rs1421534563 1285 dbSNP
rs1185694271 1288 dbSNP
rs1045474779 1319 dbSNP
rs542713966 1328 dbSNP
rs1296442192 1349 dbSNP
rs919204 1359 dbSNP
rs1358497624 1372 dbSNP
rs948525183 1376 dbSNP
rs1430341707 1378 dbSNP
rs1324179167 1384 dbSNP
rs1332592146 1385 dbSNP
rs1248742041 1387 dbSNP
rs1230877113 1388 dbSNP
rs1273810322 1390 dbSNP
rs1353989764 1391 dbSNP
rs1241633671 1402 dbSNP
rs1188056298 1417 dbSNP
rs1005287985 1418 dbSNP
rs1487704982 1438 dbSNP
rs574118943 1443 dbSNP
rs1270183418 1445 dbSNP
rs1254883938 1448 dbSNP
rs1198617823 1450 dbSNP
rs1381103661 1452 dbSNP
rs1441805635 1456 dbSNP
rs886872285 1458 dbSNP
rs184246452 1460 dbSNP
rs191689186 1465 dbSNP
rs1003210939 1469 dbSNP
rs545618068 1470 dbSNP
rs973169079 1471 dbSNP
rs940058162 1481 dbSNP
rs188775618 1482 dbSNP
rs1377416553 1484 dbSNP
rs1306704622 1486 dbSNP
rs1352330126 1490 dbSNP
rs948969140 1500 dbSNP
rs894678079 1502 dbSNP
rs1054644094 1504 dbSNP
rs954155605 1516 dbSNP
rs1363623891 1522 dbSNP
rs1028535793 1523 dbSNP
rs936131108 1527 dbSNP
rs990409553 1532 dbSNP
rs1237872031 1538 dbSNP
rs556944885 1540 dbSNP
rs17047134 1541 dbSNP
rs1370069518 1543 dbSNP
rs771167152 1547 dbSNP
rs1164188764 1549 dbSNP
rs1400744211 1554 dbSNP
rs1467052480 1555 dbSNP
rs998902169 1558 dbSNP
rs1372179367 1572 dbSNP
rs934042316 1575 dbSNP
rs1314291668 1579 dbSNP
rs1391059950 1591 dbSNP
rs906890483 1593 dbSNP
rs922590816 1594 dbSNP
rs1259336781 1596 dbSNP
rs1320444883 1601 dbSNP
rs1197151713 1605 dbSNP
rs1257601950 1624 dbSNP
rs1447799228 1632 dbSNP
rs79789849 1636 dbSNP
rs964292657 1637 dbSNP
rs1016777078 1639 dbSNP
rs983935186 1645 dbSNP
rs951176523 1652 dbSNP
rs1254142834 1662 dbSNP
rs567281986 1668 dbSNP
rs1025353818 1673 dbSNP
rs1396753511 1675 dbSNP
rs779914075 1680 dbSNP
rs148905796 1682 dbSNP
rs1466936755 1683 dbSNP
rs763267440 1684 dbSNP
rs930560539 1691 dbSNP
rs10153943 1693 dbSNP
rs1023710037 1698 dbSNP
rs1036297268 1700 dbSNP
rs1304281542 1701 dbSNP
rs76053652 1705 dbSNP
rs1413709541 1706 dbSNP
rs1197387940 1707 dbSNP
rs939971963 1720 dbSNP
rs1217131766 1726 dbSNP
rs1295350930 1731 dbSNP
rs1483161867 1736 dbSNP
rs1273557041 1743 dbSNP
rs1225470745 1746 dbSNP
rs773457737 1749 dbSNP
rs1212495508 1752 dbSNP
rs1011888248 1756 dbSNP
rs912569928 1768 dbSNP
rs755912422 1769 dbSNP
rs1054674672 1776 dbSNP
rs1263746775 1779 dbSNP
rs1478778311 1786 dbSNP
rs1191463731 1788 dbSNP
rs936162329 1794 dbSNP
rs533675397 1795 dbSNP
rs1331080824 1798 dbSNP
rs770248046 1804 dbSNP
rs780955029 1805 dbSNP
rs1433498132 1810 dbSNP
rs922655514 1811 dbSNP
rs981403384 1812 dbSNP
rs1393565821 1816 dbSNP
rs1371383270 1817 dbSNP
rs1307676605 1821 dbSNP
rs1288853960 1822 dbSNP
rs758684372 1823 dbSNP
rs1427829285 1826 dbSNP
rs1299389536 1851 dbSNP
rs1347454354 1857 dbSNP
rs932758012 1862 dbSNP
rs145599896 1863 dbSNP
rs1487379762 1869 dbSNP
rs942680696 1870 dbSNP
rs1213546563 1873 dbSNP
rs185108440 1881 dbSNP
rs983966290 1882 dbSNP
rs1375899887 1884 dbSNP
rs1422561710 1889 dbSNP
rs149989272 1892 dbSNP
rs1025415402 1895 dbSNP
rs981914961 1900 dbSNP
rs752818735 1902 dbSNP
rs1417396427 1903 dbSNP
rs970899211 1905 dbSNP
rs140460610 1906 dbSNP
rs1438990105 1907 dbSNP
rs550469111 1910 dbSNP
rs970995514 1913 dbSNP
rs893443653 1915 dbSNP
rs529106000 1918 dbSNP
rs1023963015 1921 dbSNP
rs557995306 1922 dbSNP
rs374645958 1935 dbSNP
rs1027426349 1936 dbSNP
rs1033297499 1942 dbSNP
rs995053181 1947 dbSNP
rs1351495953 1953 dbSNP
rs1000448618 1963 dbSNP
rs1239623500 1966 dbSNP
rs1287924228 1972 dbSNP
rs781741036 1973 dbSNP
rs1415103957 1979 dbSNP
rs1377559209 1981 dbSNP
rs1394194776 1985 dbSNP
rs1466534198 2002 dbSNP
rs1333538303 2003 dbSNP
rs1374974442 2016 dbSNP
rs1334887590 2021 dbSNP
rs1284889632 2022 dbSNP
rs1036650233 2026 dbSNP
rs1229939597 2028 dbSNP
rs1008858213 2032 dbSNP
rs1333796064 2033 dbSNP
rs147872484 2034 dbSNP
rs534477861 2041 dbSNP
rs527669491 2042 dbSNP
rs1051125957 2043 dbSNP
rs1399966396 2044 dbSNP
rs1237525599 2052 dbSNP
rs372659216 2054 dbSNP
rs144762402 2059 dbSNP
rs1186423563 2063 dbSNP
rs1417784851 2065 dbSNP
rs1478321359 2085 dbSNP
rs746538266 2090 dbSNP
rs545170031 2092 dbSNP
rs901272013 2098 dbSNP
rs1409576071 2104 dbSNP
rs369047856 2109 dbSNP
rs1335162439 2118 dbSNP
rs1360960639 2133 dbSNP
rs936133936 2138 dbSNP
rs116157511 2139 dbSNP
rs1354765872 2146 dbSNP
rs1218968928 2150 dbSNP
rs942710144 2152 dbSNP
rs193295121 2153 dbSNP
rs971653683 2158 dbSNP
rs1278979408 2166 dbSNP
rs1443579651 2170 dbSNP
rs1048335883 2172 dbSNP
rs1186206582 2177 dbSNP
rs916898754 2181 dbSNP
rs1257376404 2193 dbSNP
rs1488922423 2204 dbSNP
rs991093440 2205 dbSNP
rs1440206708 2208 dbSNP
rs1196522760 2213 dbSNP
rs1371678347 2217 dbSNP
rs958379562 2225 dbSNP
rs149693314 2226 dbSNP
rs1427543173 2236 dbSNP
rs1312383291 2241 dbSNP
rs1432888796 2241 dbSNP
rs544927258 2256 dbSNP
rs750175127 2269 dbSNP
rs188766571 2282 dbSNP
rs1300019392 2289 dbSNP
rs1324459808 2290 dbSNP
rs1226431721 2292 dbSNP
rs1275020309 2298 dbSNP
rs1226990647 2302 dbSNP
rs1231390876 2306 dbSNP
rs1278955107 2314 dbSNP
rs1381615532 2318 dbSNP
rs1353861457 2326 dbSNP
rs1285068994 2328 dbSNP
rs555766192 2339 dbSNP
rs1446724652 2342 dbSNP
rs982374976 2343 dbSNP
rs970549442 2344 dbSNP
rs1322401285 2348 dbSNP
rs1452773496 2363 dbSNP
rs1173298901 2369 dbSNP
rs916324050 2374 dbSNP
rs990578249 2376 dbSNP
rs1421665256 2387 dbSNP
rs1160163653 2394 dbSNP
rs183069820 2396 dbSNP
rs1381396032 2397 dbSNP
rs890401122 2398 dbSNP
rs1031994102 2401 dbSNP
rs572745143 2404 dbSNP
rs375274066 2408 dbSNP
rs1050350988 2415 dbSNP
rs1302309485 2416 dbSNP
rs1353795441 2438 dbSNP
rs1000478078 2443 dbSNP
rs557872665 2448 dbSNP
rs1259438199 2456 dbSNP
rs996821642 2466 dbSNP
rs1210999976 2471 dbSNP
rs1292439563 2475 dbSNP
rs1413993627 2485 dbSNP
rs967635462 2487 dbSNP
rs1162290435 2489 dbSNP
rs1471501740 2501 dbSNP
rs772295680 2506 dbSNP
rs1239021891 2509 dbSNP
rs778560970 2511 dbSNP
rs1179781297 2513 dbSNP
rs1361955674 2515 dbSNP
rs761559689 2520 dbSNP
rs936136443 2526 dbSNP
rs539104838 2527 dbSNP
rs1459741164 2537 dbSNP
rs1248026348 2548 dbSNP
rs189743749 2551 dbSNP
rs773827648 2557 dbSNP
rs1323894904 2558 dbSNP
rs1392582759 2561 dbSNP
rs1304190935 2566 dbSNP
rs1334706767 2568 dbSNP
rs1286529458 2569 dbSNP
rs950240205 2569 dbSNP
rs1006925261 2570 dbSNP
rs550331867 2572 dbSNP
rs17392059 2574 dbSNP
rs1258905215 2575 dbSNP
rs936966192 2580 dbSNP
rs929957592 2582 dbSNP
rs918504766 2594 dbSNP
rs1194336363 2596 dbSNP
rs1227980353 2606 dbSNP
rs1046276964 2611 dbSNP
rs1424531905 2615 dbSNP
rs1354566037 2620 dbSNP
rs1188160739 2621 dbSNP
rs1299875005 2632 dbSNP
rs1435993787 2633 dbSNP
rs1364354977 2634 dbSNP
rs1318475548 2636 dbSNP
rs1438261662 2638 dbSNP
rs1350286495 2639 dbSNP
rs1163987529 2644 dbSNP
rs1322412596 2645 dbSNP
rs1403223502 2646 dbSNP
rs568048833 2646 dbSNP
rs546556944 2655 dbSNP
rs973553455 2657 dbSNP
rs1448416776 2658 dbSNP
rs538511596 2659 dbSNP
rs949277352 2659 dbSNP
rs1166108565 2660 dbSNP
rs1233015238 2660 dbSNP
rs776553926 2660 dbSNP
rs961850416 2660 dbSNP
rs13392471 2661 dbSNP
rs1484632300 2662 dbSNP
rs987278610 2666 dbSNP
rs545733899 2669 dbSNP
rs954540004 2669 dbSNP
rs1167795521 2671 dbSNP
rs1372156438 2672 dbSNP
rs1028880472 2674 dbSNP
rs1373139767 2675 dbSNP
rs1414688218 2676 dbSNP
rs1299404841 2677 dbSNP
rs1364520353 2678 dbSNP
rs990593509 2682 dbSNP
rs1380892946 2687 dbSNP
rs1295054623 2688 dbSNP
rs957759867 2706 dbSNP
rs924995115 2711 dbSNP
rs560278651 2717 dbSNP
rs966364193 2718 dbSNP
rs1020961310 2755 dbSNP
rs1278255054 2756 dbSNP
rs1347318307 2762 dbSNP
rs977021053 2766 dbSNP
rs1221341792 2771 dbSNP
rs1450077599 2772 dbSNP
rs1277106754 2776 dbSNP
rs899827672 2782 dbSNP
rs1033046798 2784 dbSNP
rs1184581950 2786 dbSNP
rs534315143 2799 dbSNP
rs1175182601 2802 dbSNP
rs1433380386 2802 dbSNP
rs1229158638 2806 dbSNP
rs903289875 2814 dbSNP
rs1018424365 2821 dbSNP
rs1341548801 2824 dbSNP
rs1006985889 2825 dbSNP
rs1347479328 2834 dbSNP
rs1429002649 2835 dbSNP
rs1295264083 2838 dbSNP
rs1368803990 2840 dbSNP
rs1041799812 2850 dbSNP
rs950188355 2855 dbSNP
rs888550923 2857 dbSNP
rs748683978 2858 dbSNP
rs1240978446 2859 dbSNP
rs1026989985 2860 dbSNP
rs1213609840 2867 dbSNP
rs1055971752 2875 dbSNP
rs994139555 2879 dbSNP
rs779539517 2880 dbSNP
rs1195107638 2886 dbSNP
rs551863335 2887 dbSNP
rs1453208744 2888 dbSNP
rs1178741085 2892 dbSNP
rs1046785249 2894 dbSNP
rs920242915 2897 dbSNP
rs1399439945 2910 dbSNP
rs1159089263 2913 dbSNP
rs1372011954 2926 dbSNP
rs879633141 2930 dbSNP
rs973117381 2933 dbSNP
rs1308278383 2937 dbSNP
rs533419778 2940 dbSNP
rs895002071 2943 dbSNP
rs34250682 2948 dbSNP
rs1394052299 2951 dbSNP
rs1054977851 2954 dbSNP
rs1177662707 2955 dbSNP
rs1435390141 2967 dbSNP
rs936464645 2969 dbSNP
rs769783345 2971 dbSNP
rs1371345288 2982 dbSNP
rs1221995527 2991 dbSNP
rs186540193 2991 dbSNP
rs1426562375 3002 dbSNP
rs987226405 3006 dbSNP
rs1467778486 3009 dbSNP
rs1204835055 3024 dbSNP
rs563099144 3025 dbSNP
rs945068221 3026 dbSNP
rs922958303 3028 dbSNP
rs1415169740 3041 dbSNP
rs745771410 3043 dbSNP
rs1254165296 3048 dbSNP
rs1163260261 3050 dbSNP
rs1206175173 3054 dbSNP
rs965643111 3057 dbSNP
rs1482742886 3060 dbSNP
rs1331201563 3073 dbSNP
rs958007466 3075 dbSNP
rs1018459268 3085 dbSNP
rs1297479281 3089 dbSNP
rs1356038562 3099 dbSNP
rs1234863032 3102 dbSNP
rs1291186164 3106 dbSNP
rs1033407535 3107 dbSNP
rs1214793567 3109 dbSNP
rs985597769 3110 dbSNP
rs1000174245 3112 dbSNP
rs1272547776 3118 dbSNP
rs369665597 3120 dbSNP
rs903192323 3122 dbSNP
rs1186491328 3126 dbSNP
rs544784868 3130 dbSNP
rs140811830 3132 dbSNP
rs1300581116 3134 dbSNP
rs1169808562 3136 dbSNP
rs1417653377 3137 dbSNP
rs562448604 3140 dbSNP
rs1027060481 3153 dbSNP
rs147299572 3155 dbSNP
rs1377395416 3165 dbSNP
rs572804275 3168 dbSNP
rs1416528766 3180 dbSNP
rs1352106547 3190 dbSNP
rs764071046 3197 dbSNP
rs1354510618 3199 dbSNP
rs756949965 3203 dbSNP
rs1024963450 3204 dbSNP
rs557421081 3207 dbSNP
rs1213667355 3208 dbSNP
rs1280394939 3209 dbSNP
rs1013974119 3214 dbSNP
rs1209353723 3216 dbSNP
rs1002176394 3223 dbSNP
rs759566349 3224 dbSNP
rs539168658 3225 dbSNP
rs182605337 3226 dbSNP
rs1174559662 3229 dbSNP
rs778935278 3235 dbSNP
rs1360192031 3248 dbSNP
rs1171618689 3254 dbSNP
rs1401433988 3255 dbSNP
rs1401030686 3257 dbSNP
rs1175981859 3268 dbSNP
rs903678517 3285 dbSNP
rs1320004087 3295 dbSNP
rs190012053 3298 dbSNP
rs1303781131 3302 dbSNP
rs10153560 3315 dbSNP
rs1231462887 3327 dbSNP
rs145509803 3333 dbSNP
rs1352076678 3335 dbSNP
rs1207453675 3343 dbSNP
rs1472369375 3344 dbSNP
rs1248767591 3345 dbSNP
rs546915919 3349 dbSNP
rs975793757 3361 dbSNP
rs1183661162 3366 dbSNP
rs1255140934 3369 dbSNP
rs1483630321 3372 dbSNP
rs1193115639 3373 dbSNP
rs146542814 3374 dbSNP
rs1207978250 3381 dbSNP
rs1160289846 3384 dbSNP
rs1382509364 3385 dbSNP
rs925191849 3390 dbSNP
rs1326100194 3393 dbSNP
rs1396251888 3394 dbSNP
rs978419102 3397 dbSNP
rs942990544 3398 dbSNP
rs911482080 3406 dbSNP
rs570728021 3409 dbSNP
rs1268490008 3411 dbSNP
rs1241798609 3415 dbSNP
rs952924134 3424 dbSNP
rs920078118 3430 dbSNP
rs775712828 3438 dbSNP
rs1350337926 3441 dbSNP
rs1214731379 3449 dbSNP
rs1275234349 3464 dbSNP
rs1467283110 3471 dbSNP
rs973258913 3473 dbSNP
rs372319503 3486 dbSNP
rs1439702453 3488 dbSNP
rs961498271 3490 dbSNP
rs553990191 3493 dbSNP
rs1025455708 3494 dbSNP
rs960137844 3503 dbSNP
rs1034866688 3512 dbSNP
rs534575755 3519 dbSNP
rs1419813423 3520 dbSNP
rs1459530801 3521 dbSNP
rs1292646875 3526 dbSNP
rs1001683209 3532 dbSNP
rs1392638777 3534 dbSNP
rs899335554 3541 dbSNP
rs187100670 3545 dbSNP
rs1013588772 3551 dbSNP
rs1295474074 3555 dbSNP
rs1333220294 3558 dbSNP
rs959323859 3560 dbSNP
rs1252118124 3581 dbSNP
rs1481627086 3583 dbSNP
rs1194177107 3591 dbSNP
rs1314449208 3597 dbSNP
rs1033627673 3606 dbSNP
rs1396040204 3613 dbSNP
rs551654950 3614 dbSNP
rs886096120 3618 dbSNP
rs1051455472 3625 dbSNP
rs1302725988 3640 dbSNP
rs933036760 3643 dbSNP
rs1474104659 3650 dbSNP
rs1163559910 3652 dbSNP
rs1373309758 3655 dbSNP
rs1463032225 3658 dbSNP
rs903711389 3668 dbSNP
rs1451069424 3674 dbSNP
rs1165620345 3677 dbSNP
rs1369453278 3679 dbSNP
rs1042231318 3682 dbSNP
rs1039204422 3684 dbSNP
rs1353885803 3688 dbSNP
rs936479773 3690 dbSNP
rs1296505255 3691 dbSNP
rs528403551 3697 dbSNP
rs1362221117 3699 dbSNP
rs779525834 3701 dbSNP
rs1424432932 3702 dbSNP
rs1348766973 3712 dbSNP
rs530550053 3714 dbSNP
rs1211505582 3728 dbSNP
rs551773885 3731 dbSNP
rs1255590027 3732 dbSNP
rs1181864366 3733 dbSNP
rs559478508 3734 dbSNP
rs1248626515 3741 dbSNP
rs978029095 3742 dbSNP
rs1429904590 3743 dbSNP
rs533484723 3761 dbSNP
rs1326821928 3766 dbSNP
rs901597113 3769 dbSNP
rs1389006418 3770 dbSNP
rs1434806444 3774 dbSNP
rs1266802638 3775 dbSNP
rs966627992 3785 dbSNP
rs750920918 3790 dbSNP
rs1465820620 3801 dbSNP
rs1040493761 3809 dbSNP
rs1364590642 3812 dbSNP
rs1380735169 3814 dbSNP
rs943083409 3818 dbSNP
rs913217320 3824 dbSNP
rs1371743619 3826 dbSNP
rs992765694 3830 dbSNP
rs1309923510 3837 dbSNP
rs1230061713 3842 dbSNP
rs562996248 3844 dbSNP
rs1002027429 3845 dbSNP
rs1321828096 3853 dbSNP
rs181689976 3859 dbSNP
rs910219121 3866 dbSNP
rs148589307 3869 dbSNP
rs1049992857 3872 dbSNP
rs1247047890 3886 dbSNP
rs1383302628 3897 dbSNP
rs1194989822 3901 dbSNP
rs1392767545 3902 dbSNP
rs1295460427 3912 dbSNP
rs562099842 3913 dbSNP
rs1160550745 3914 dbSNP
rs1458573449 3917 dbSNP
rs1347316334 3922 dbSNP
rs931553746 3944 dbSNP
rs1320080539 3949 dbSNP
rs920150363 3951 dbSNP
rs1395530653 3952 dbSNP
rs1443427191 3954 dbSNP
rs972942505 3957 dbSNP
rs1161728064 3959 dbSNP
rs1301306178 3965 dbSNP
rs540923226 3966 dbSNP
rs1218571180 3986 dbSNP
rs770020271 3986 dbSNP
rs1390639718 3989 dbSNP
rs1226371210 3994 dbSNP
rs1187886489 3999 dbSNP
rs1016878075 4005 dbSNP
rs961802540 4007 dbSNP
rs918013800 4009 dbSNP
rs992641606 4010 dbSNP
rs959400183 4015 dbSNP
rs1030605847 4019 dbSNP
rs1033661940 4035 dbSNP
rs1487953050 4042 dbSNP
rs1289221068 4043 dbSNP
rs1463197682 4049 dbSNP
rs1324214016 4051 dbSNP
rs1206607230 4053 dbSNP
rs1443035866 4056 dbSNP
rs1342265825 4058 dbSNP
rs1298944075 4064 dbSNP
rs543054833 4067 dbSNP
rs900173772 4079 dbSNP
rs1228345524 4087 dbSNP
rs1287466303 4089 dbSNP
rs1325255009 4094 dbSNP
rs1303853087 4096 dbSNP
rs1335307386 4105 dbSNP
rs1387763843 4106 dbSNP
rs1234748222 4116 dbSNP
rs1287312170 4120 dbSNP
rs1320533610 4125 dbSNP
rs1204640749 4128 dbSNP
rs1000813059 4133 dbSNP
rs573428997 4142 dbSNP
rs1258651027 4146 dbSNP
rs1021252678 4152 dbSNP
rs1476393278 4163 dbSNP
rs1413371430 4168 dbSNP
rs1410567286 4169 dbSNP
rs1172583640 4181 dbSNP
rs1352886191 4183 dbSNP
rs1407911537 4186 dbSNP
rs903674212 4213 dbSNP
rs1431662320 4219 dbSNP
rs1042638213 4224 dbSNP
rs1282021429 4253 dbSNP
rs1377947687 4255 dbSNP
rs945230568 4263 dbSNP
rs1274476916 4267 dbSNP
rs564123987 4271 dbSNP
rs1339539618 4274 dbSNP
rs1371267604 4280 dbSNP
rs1168092909 4282 dbSNP
rs917805080 4284 dbSNP
rs1185908938 4286 dbSNP
rs1486829378 4286 dbSNP
rs1474368681 4290 dbSNP
rs1379368419 4295 dbSNP
rs1188566514 4317 dbSNP
rs1475852057 4317 dbSNP
rs1388400073 4325 dbSNP
rs992046341 4327 dbSNP
rs1009412341 4328 dbSNP
rs1167825220 4343 dbSNP
rs938643796 4356 dbSNP
rs1376021216 4361 dbSNP
rs1436544933 4375 dbSNP
rs192489875 4376 dbSNP
rs1040162866 4381 dbSNP
rs767947684 4382 dbSNP
rs1431001477 4390 dbSNP
rs963822190 4394 dbSNP
rs574872406 4395 dbSNP
rs1266247147 4396 dbSNP
rs762026228 4399 dbSNP
rs529347147 4413 dbSNP
rs1304755225 4425 dbSNP
rs983593886 4430 dbSNP
rs1199295986 4435 dbSNP
rs1278347148 4438 dbSNP
rs1206895187 4443 dbSNP
rs1448009513 4449 dbSNP
rs1218138059 4454 dbSNP
rs1246441306 4455 dbSNP
rs1448893307 4458 dbSNP
rs1007247757 4480 dbSNP
rs888812323 4483 dbSNP
rs1397017513 4488 dbSNP
rs1273257767 4500 dbSNP
rs1193637500 4505 dbSNP
rs1048730464 4507 dbSNP
rs1332561166 4513 dbSNP
rs950872968 4514 dbSNP
rs1337999701 4522 dbSNP
rs1401088001 4523 dbSNP
rs1322078041 4532 dbSNP
rs1386037055 4539 dbSNP
rs1030550429 4541 dbSNP
rs930289825 4544 dbSNP
rs1258296092 4545 dbSNP
rs187229365 4558 dbSNP
rs920179540 4571 dbSNP
rs771318808 4584 dbSNP
rs1231704959 4593 dbSNP
rs774062168 4600 dbSNP
rs1274784731 4602 dbSNP
rs181823742 4625 dbSNP
rs1225858328 4630 dbSNP
rs940235677 4639 dbSNP
rs918074473 4643 dbSNP
rs1281559350 4645 dbSNP
rs1411872402 4650 dbSNP
rs188382676 4659 dbSNP
rs534941438 4662 dbSNP
rs183714117 4663 dbSNP
rs992280060 4669 dbSNP
rs144823330 4674 dbSNP
rs1377022364 4676 dbSNP
rs1307497662 4684 dbSNP
rs926664129 4686 dbSNP
rs979444390 4692 dbSNP
rs968008398 4693 dbSNP
rs181385825 4696 dbSNP
rs776952216 4698 dbSNP
rs762584523 4703 dbSNP
rs543527503 4704 dbSNP
rs769316332 4707 dbSNP
rs189533294 4716 dbSNP
rs896325810 4720 dbSNP
rs1056306490 4722 dbSNP
rs1184140922 4723 dbSNP
rs1328983045 4724 dbSNP
rs1007321112 4725 dbSNP
rs1275296495 4726 dbSNP
rs62130125 4727 dbSNP
rs752335772 4735 dbSNP
rs1209348405 4742 dbSNP
rs1223846674 4779 dbSNP
rs937963423 4785 dbSNP
rs1438302436 4790 dbSNP
rs62130124 4797 dbSNP
rs1184334178 4799 dbSNP
rs1249344774 4800 dbSNP
rs1472145365 4810 dbSNP
rs1369865139 4811 dbSNP
rs551102981 4811 dbSNP
rs927303523 4811 dbSNP
rs888884430 4812 dbSNP
rs1432160837 4813 dbSNP
rs980531954 4813 dbSNP
rs1350190117 4817 dbSNP
rs552025244 4820 dbSNP
rs1315059760 4828 dbSNP
rs994468081 4836 dbSNP
rs1338891020 4842 dbSNP
rs568659466 4849 dbSNP
rs546843130 4853 dbSNP
rs78630253 4863 dbSNP
rs1201553068 4866 dbSNP
rs940247792 4867 dbSNP
rs1207130478 4880 dbSNP
rs557935573 4882 dbSNP
rs1057046684 4885 dbSNP
rs1323505919 4886 dbSNP
rs1482580066 4887 dbSNP
rs1188433089 4888 dbSNP
rs1258061370 4890 dbSNP
rs1421672106 4892 dbSNP
rs950860491 4901 dbSNP
rs769251360 4902 dbSNP
rs533171622 4908 dbSNP
rs1230696625 4912 dbSNP
rs546086110 4913 dbSNP
rs1167206085 4917 dbSNP
rs1370516520 4927 dbSNP
rs1435929191 4930 dbSNP
rs926703272 4934 dbSNP
rs1279204286 4938 dbSNP
rs976319679 4948 dbSNP
rs1400590165 4953 dbSNP
rs965355830 4954 dbSNP
rs1296569251 4955 dbSNP
rs1342378037 4957 dbSNP
rs1334686946 4961 dbSNP
rs1395365235 4963 dbSNP
rs1403874232 4964 dbSNP
rs1341339309 4966 dbSNP
rs530465384 4970 dbSNP
rs1457581628 4973 dbSNP
rs1257531409 4975 dbSNP
rs1482153553 4984 dbSNP
rs1199467860 4985 dbSNP
rs1262016029 4989 dbSNP
rs946739638 4992 dbSNP
rs1389067784 5000 dbSNP
rs1455073819 5003 dbSNP
rs967749308 5006 dbSNP
rs1020623524 5012 dbSNP
rs1376215532 5019 dbSNP
rs776490506 5033 dbSNP
rs1289618487 5035 dbSNP
rs770761149 5040 dbSNP
rs896314364 5041 dbSNP
rs1371898115 5042 dbSNP
rs913874127 5044 dbSNP
rs1303332171 5045 dbSNP
rs1461260422 5046 dbSNP
rs1232298116 5049 dbSNP
rs1268569445 5054 dbSNP
rs988106795 5060 dbSNP
rs1206497211 5063 dbSNP
rs905084456 5064 dbSNP
rs562578751 5065 dbSNP
rs1283781702 5066 dbSNP
rs1265910741 5072 dbSNP
rs1222305957 5074 dbSNP
rs966371801 5075 dbSNP
rs72799640 5082 dbSNP
rs1245427082 5088 dbSNP
rs985930597 5090 dbSNP
rs1158707772 5097 dbSNP
rs909256345 5101 dbSNP
rs369937883 5108 dbSNP
rs1027394374 5112 dbSNP
rs994541889 5116 dbSNP
rs929405770 5132 dbSNP
rs376655359 5134 dbSNP
rs1386187496 5137 dbSNP
rs1435490305 5138 dbSNP
rs976226746 5139 dbSNP
rs1226121566 5143 dbSNP
rs1267118191 5145 dbSNP
rs897511348 5149 dbSNP
rs964922914 5150 dbSNP
rs1223170993 5158 dbSNP
rs574423279 5159 dbSNP
rs537116229 5161 dbSNP
rs1488429223 5166 dbSNP
rs185479776 5167 dbSNP
rs1254334568 5189 dbSNP
rs979712790 5191 dbSNP
rs552692696 5192 dbSNP
rs1162115140 5193 dbSNP
rs1442254375 5194 dbSNP
rs896748256 5195 dbSNP
rs1349429817 5198 dbSNP
rs1383859698 5201 dbSNP
rs900754456 5205 dbSNP
rs938195786 5217 dbSNP
rs1407792497 5222 dbSNP
rs1287279666 5236 dbSNP
rs1020610354 5237 dbSNP
rs149424257 5238 dbSNP
rs1287122526 5239 dbSNP
rs749488810 5243 dbSNP
rs1241872652 5245 dbSNP
rs1214148481 5248 dbSNP
rs1034750675 5250 dbSNP
rs1290872211 5252 dbSNP
rs558929955 5253 dbSNP
rs1357408606 5255 dbSNP
rs1238461439 5266 dbSNP
rs145939670 5268 dbSNP
rs1299664705 5269 dbSNP
rs536275803 5272 dbSNP
rs905032387 5274 dbSNP
rs780314052 5283 dbSNP
rs913961557 5284 dbSNP
rs1429215595 5289 dbSNP
rs1268193961 5292 dbSNP
rs1005501782 5294 dbSNP
rs1427788773 5310 dbSNP
rs1359589044 5318 dbSNP
rs1350052475 5319 dbSNP
rs35662030 5328 dbSNP
rs1282078533 5329 dbSNP
rs1377744651 5335 dbSNP
rs1052883618 5336 dbSNP
rs1228535413 5352 dbSNP
rs944686109 5353 dbSNP
rs1422174924 5355 dbSNP
rs911804892 5357 dbSNP
rs1168735126 5363 dbSNP
rs1450607791 5366 dbSNP
rs1419516821 5367 dbSNP
rs1211116034 5368 dbSNP
rs887765886 5372 dbSNP
rs1444495682 5374 dbSNP
rs1479209923 5379 dbSNP
rs1190562060 5382 dbSNP
rs1237142205 5382 dbSNP
rs201390325 5382 dbSNP
rs760740134 5382 dbSNP
rs78072926 5382 dbSNP
rs1247464961 5386 dbSNP
rs1198992361 5387 dbSNP
rs1489934209 5391 dbSNP
rs1167334729 5399 dbSNP
rs756215662 5408 dbSNP
rs1047784092 5413 dbSNP
rs1331740893 5415 dbSNP
rs13004845 5421 dbSNP
rs1206043058 5424 dbSNP
rs953250190 5428 dbSNP
rs1435420666 5439 dbSNP
rs920407242 5446 dbSNP
rs1306833318 5457 dbSNP
rs557363380 5458 dbSNP
rs367563828 5459 dbSNP
rs1014651779 5464 dbSNP
rs1347516831 5469 dbSNP
rs1217866126 5472 dbSNP
rs568495446 5474 dbSNP
rs1040470481 5475 dbSNP
rs1210886780 5479 dbSNP
rs943495829 5484 dbSNP
rs1464506731 5487 dbSNP
rs547049823 5488 dbSNP
rs1247245510 5490 dbSNP
rs980083736 5494 dbSNP
rs959726440 5495 dbSNP
rs56090694 5500 dbSNP
rs1428407511 5504 dbSNP
rs1461100585 5516 dbSNP
rs1160930709 5522 dbSNP
rs756982531 5531 dbSNP
rs1385732821 5533 dbSNP
rs1439260985 5537 dbSNP
rs1433743420 5538 dbSNP
rs1002438670 5542 dbSNP
rs142461526 5543 dbSNP
rs1416469748 5545 dbSNP
rs1043933500 5548 dbSNP
rs757782062 5549 dbSNP
rs892549528 5558 dbSNP
rs987741112 5562 dbSNP
rs1052497524 5566 dbSNP
rs1034696862 5575 dbSNP
rs375189713 5584 dbSNP
rs377523428 5584 dbSNP
rs72419591 5584 dbSNP
rs944737182 5586 dbSNP
rs1453238188 5588 dbSNP
rs911889090 5597 dbSNP
rs137915977 5621 dbSNP
rs931884246 5623 dbSNP
rs1472803567 5641 dbSNP
rs34506951 5643 dbSNP
rs1183833185 5653 dbSNP
rs1409352110 5653 dbSNP
rs145470229 5659 dbSNP
rs973662835 5660 dbSNP
rs562968249 5664 dbSNP
rs1231064362 5669 dbSNP
rs1303088216 5672 dbSNP
rs1351427625 5682 dbSNP
rs1412095570 5688 dbSNP
rs79889041 5693 dbSNP
rs1350075026 5701 dbSNP
rs1312753211 5702 dbSNP
rs529679909 5708 dbSNP
rs568758280 5724 dbSNP
rs901848761 5727 dbSNP
rs141243303 5734 dbSNP
rs1034002502 5736 dbSNP
rs943498884 5738 dbSNP
rs116750825 5741 dbSNP
rs1418138055 5750 dbSNP
rs969649860 5755 dbSNP
rs576971632 5757 dbSNP
rs1022517488 5759 dbSNP
rs1043921816 5762 dbSNP
rs1471533171 5769 dbSNP
rs1163456036 5772 dbSNP
rs1371675338 5776 dbSNP
rs1011501292 5801 dbSNP
rs1306543293 5802 dbSNP
rs571424419 5805 dbSNP
rs143203815 5807 dbSNP
rs1336413689 5817 dbSNP
rs1407556208 5819 dbSNP
rs938980351 5825 dbSNP
rs1245377796 5827 dbSNP
rs1176141876 5831 dbSNP
rs764500148 5850 dbSNP
rs1230596484 5855 dbSNP
rs1272207216 5856 dbSNP
rs1480224236 5858 dbSNP
rs1200661144 5859 dbSNP
rs927689803 5860 dbSNP
rs543760485 5863 dbSNP
rs1390271452 5876 dbSNP
rs1008963217 5884 dbSNP
rs550540589 5888 dbSNP
rs969189828 5891 dbSNP
rs1017113301 5900 dbSNP
rs1466919985 5903 dbSNP
rs1304778168 5911 dbSNP
rs371900260 5911 dbSNP
rs1452219771 5912 dbSNP
rs554886929 5918 dbSNP
rs1367444492 5922 dbSNP
rs951204705 5928 dbSNP
rs1293416565 5940 dbSNP
rs1418529417 5941 dbSNP
rs931960754 5948 dbSNP
rs1405860369 5949 dbSNP
rs1025530249 5952 dbSNP
rs535509851 5957 dbSNP
rs1233753539 5959 dbSNP
rs1183713912 5961 dbSNP
rs1257570074 5965 dbSNP
rs1342370568 5967 dbSNP
rs1037588649 5973 dbSNP
rs940560068 5974 dbSNP
rs7591277 5975 dbSNP
rs1465910747 5978 dbSNP
rs1201482660 5984 dbSNP
rs1018974039 5994 dbSNP
rs1268313027 5999 dbSNP
rs1237847976 6000 dbSNP
rs553238157 6011 dbSNP
rs751584659 6012 dbSNP
rs1434283685 6017 dbSNP
rs1178625965 6020 dbSNP
rs1314803960 6022 dbSNP
rs1376295948 6028 dbSNP
rs1469421754 6036 dbSNP
rs1314243528 6039 dbSNP
rs1390907332 6040 dbSNP
rs1455752789 6042 dbSNP
rs938426261 6043 dbSNP
rs1008036634 6045 dbSNP
rs1303055798 6058 dbSNP
rs1228452578 6067 dbSNP
rs1343483879 6069 dbSNP
rs1222510914 6075 dbSNP
rs535069953 6076 dbSNP
rs889180861 6083 dbSNP
rs1044210095 6086 dbSNP
rs17047132 6089 dbSNP
rs552316898 6090 dbSNP
rs1450859586 6095 dbSNP
rs1391317738 6096 dbSNP
rs979769757 6098 dbSNP
rs1193428956 6107 dbSNP
rs1289870067 6107 dbSNP
rs1265699651 6116 dbSNP
rs192911435 6118 dbSNP
rs939635096 6121 dbSNP
rs1022589402 6127 dbSNP
rs534913033 6134 dbSNP
rs1455867624 6137 dbSNP
rs1343726312 6140 dbSNP
rs957115119 6142 dbSNP
rs1158410441 6148 dbSNP
rs980440142 6157 dbSNP
rs1458345731 6158 dbSNP
rs188497079 6165 dbSNP
rs565994549 6166 dbSNP
rs766439017 6175 dbSNP
rs890557647 6178 dbSNP
rs1181696474 6179 dbSNP
rs1305590681 6180 dbSNP
rs951193310 6183 dbSNP
rs918459330 6187 dbSNP
rs976651500 6195 dbSNP
rs1290278579 6200 dbSNP
rs965311029 6201 dbSNP
rs1262124921 6207 dbSNP
rs1204400690 6213 dbSNP
rs1206259083 6217 dbSNP
rs769365384 6218 dbSNP
rs1484680340 6219 dbSNP
rs1018625039 6226 dbSNP
rs1176912623 6239 dbSNP
rs1414613628 6242 dbSNP
rs1425688700 6249 dbSNP
rs1166794637 6250 dbSNP
rs1028994343 6251 dbSNP
rs879190651 6252 dbSNP
rs1423956345 6258 dbSNP
rs1007527461 6271 dbSNP
rs1221576370 6275 dbSNP
rs75177369 6276 dbSNP
rs1314903212 6279 dbSNP
rs764735817 6297 dbSNP
rs1229574340 6300 dbSNP
rs899162602 6304 dbSNP
rs1359282094 6306 dbSNP
rs1229797944 6316 dbSNP
rs1277211221 6325 dbSNP
rs1436494047 6329 dbSNP
rs1368025388 6335 dbSNP
rs1296737822 6337 dbSNP
rs1484378607 6341 dbSNP
rs1382075645 6358 dbSNP
rs528782248 6363 dbSNP
rs758975571 6365 dbSNP
rs1295513836 6371 dbSNP
rs1425321095 6376 dbSNP
rs1443858376 6382 dbSNP
rs776199954 6382 dbSNP
rs570795611 6384 dbSNP
rs549093801 6400 dbSNP
rs1448666893 6401 dbSNP
rs1431543152 6404 dbSNP
rs938458650 6418 dbSNP
rs1192129058 6420 dbSNP
rs1426522064 6421 dbSNP
rs1449799311 6422 dbSNP
rs1268971656 6426 dbSNP
rs1199724541 6428 dbSNP
rs1045733656 6436 dbSNP
rs1288922495 6441 dbSNP
rs1381494614 6444 dbSNP
rs947709445 6464 dbSNP
rs1300512723 6467 dbSNP
rs770830366 6475 dbSNP
rs1214311675 6481 dbSNP
rs1048165403 6483 dbSNP
rs1314106940 6484 dbSNP
rs1202014156 6485 dbSNP
rs979841924 6487 dbSNP
rs1189111687 6490 dbSNP
rs947073894 6492 dbSNP
rs976556790 6495 dbSNP
rs757240905 6500 dbSNP
rs1425620291 6508 dbSNP
rs758542560 6522 dbSNP
rs559258132 6525 dbSNP
rs985783653 6542 dbSNP
rs990165749 6544 dbSNP
rs1303921040 6546 dbSNP
rs1322011276 6555 dbSNP
rs1325151141 6558 dbSNP
rs201300348 6561 dbSNP
rs1031646272 6565 dbSNP
rs1221896885 6570 dbSNP
rs1262806844 6573 dbSNP
rs532213511 6576 dbSNP