miRTarBase - #MIRT000825 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CARD8   
Synonyms CARDINAL, DACAR, DAKAR, NDPP, NDPP1, TUCAN
Description caspase recruitment domain family member 8
Transcript NM_001184902   
Other Transcripts NM_001184901 , NM_001184900 , NM_001184903 , NM_001184904 , NM_014959   
Expression
Putative miRNA Targets on CARD8
3'UTR of CARD8
(miRNA target sites are highlighted)
>CARD8|NM_001184902|3'UTR
   1 CTGCATCAGCCCCTCCTCCTTTCTCAGGTGCAGCCTTTGTGAAGGAGAACCACCGGCAACTCCAAGCCAGGATGGGGGAC
  81 CTGAAAGGGGTGCTCGATGATCTCCAAGACAATGAGGTTCTTACTGAGAATGAGAAGGAGCTGGTGGAGCAGGAAAAGAC
 161 ACGGCAGAGCAAGAATGAGGCCTTGCTGAGCATGGTGGAGAAGAAAGGGGACCTGGCCCTGGACGTGCTCTTCAGAAGCA
 241 TTAGTGAAAGGGACCCTTACCTCGTGTCCTATCTTAGACAGCAGAATTTGTAAAATGAGTCAGTTAGGTAGTCTGGAAGA
 321 GAGAATCCAGCGTTCTCATTGGAAATGGATAAACAGAAATGTGATCATTGATTTCAGTGTTCAAGACAGAAGAAGACTGG
 401 GTAACATCTATCACACAGGCTTTCAGGACAGACTTGTAACCTGGCATGTACCTATTGACTGTATCCTCATGCATTTTCCT
 481 CAAGAATGTCTGAAGAAGGTAGTAATATTCCTTTTAAATTTTTTCCAACCATTGCTTGATATATCACTATTTTATCCATT
 561 GACATGATTCTTGAAGACCCAGGATAAAGGACATCCGGATAGGTGTGTTTATGAAGGATGGGGCCTGGAAAGGCAACTTT
 641 TCCTGATTAATGTGAAAAATAATTCCTATGGACACTCCGTTTGAAGTATCACCTTCTCATAACTAAAAGCAGAAAAGCTA
 721 ACAAAAGCTTCTCAGCTGAGGACACTCAAGGCATACATGATGACAGTCTTTTTTTTTTTTGTATGTTAGGACTTTAACAC
 801 TTTATCTATGGCTACTGTTATTAGAACAATGTAAATGTATTTGCTGAAAGAGAGCACAAAAATGGGAGAAAATGCAAACA
 881 TGAGCAGAAAATATTTTCCCACTGGTGTGTAGCCTGCTACAAGGAGTTGTTGGGTTAAATGTTCATGGTCAACTCCAAGG
 961 AATACTGAGATGAAATGTGGTAAATCAACTCCACAGAACCACCAAAAAGAAAATGAGGGTAATTCAGCTTATTCTGAGAC
1041 AGACATTCCTGGCAATGTACCATACAAAAAATAAGCCAACTCTGACATTTGGATTCTACCATAGACTCTGTCATTTTGTA
1121 GCCATTTCAGCTGTCTTTTGATTAATGTTTTCGTGGCACACATATTTCCATCCTTTTATGTTTAATCTGTTTAAAACAAG
1201 TTCCTAGTAGACACCATCTGGTTGAGTCAGTTTTTTTTATGGTGTATTTTGAACCCATTCTGATAGTCTCTTTTAACTGG
1281 AAGATTTCAATTACTTACGTTAATGTAATTATTAATATGTTAGGATTTATCCTCAGTCAGCCAGTTTGTTATGTCTTTTC
1361 TATTCTACTGTTATCACATTTGTACCACTTAAAGTGGAATCTAGGCACTTTATCACCATTTAGATCCTATTACCTTTTCT
1441 CATCTAGGATATAGTTATCTTCTACATAATCTTTCTGTATCTTAAAACCCATCAATAAATTATTATATATTTTCTACTTT
1521 TAATCACTCAGAAGATTTAAAAAACTCATGAGAAGAGTAATCTGTTATGTTTTTCCAGATATTTACCATTTCTGTTGCTC
1601 TTCCTTCATTATTTTCCAAATTTCGTTCTGCAAATTTCCACTTCCTCTGATAGACGTTTTTTAGTTCTTTTAGAGTGGTT
1681 CTGATAGGTACAGATTCTCTTATTTTTTGCTTCCTCTGAGGACATCTTTTTCTCACCTTCATTCTCAGTGATGTTTTTTG
1761 CTTGTAGTATTTTTAGTTGACATTGTTTTCTGTTCAGCAGTTTCCTTTTAGCTTCCGTATTTCCTGATGAGAAATCTGCA
1841 GTCATTCAAATTGTTGTTTCCCTGTATGTAGTGTGTCATTTTTCTGTCAGATTTCAAGGTATTTATCTTTAGTTTTTAGC
1921 CATTTCATTATGTTGGGGATGAGTTTCCTTGTTTTATTCCCTTTGGAATTTGCTCCAATTCATAAATTTGCAGTTTTATG
2001 TCTTTTACCAAACTTAGAGGTTTTCAGCCTAATTTCTAAAAATACTTTTTATTAGCCTGATTTTCATCTTTATAGGAAAT
2081 AGTTTAAGTGATGACAAGTTCCAATAGCTTATATGCCCAGAAGGCCTTCAAAATAAGAATTTTGAAAGAATACAGAAAAC
2161 AAACTTTTATATCCTTCTCATGTCTTCTACTGTAAAATTCATATGCTTTGCTACTCTAAACCTAGTTTGAAATCAACAGT
2241 CTTGAGAATAGATGAAAATTTTGATGAATAGTGGAATTCTTTTAAATGGAAACCTCTTACATGTGATTTTCCTTGCCATC
2321 TAGAAATAAACCATAGTATTTATGTTGAATCAATCAATATTATATTTTGTTTTTTTCCTCCTCTTCTGAGACTCTTATTG
2401 TGGAAATGTTAGACTTTTATGTTTTCCTAAATGTCCCTGATATTCTACTTATTTAGAACATCTTTTCATTTTTTCCATTA
2481 TTCTGATTGGGTAATTTTAATTTGTCTATTTTCAAATTTGCTGGAGTGTTCACCTGTTGTTATCTGTGTCGTCCCACTGA
2561 GTGCATTCACCACCTTTTAAATTTTGGTCACTGTATGTATCAGTTCTAAAATTTCCATTTTGTTCTCTATATTTTAAATT
2641 TCTTGCCTTATATTCTATTTTCCTGCAAATGTGTCAGCATTTGCTTGTTTGAGCTTTTTTTTTTTCAAGACAGGGTCTCA
2721 ACTCTGTTACCCAGGCTGGAGTGCAGTGGTGCGATCTCAGCTCACTGCAACCTCTGCCTCCTGGTTCAAGCGATTATTGT
2801 GCCTCAGCCTCCAGAGTAGCTGGGATTACAGGCATGCACCACCACAGCCCAGCTAATTTTTTGTATTTTTAGTAGAGACA
2881 GAGTTTTGCTATGTTGGCCAGGCTGGTTTTGAACTCCTGGCCTCAAGTGATCCACCCACCTCAGCCTCCCAAAGTGCTGG
2961 GATTACAGGCCACTACACCTGGCACATTTGAGTATTTTTTTTTTTTTTTTTTTTTTTTTGAGATGGAGTCTCGCTCTGTC
3041 ATCTAGGCTGGAGTGCAGTGGTGTGATCTCAGCTCACTGCAGCCTCTGTCTCCCGGGCTCAAGCGATTCTCTTGCCTCAG
3121 CCTCCTGAGTAGCTAGGACTACAGGTGCATGCCAACACGCCCGGCTAATTTTTTTTTAAAAATATTTTTAGTAGAGACAG
3201 GGTTTCACCATTTTGGCCAGGATGGTCTTGATCTCCTGACCTCATGATCCACCCGCCTCGGCCTTCCAAAGTGCTGGGAT
3281 TACAGGCATGAGCCACCGTGCCTGGCCTCATTTGAGTATTTTTATAATGTCTCTTTTAAAGTCTTTGTCAGATAATTTCA
3361 CTGTACATGTTATTCAGTGTTTGGTGTCCACTGAGTTGTCATTTGCCAGACAAGTGGAGATTTTTGCAGCTCATCCTTGT
3441 ATTCTCAGTAGTTCCGATATGTACCCTCGAAATGTGAATGTTATCTTATGAGACTCTGTTTTATTTGTATCCAACAGAAG
3521 ATGTTTATTATTTATTTGGCTTTCTGTGAACTGAGGTCTTAATATCAGCTCATTTTAAAAGTCTTTGCAGTGGTATTCGG
3601 ATCTATCCTGTGTGTGCCTATGAGATTGGGTGCAGTGTATCCTGTTAGCTCCATTCTCAGGGCGTTTGAATGTGAATTAG
3681 GACCAGCGCAATGAATGCTCAAGTTGGGGTTGGGCGTTAGAATTCATAAAAGTCTTTATATGCTCAGATTCTGCAGCTCC
3761 ATCCTCTTCATGATTGTGATCGTAAGGACAGTGGAATTTTGCAGTTGTCTATACCTTATCTTGAAGTAGAACTAAATTGT
3841 TACATTTGAAGAATGTACTTCATAAATTTACAAAAATAAAAAAATAGGTTAATGTTATTAAAACAAAAAGGCACACAAAA
3921 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               |||||| | ||:|||| 
Target 5' tatttACCATT-TCTGTTGCTc 3'
1580 - 1600 148.00 -13.90
2
miRNA  3' gugUUUGGUAAUAC---ACGACGAu 5'
             |||::  ||||   |||| || 
Target 5' gtaAAATTCATATGCTTTGCTACTc 3'
2192 - 2216 127.00 -7.90
3
miRNA  3' guguUUGGUAA---UACACGACGAu 5'
              |::||||   || ||:||:| 
Target 5' ctgcAGTCATTCAAAT-TGTTGTTt 3'
1836 - 1859 125.00 -7.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1169236 3428 ClinVar
782653 3459 ClinVar
1168810 3471 ClinVar
1168809 3588 ClinVar
1116126 3592 ClinVar
COSM6259854 4 COSMIC
COSM8471650 11 COSMIC
COSM7978497 23 COSMIC
COSN8974338 436 COSMIC
COSN8261349 1427 COSMIC
COSN29265727 1518 COSMIC
COSN4778459 2251 COSMIC
COSN17687967 2291 COSMIC
COSN4778458 2402 COSMIC
COSN16919589 2568 COSMIC
COSN29421497 2796 COSMIC
COSN30405102 3057 COSMIC
COSN6145842 3089 COSMIC
COSN19661069 3355 COSMIC
COSM1612510 3392 COSMIC
COSM5471074 3419 COSMIC
COSM9916649 3424 COSMIC
COSM7305874 3431 COSMIC
COSM6558071 3447 COSMIC
COSM7113774 3471 COSMIC
COSM6274779 3474 COSMIC
COSM4581261 3505 COSMIC
COSM3362937 3510 COSMIC
COSM4669253 3511 COSMIC
COSM8277395 3511 COSMIC
COSM3107029 3527 COSMIC
COSM1729866 3539 COSMIC
COSM1481287 3570 COSMIC
COSM3823528 3578 COSMIC
COSM3536451 3582 COSMIC
COSM8110010 3583 COSMIC
COSM243481 3586 COSMIC
COSM6333662 3588 COSMIC
COSM998895 3589 COSMIC
COSM7422763 3599 COSMIC
COSM7201012 3621 COSMIC
COSM7201010 3636 COSMIC
COSM7129945 3637 COSMIC
COSM7201056 3639 COSMIC
COSM1712545 3644 COSMIC
COSM7595835 3648 COSMIC
COSN5268614 3681 COSMIC
COSN31598074 3695 COSMIC
COSN13817081 3696 COSMIC
COSN31527178 3701 COSMIC
COSN31506729 3702 COSMIC
COSN28759968 3772 COSMIC
COSN28758687 3788 COSMIC
COSN27271072 4132 COSMIC
COSN1217142 4133 COSMIC
COSN20115965 4542 COSMIC
COSN17182655 4848 COSMIC
COSN32160143 5082 COSMIC
COSN25764111 5476 COSMIC
COSN30228944 5954 COSMIC
COSN15726270 6970 COSMIC
COSN21766686 7020 COSMIC
COSN27918202 7022 COSMIC
COSN19422351 7137 COSMIC
COSN17038304 7156 COSMIC
COSN9851385 7175 COSMIC
COSN20115962 7241 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs149691235 3 dbSNP
rs1283699038 4 dbSNP
rs1420372169 13 dbSNP
rs772140439 21 dbSNP
rs900517274 21 dbSNP
rs1443022472 23 dbSNP
rs1454908680 25 dbSNP
rs1242687597 26 dbSNP
rs1017630574 36 dbSNP
rs938549122 39 dbSNP
rs1184431291 42 dbSNP
rs770580052 45 dbSNP
rs1224594234 55 dbSNP
rs763543086 58 dbSNP
rs748419287 59 dbSNP
rs1309455018 64 dbSNP
rs369746337 70 dbSNP
rs770028248 74 dbSNP
rs748599306 75 dbSNP
rs372368339 83 dbSNP
rs1364469494 90 dbSNP
rs1184013874 102 dbSNP
rs1006614233 108 dbSNP
rs112927753 117 dbSNP
rs980080894 125 dbSNP
rs1205295737 126 dbSNP
rs1048268128 133 dbSNP
rs1480199001 136 dbSNP
rs941650537 143 dbSNP
rs908883415 144 dbSNP
rs1250037151 163 dbSNP
rs983577551 166 dbSNP
rs1175154766 169 dbSNP
rs1490772019 176 dbSNP
rs533487413 178 dbSNP
rs1471268009 205 dbSNP
rs768064976 208 dbSNP
rs149478741 223 dbSNP
rs1030108582 225 dbSNP
rs1443428267 228 dbSNP
rs543536044 237 dbSNP
rs1300048351 238 dbSNP
rs574688758 240 dbSNP
rs979145525 241 dbSNP
rs774707561 244 dbSNP
rs1236191592 255 dbSNP
rs1315997198 259 dbSNP
rs1284047841 265 dbSNP
rs371775497 271 dbSNP
rs965575531 272 dbSNP
rs139932428 279 dbSNP
rs956209837 285 dbSNP
rs1347773936 286 dbSNP
rs1007151331 291 dbSNP
rs1030475158 292 dbSNP
rs1489756128 296 dbSNP
rs904494806 297 dbSNP
rs535282870 298 dbSNP
rs186831884 324 dbSNP
rs552906050 325 dbSNP
rs1166626136 326 dbSNP
rs891870240 330 dbSNP
rs1018269617 331 dbSNP
rs749637269 332 dbSNP
rs938513275 334 dbSNP
rs905696749 357 dbSNP
rs778310882 358 dbSNP
rs1266514099 360 dbSNP
rs1347425644 362 dbSNP
rs1428725263 365 dbSNP
rs1044669289 367 dbSNP
rs1268284878 375 dbSNP
rs11668930 376 dbSNP
rs941968453 378 dbSNP
rs1198348836 389 dbSNP
rs1214932396 395 dbSNP
rs1276564089 397 dbSNP
rs1447535649 401 dbSNP
rs113210620 405 dbSNP
rs1056256111 411 dbSNP
rs1292093999 412 dbSNP
rs570497883 417 dbSNP
rs748392077 420 dbSNP
rs550676865 425 dbSNP
rs905148599 435 dbSNP
rs923006804 440 dbSNP
rs975833443 443 dbSNP
rs965504165 445 dbSNP
rs530673013 446 dbSNP
rs1383717512 450 dbSNP
rs774935946 453 dbSNP
rs1263448020 454 dbSNP
rs946405114 473 dbSNP
rs1399007712 479 dbSNP
rs568255394 485 dbSNP
rs1325749545 487 dbSNP
rs1431458852 492 dbSNP
rs1299763593 504 dbSNP
rs1380258454 511 dbSNP
rs182152589 516 dbSNP
rs1244983168 522 dbSNP
rs1315244237 525 dbSNP
rs1358101362 526 dbSNP
rs986092296 539 dbSNP
rs1320906880 540 dbSNP
rs913533908 547 dbSNP
rs1211079889 548 dbSNP
rs968980548 556 dbSNP
rs1184655540 557 dbSNP
rs1232941155 557 dbSNP
rs1387304595 559 dbSNP
rs1327574109 560 dbSNP
rs1468831354 562 dbSNP
rs1242165863 563 dbSNP
rs1158048396 564 dbSNP
rs1385704223 565 dbSNP
rs1320820884 566 dbSNP
rs1380658617 567 dbSNP
rs1384337526 569 dbSNP
rs1337391456 570 dbSNP
rs1471086312 572 dbSNP
rs1427400312 574 dbSNP
rs1330672560 576 dbSNP
rs74678094 576 dbSNP
rs1175480529 580 dbSNP
rs1475600337 581 dbSNP
rs1374782632 582 dbSNP
rs1022326466 583 dbSNP
rs866931704 584 dbSNP
rs1243233562 585 dbSNP
rs1204968455 586 dbSNP
rs1459730010 587 dbSNP
rs1262092226 588 dbSNP
rs1200288163 590 dbSNP
rs1340477013 591 dbSNP
rs1272492330 592 dbSNP
rs1225878621 593 dbSNP
rs1365029369 594 dbSNP
rs1315847213 596 dbSNP
rs7508437 597 dbSNP
rs1181316134 598 dbSNP
rs1204672148 598 dbSNP
rs1251500302 598 dbSNP
rs1258756061 598 dbSNP
rs1261798120 598 dbSNP
rs1280851989 598 dbSNP
rs1289491941 598 dbSNP
rs1301353257 598 dbSNP
rs1327696954 598 dbSNP
rs1336039482 598 dbSNP
rs1337335099 598 dbSNP
rs1364608266 598 dbSNP
rs1389465126 598 dbSNP
rs1404037089 598 dbSNP
rs1411118725 598 dbSNP
rs1427108320 598 dbSNP
rs1461315137 598 dbSNP
rs1469265583 598 dbSNP
rs1471167951 598 dbSNP
rs1489654592 598 dbSNP
rs531199248 598 dbSNP
rs1484199307 599 dbSNP
rs1491405976 599 dbSNP
rs1197326346 600 dbSNP
rs1491239237 600 dbSNP
rs933757510 600 dbSNP
rs1176618570 601 dbSNP
rs1336308677 603 dbSNP
rs1379310403 606 dbSNP
rs922325504 615 dbSNP
rs976285374 623 dbSNP
rs1167177133 626 dbSNP
rs956081631 630 dbSNP
rs1035695953 634 dbSNP
rs546160755 642 dbSNP
rs35174448 643 dbSNP
rs1002919019 649 dbSNP
rs1300924362 651 dbSNP
rs965233027 653 dbSNP
rs1165880178 654 dbSNP
rs905661487 655 dbSNP
rs1303982594 656 dbSNP
rs1325265572 668 dbSNP
rs1227148830 670 dbSNP
rs1252298563 671 dbSNP
rs781261954 672 dbSNP
rs1385747137 674 dbSNP
rs1220482660 676 dbSNP
rs1044255082 677 dbSNP
rs755013552 682 dbSNP
rs1006490212 688 dbSNP
rs1184947058 693 dbSNP
rs887686799 696 dbSNP
rs1193047836 697 dbSNP
rs35174558 699 dbSNP
rs1269366561 714 dbSNP
rs1426701298 715 dbSNP
rs1192170218 719 dbSNP
rs1390501323 720 dbSNP
rs146120788 721 dbSNP
rs559401001 730 dbSNP
rs1242207044 732 dbSNP
rs546110490 735 dbSNP
rs922941245 738 dbSNP
rs751723739 741 dbSNP
rs1424730850 743 dbSNP
rs1294846469 749 dbSNP
rs1383401893 749 dbSNP
rs1026707287 754 dbSNP
rs532378402 766 dbSNP
rs993449146 767 dbSNP
rs563074747 770 dbSNP
rs1244253581 771 dbSNP
rs375761576 777 dbSNP
rs563387841 778 dbSNP
rs766206973 779 dbSNP
rs1485596054 782 dbSNP
rs1293097072 783 dbSNP
rs1204436413 786 dbSNP
rs1248577770 787 dbSNP
rs1451037825 795 dbSNP
rs1181591671 796 dbSNP
rs142915871 806 dbSNP
rs1424071742 811 dbSNP
rs985636038 812 dbSNP
rs1361509838 815 dbSNP
rs577490583 816 dbSNP
rs372519031 820 dbSNP
rs1391544644 827 dbSNP
rs574601255 828 dbSNP
rs969328260 833 dbSNP
rs1443221840 834 dbSNP
rs138482176 835 dbSNP
rs989023138 838 dbSNP
rs541287087 842 dbSNP
rs1428838346 844 dbSNP
rs572666330 851 dbSNP
rs1239880976 853 dbSNP
rs1268680663 856 dbSNP
rs1466254445 867 dbSNP
rs933641635 873 dbSNP
rs1483468549 878 dbSNP
rs922379375 879 dbSNP
rs1039437209 881 dbSNP
rs1422281222 881 dbSNP
rs750180370 885 dbSNP
rs970148518 886 dbSNP
rs1384075490 891 dbSNP
rs558973403 896 dbSNP
rs1006044651 897 dbSNP
rs910688218 907 dbSNP
rs985074382 914 dbSNP
rs1360068326 915 dbSNP
rs1450636278 917 dbSNP
rs887645468 918 dbSNP
rs1296611255 919 dbSNP
rs539349169 923 dbSNP
rs1372950600 933 dbSNP
rs1410516434 937 dbSNP
rs1290340767 943 dbSNP
rs1047645159 944 dbSNP
rs1230777077 946 dbSNP
rs187094116 947 dbSNP
rs1312495389 948 dbSNP
rs972080622 956 dbSNP
rs1230815751 964 dbSNP
rs376432179 977 dbSNP
rs557038595 984 dbSNP
rs1199238498 987 dbSNP
rs1002673945 990 dbSNP
rs943060682 993 dbSNP
rs1168864622 994 dbSNP
rs12610708 995 dbSNP
rs1357851586 996 dbSNP
rs1289273326 997 dbSNP
rs1224372254 999 dbSNP
rs1430699718 999 dbSNP
rs1022575346 1007 dbSNP
rs1353164665 1010 dbSNP
rs1043906891 1013 dbSNP
rs1404418286 1014 dbSNP
rs577481501 1017 dbSNP
rs1368299200 1018 dbSNP
rs1345904838 1019 dbSNP
rs1010719189 1021 dbSNP
rs1306724910 1024 dbSNP
rs1205373282 1026 dbSNP
rs1276337840 1028 dbSNP
rs892417097 1033 dbSNP
rs1052343594 1038 dbSNP
rs997858602 1042 dbSNP
rs900798742 1043 dbSNP
rs1185122525 1047 dbSNP
rs761397321 1048 dbSNP
rs947542505 1049 dbSNP
rs780117159 1050 dbSNP
rs1419194857 1052 dbSNP
rs568180364 1053 dbSNP
rs753437816 1055 dbSNP
rs1170646716 1057 dbSNP
rs988991983 1060 dbSNP
rs1349177208 1061 dbSNP
rs942416221 1063 dbSNP
rs1401906989 1068 dbSNP
rs548329034 1071 dbSNP
rs1438457775 1073 dbSNP
rs1405400884 1074 dbSNP
rs1157616905 1082 dbSNP
rs1228880846 1085 dbSNP
rs1299347193 1088 dbSNP
rs1480522442 1090 dbSNP
rs763865199 1095 dbSNP
rs1208699412 1101 dbSNP
rs928913529 1104 dbSNP
rs375724931 1106 dbSNP
rs73578133 1108 dbSNP
rs1452857052 1115 dbSNP
rs1214223658 1122 dbSNP
rs930827281 1125 dbSNP
rs760080818 1127 dbSNP
rs775103905 1132 dbSNP
rs1383584927 1140 dbSNP
rs191817472 1141 dbSNP
rs972257130 1142 dbSNP
rs1023045957 1150 dbSNP
rs985289491 1153 dbSNP
rs1415997695 1154 dbSNP
rs763575381 1161 dbSNP
rs1448802480 1168 dbSNP
rs1316060357 1169 dbSNP
rs866429517 1170 dbSNP
rs1387888473 1173 dbSNP
rs939359647 1175 dbSNP
rs1380098734 1192 dbSNP
rs552183612 1206 dbSNP
rs980781925 1233 dbSNP
rs1221591569 1234 dbSNP
rs1268044390 1244 dbSNP
rs576415798 1257 dbSNP
rs1210945160 1261 dbSNP
rs1324462777 1263 dbSNP
rs1241632525 1266 dbSNP
rs969899203 1269 dbSNP
rs1022373657 1270 dbSNP
rs1026170832 1272 dbSNP
rs1239443192 1274 dbSNP
rs1468652544 1281 dbSNP
rs993355340 1288 dbSNP
rs1966625 1292 dbSNP
rs956492227 1300 dbSNP
rs770283617 1302 dbSNP
rs1030924662 1305 dbSNP
rs556651120 1306 dbSNP
rs1366871118 1313 dbSNP
rs145863265 1331 dbSNP
rs1334340573 1332 dbSNP
rs1341956763 1334 dbSNP
rs549766595 1338 dbSNP
rs768953046 1346 dbSNP
rs1287212519 1351 dbSNP
rs1342931941 1358 dbSNP
rs1329263886 1381 dbSNP
rs368737434 1383 dbSNP
rs1261816332 1386 dbSNP
rs1344678564 1394 dbSNP
rs1280988900 1401 dbSNP
rs748586357 1401 dbSNP
rs893280382 1403 dbSNP
rs900852926 1407 dbSNP
rs1053196627 1415 dbSNP
rs1179088749 1421 dbSNP
rs1473633821 1423 dbSNP
rs1184170326 1429 dbSNP
rs561242783 1431 dbSNP
rs1465349215 1432 dbSNP
rs1017982780 1437 dbSNP
rs1403873335 1455 dbSNP
rs541549605 1457 dbSNP
rs1006540085 1459 dbSNP
rs888235141 1460 dbSNP
rs1048137725 1461 dbSNP
rs1187612943 1467 dbSNP
rs1454008464 1473 dbSNP
rs1476635108 1476 dbSNP
rs930816859 1477 dbSNP
rs141432622 1478 dbSNP
rs565924882 1485 dbSNP
rs1234386483 1494 dbSNP
rs928883839 1495 dbSNP
rs1337884007 1497 dbSNP
rs1204658124 1501 dbSNP
rs1275626480 1504 dbSNP
rs148292965 1504 dbSNP
rs982139428 1514 dbSNP
rs186541202 1525 dbSNP
rs948709403 1536 dbSNP
rs915911715 1537 dbSNP
rs1265180584 1540 dbSNP
rs984870397 1541 dbSNP
rs1199517234 1545 dbSNP
rs981217205 1547 dbSNP
rs1447438778 1554 dbSNP
rs1167504281 1566 dbSNP
rs1370844967 1573 dbSNP
rs1431097067 1577 dbSNP
rs948071512 1578 dbSNP
rs143313197 1580 dbSNP
rs149161827 1581 dbSNP
rs956542730 1582 dbSNP
rs1359721121 1585 dbSNP
rs182424277 1590 dbSNP
rs965909335 1605 dbSNP
rs376242349 1610 dbSNP
rs1018825515 1611 dbSNP
rs1384611434 1614 dbSNP
rs1243835568 1615 dbSNP
rs976569710 1623 dbSNP
rs1488865698 1629 dbSNP
rs965312824 1632 dbSNP
rs1007899141 1634 dbSNP
rs747032407 1636 dbSNP
rs1463362987 1637 dbSNP
rs1187767821 1641 dbSNP
rs1334275303 1642 dbSNP
rs1450999058 1650 dbSNP
rs1464919192 1651 dbSNP
rs1162288899 1660 dbSNP
rs35201945 1666 dbSNP
rs574517631 1671 dbSNP
rs536350506 1683 dbSNP
rs1412152079 1692 dbSNP
rs1434823111 1701 dbSNP
rs1321694466 1709 dbSNP
rs1010593109 1713 dbSNP
rs1367820156 1716 dbSNP
rs1450667315 1730 dbSNP
rs892201425 1735 dbSNP
rs1052168596 1736 dbSNP
rs190754684 1741 dbSNP
rs998976034 1742 dbSNP
rs185162407 1745 dbSNP
rs1267140102 1750 dbSNP
rs1327045420 1755 dbSNP
rs1207853634 1759 dbSNP
rs1248361851 1767 dbSNP
rs552358587 1772 dbSNP
rs6509363 1773 dbSNP
rs1245259758 1774 dbSNP
rs1423880207 1777 dbSNP
rs1180330696 1790 dbSNP
rs569635865 1805 dbSNP
rs11667675 1814 dbSNP
rs930667162 1836 dbSNP
rs530022425 1837 dbSNP
rs972147401 1841 dbSNP
rs1391203590 1846 dbSNP
rs1464867127 1854 dbSNP
rs965837150 1862 dbSNP
rs1302470609 1865 dbSNP
rs757042375 1868 dbSNP
rs1397827628 1869 dbSNP
rs906825205 1874 dbSNP
rs1349977511 1875 dbSNP
rs1227670322 1886 dbSNP
rs180763860 1890 dbSNP
rs1330876777 1892 dbSNP
rs34585211 1906 dbSNP
rs948052061 1906 dbSNP
rs753716197 1907 dbSNP
rs368891921 1912 dbSNP
rs935432610 1913 dbSNP
rs547574539 1917 dbSNP
rs141307935 1923 dbSNP
rs1010520247 1924 dbSNP
rs571687150 1925 dbSNP
rs778980478 1927 dbSNP
rs188683720 1929 dbSNP
rs545623927 1930 dbSNP
rs754430003 1930 dbSNP
rs567318381 1931 dbSNP
rs985357785 1931 dbSNP
rs1168493403 1932 dbSNP
rs1369956498 1935 dbSNP
rs1425453419 1936 dbSNP
rs532017576 1937 dbSNP
rs147855138 1938 dbSNP
rs907346037 1941 dbSNP
rs149741889 1942 dbSNP
rs752098805 1949 dbSNP
rs1300394834 1952 dbSNP
rs1312581885 1953 dbSNP
rs961148085 1954 dbSNP
rs1272055987 1959 dbSNP
rs1178780378 1960 dbSNP
rs1205333302 1964 dbSNP
rs1254552850 1967 dbSNP
rs1481944776 1972 dbSNP
rs1477353895 1975 dbSNP
rs1251078197 1976 dbSNP
rs1426266555 1979 dbSNP
rs1035391856 1993 dbSNP
rs1344605732 1994 dbSNP
rs894712096 1994 dbSNP
rs906662955 1994 dbSNP
rs1049361838 2010 dbSNP
rs1356187295 2017 dbSNP
rs1012470609 2028 dbSNP
rs930593597 2033 dbSNP
rs894037904 2035 dbSNP
rs184852382 2047 dbSNP
rs1236289069 2049 dbSNP
rs1242704762 2051 dbSNP
rs1294935464 2054 dbSNP
rs1317182780 2059 dbSNP
rs767145585 2061 dbSNP
rs1276091738 2062 dbSNP
rs1449406902 2063 dbSNP
rs10406657 2065 dbSNP
rs1489664095 2077 dbSNP
rs1187140653 2082 dbSNP
rs1389752467 2089 dbSNP
rs924056847 2093 dbSNP
rs1170744023 2101 dbSNP
rs1041119286 2108 dbSNP
rs1349012429 2120 dbSNP
rs1404851591 2124 dbSNP
rs1307738567 2125 dbSNP
rs1236659161 2135 dbSNP
rs944788863 2137 dbSNP
rs912001475 2144 dbSNP
rs1442783849 2156 dbSNP
rs773847577 2159 dbSNP
rs1318349934 2160 dbSNP
rs770485713 2160 dbSNP
rs181910817 2166 dbSNP
rs915139567 2168 dbSNP
rs1457452706 2170 dbSNP
rs1227300470 2172 dbSNP
rs78199715 2173 dbSNP
rs1337641853 2181 dbSNP
rs1207196877 2188 dbSNP
rs1161551460 2196 dbSNP
rs533594894 2197 dbSNP
rs1471697840 2207 dbSNP
rs3786739 2218 dbSNP
rs960992559 2225 dbSNP
rs1236001336 2228 dbSNP
rs867754909 2229 dbSNP
rs1002554051 2230 dbSNP
rs981766813 2236 dbSNP
rs1208772568 2241 dbSNP
rs1485900391 2246 dbSNP
rs1262192565 2249 dbSNP
rs970871625 2257 dbSNP
rs1462904088 2274 dbSNP
rs543313381 2279 dbSNP
rs1387549139 2280 dbSNP
rs201165936 2286 dbSNP
rs1319868255 2295 dbSNP
rs894098157 2304 dbSNP
rs1446611814 2306 dbSNP
rs1224472916 2307 dbSNP
rs775119847 2316 dbSNP
rs1013501171 2318 dbSNP
rs190259336 2321 dbSNP
rs1330221015 2322 dbSNP
rs139478962 2326 dbSNP
rs995103422 2327 dbSNP
rs1442105439 2334 dbSNP
rs185019002 2346 dbSNP
rs1188533711 2355 dbSNP
rs779940610 2356 dbSNP
rs1386356464 2357 dbSNP
rs1239242064 2361 dbSNP
rs772144183 2365 dbSNP
rs746015412 2367 dbSNP
rs1290653159 2373 dbSNP
rs536180906 2374 dbSNP
rs1472793758 2376 dbSNP
rs376558567 2377 dbSNP
rs931130159 2378 dbSNP
rs1050571622 2386 dbSNP
rs931767538 2391 dbSNP
rs1481281250 2395 dbSNP
rs1334439994 2398 dbSNP
rs567548039 2402 dbSNP
rs1375913539 2408 dbSNP
rs796205828 2409 dbSNP
rs192575989 2411 dbSNP
rs1241590690 2415 dbSNP
rs527740522 2415 dbSNP
rs1344790940 2416 dbSNP
rs1201180891 2425 dbSNP
rs150930815 2428 dbSNP
rs551935706 2430 dbSNP
rs3786738 2437 dbSNP
rs981735915 2441 dbSNP
rs1438374917 2443 dbSNP
rs774707819 2448 dbSNP
rs1375685070 2472 dbSNP
rs1477578740 2474 dbSNP
rs189368405 2475 dbSNP
rs201526013 2501 dbSNP
rs1032599940 2502 dbSNP
rs1204775769 2503 dbSNP
rs999758283 2504 dbSNP
rs543341359 2508 dbSNP
rs1370655778 2511 dbSNP
rs1393605451 2531 dbSNP
rs990594656 2538 dbSNP
rs1330825223 2539 dbSNP
rs1019656434 2541 dbSNP
rs1305897143 2546 dbSNP
rs1008640335 2548 dbSNP
rs753535806 2552 dbSNP
rs1027845301 2559 dbSNP
rs1481679362 2563 dbSNP
rs183903285 2569 dbSNP
rs777644793 2570 dbSNP
rs1194068113 2584 dbSNP
rs1450812057 2584 dbSNP
rs898064577 2585 dbSNP
rs1254461512 2588 dbSNP
rs898309778 2598 dbSNP
rs1167607647 2607 dbSNP
rs1373085984 2619 dbSNP
rs1036921990 2629 dbSNP
rs1432945598 2643 dbSNP
rs191379576 2649 dbSNP
rs1337618006 2652 dbSNP
rs1390731325 2661 dbSNP
rs1470871331 2663 dbSNP
rs762913108 2667 dbSNP
rs1171720391 2669 dbSNP
rs1462452395 2680 dbSNP
rs890463370 2690 dbSNP
rs948383243 2696 dbSNP
rs188154396 2700 dbSNP
rs990267284 2701 dbSNP
rs1242779776 2713 dbSNP
rs1448336134 2728 dbSNP
rs932097577 2732 dbSNP
rs1355611736 2736 dbSNP
rs893916876 2737 dbSNP
rs958252149 2745 dbSNP
rs1243447934 2753 dbSNP
rs1032485482 2769 dbSNP
rs966988983 2772 dbSNP
rs1429770332 2773 dbSNP
rs1053537456 2774 dbSNP
rs935200372 2776 dbSNP
rs1462380363 2777 dbSNP
rs1019868644 2786 dbSNP
rs572017486 2787 dbSNP
rs1276981587 2791 dbSNP
rs1008233794 2797 dbSNP
rs923857893 2798 dbSNP
rs1394339035 2807 dbSNP
rs1028425287 2811 dbSNP
rs981999149 2813 dbSNP
rs767341718 2815 dbSNP
rs949039779 2826 dbSNP
rs1340730170 2828 dbSNP
rs1295065346 2831 dbSNP
rs558207790 2832 dbSNP
rs1207949798 2833 dbSNP
rs916263688 2839 dbSNP
rs990955333 2844 dbSNP
rs1486670807 2855 dbSNP
rs1198395918 2856 dbSNP
rs1254822804 2861 dbSNP
rs952474748 2863 dbSNP
rs1036848490 2865 dbSNP
rs907163772 2868 dbSNP
rs544737264 2873 dbSNP
rs1341537827 2886 dbSNP
rs1315737244 2887 dbSNP
rs1160346265 2890 dbSNP
rs919700837 2894 dbSNP
rs973558703 2896 dbSNP
rs1450480585 2898 dbSNP
rs1347336958 2899 dbSNP
rs1046026077 2900 dbSNP
rs1302486687 2904 dbSNP
rs3786737 2916 dbSNP
rs754518547 2917 dbSNP
rs1015144631 2918 dbSNP
rs948417009 2920 dbSNP
rs1391737873 2933 dbSNP
rs28744445 2935 dbSNP
rs575821473 2937 dbSNP
rs915540479 2951 dbSNP
rs1009158543 2952 dbSNP
rs555985369 2953 dbSNP
rs1029012591 2955 dbSNP
rs1212486970 2958 dbSNP
rs996609787 2966 dbSNP
rs1164887327 2973 dbSNP
rs893884374 2974 dbSNP
rs978288623 2981 dbSNP
rs966833388 2982 dbSNP
rs183280257 2985 dbSNP
rs1175608985 2992 dbSNP
rs1395990941 2993 dbSNP
rs1436627377 2997 dbSNP
rs1236500003 2999 dbSNP
rs1306312435 3002 dbSNP
rs1053839070 3003 dbSNP
rs1187340007 3009 dbSNP
rs1298684646 3012 dbSNP
rs987433267 3020 dbSNP
rs999276330 3031 dbSNP
rs902365526 3032 dbSNP
rs1300165546 3036 dbSNP
rs192552997 3040 dbSNP
rs553842924 3047 dbSNP
rs1236065795 3049 dbSNP
rs751168453 3056 dbSNP
rs949352067 3057 dbSNP
rs916510688 3074 dbSNP
rs995500663 3078 dbSNP
rs565664320 3082 dbSNP
rs1254675489 3083 dbSNP
rs765813035 3086 dbSNP
rs562532829 3087 dbSNP
rs550914095 3089 dbSNP
rs931004486 3100 dbSNP
rs1455708990 3102 dbSNP
rs534179187 3107 dbSNP
rs770018895 3107 dbSNP
rs746032372 3109 dbSNP
rs972478755 3111 dbSNP
rs1410620419 3118 dbSNP
rs1171046587 3130 dbSNP
rs962168944 3136 dbSNP
rs1292617742 3147 dbSNP
rs1356281799 3148 dbSNP
rs1433993709 3153 dbSNP
rs571589529 3167 dbSNP
rs551898633 3169 dbSNP
rs1371497425 3177 dbSNP
rs1442564844 3186 dbSNP
rs374276938 3190 dbSNP
rs954971163 3201 dbSNP
rs531890099 3203 dbSNP
rs1013223816 3206 dbSNP
rs2008527 3207 dbSNP
rs996190980 3208 dbSNP
rs1305892797 3218 dbSNP
rs1409161232 3219 dbSNP
rs1366074001 3224 dbSNP
rs1054554682 3225 dbSNP
rs958035541 3228 dbSNP
rs1032355863 3231 dbSNP
rs549609094 3233 dbSNP
rs1425295973 3239 dbSNP
rs1475781836 3240 dbSNP
rs34477929 3243 dbSNP
rs529527612 3244 dbSNP
rs1158779030 3250 dbSNP
rs1188402741 3261 dbSNP
rs1470920165 3262 dbSNP
rs1414668981 3272 dbSNP
rs924363041 3275 dbSNP
rs11669386 3278 dbSNP
rs1394869194 3287 dbSNP
rs1462869841 3289 dbSNP
rs760744039 3301 dbSNP
rs1344278430 3303 dbSNP
rs1270205027 3305 dbSNP
rs1430793665 3306 dbSNP
rs1013863362 3320 dbSNP
rs1271381520 3331 dbSNP
rs775684490 3336 dbSNP
rs1376381548 3337 dbSNP
rs1233139551 3338 dbSNP
rs1381592825 3340 dbSNP
rs1315388822 3345 dbSNP
rs945544090 3347 dbSNP
rs1381864813 3349 dbSNP
rs781437480 3353 dbSNP
rs2008521 3355 dbSNP
rs747242060 3356 dbSNP
rs758539025 3357 dbSNP
rs753686618 3359 dbSNP
rs1422890246 3363 dbSNP
rs532121024 3367 dbSNP
rs777814650 3367 dbSNP
rs778506041 3367 dbSNP
rs756028048 3380 dbSNP
rs1164498662 3381 dbSNP
rs754980203 3382 dbSNP
rs1425749642 3385 dbSNP
rs375457501 3386 dbSNP
rs939770324 3388 dbSNP
rs1442704668 3393 dbSNP
rs749211389 3395 dbSNP
rs767222046 3398 dbSNP
rs188716648 3402 dbSNP
rs987648875 3403 dbSNP
rs1197495634 3404 dbSNP
rs1220155242 3410 dbSNP
rs751317554 3411 dbSNP
rs139483339 3417 dbSNP
rs150504639 3418 dbSNP
rs141801097 3419 dbSNP
rs770291118 3420 dbSNP
rs34632751 3428 dbSNP
rs1356877202 3429 dbSNP
rs776993799 3432 dbSNP
rs769063453 3433 dbSNP
rs1413699040 3434 dbSNP
rs1310447078 3436 dbSNP
rs755632223 3438 dbSNP
rs371795173 3440 dbSNP
rs780293112 3453 dbSNP
rs1032324679 3454 dbSNP
rs61755273 3459 dbSNP
rs745911441 3460 dbSNP
rs1024589650 3461 dbSNP
rs1158113180 3468 dbSNP
rs3745718 3471 dbSNP
rs573785078 3474 dbSNP
rs1413888232 3476 dbSNP
rs748050357 3477 dbSNP
rs781123298 3485 dbSNP
rs1269018291 3487 dbSNP
rs1276840760 3488 dbSNP
rs138779699 3492 dbSNP
rs1211734079 3495 dbSNP
rs1211062233 3496 dbSNP
rs1013415417 3499 dbSNP
rs754890431 3501 dbSNP
rs780016656 3502 dbSNP
rs751229617 3504 dbSNP
rs766186900 3505 dbSNP
rs146199265 3508 dbSNP
rs749876926 3511 dbSNP
rs1345381617 3517 dbSNP
rs764663963 3519 dbSNP
rs146657505 3526 dbSNP
rs756075950 3526 dbSNP
rs149162452 3527 dbSNP
rs999862762 3530 dbSNP
rs1173777577 3533 dbSNP
rs764409113 3536 dbSNP
rs1288572685 3537 dbSNP
rs1376773637 3543 dbSNP
rs761074966 3545 dbSNP
rs1328785223 3546 dbSNP
rs558188524 3553 dbSNP
rs995434554 3556 dbSNP
rs898139743 3559 dbSNP
rs368359327 3564 dbSNP
rs746082189 3566 dbSNP
rs749851325 3572 dbSNP
rs774431953 3580 dbSNP
rs770975518 3582 dbSNP
rs749260047 3583 dbSNP
rs8112588 3588 dbSNP
rs754800916 3589 dbSNP
rs35920934 3592 dbSNP
rs549570428 3599 dbSNP
rs758006827 3601 dbSNP
rs767068052 3602 dbSNP
rs756792561 3611 dbSNP
rs750097954 3612 dbSNP
rs1250733986 3614 dbSNP
rs764776725 3615 dbSNP
rs756786481 3616 dbSNP
rs190997806 3618 dbSNP
rs751288332 3624 dbSNP
rs1406522456 3626 dbSNP
rs140428405 3627 dbSNP
rs146880951 3628 dbSNP
rs765678614 3631 dbSNP
rs775792481 3634 dbSNP
rs1193213910 3642 dbSNP
rs1450958083 3644 dbSNP
rs1269012654 3646 dbSNP
rs767889684 3648 dbSNP
rs759781205 3654 dbSNP
rs1461193430 3658 dbSNP
rs1279760290 3659 dbSNP
rs774474455 3663 dbSNP
rs182337605 3666 dbSNP
rs749382283 3667 dbSNP
rs773435031 3668 dbSNP
rs1367628950 3670 dbSNP
rs1313261508 3671 dbSNP
rs760025108 3672 dbSNP
rs1383303741 3674 dbSNP
rs768643736 3679 dbSNP
rs746969682 3681 dbSNP
rs755929405 3689 dbSNP
rs771805440 3690 dbSNP
rs375359387 3695 dbSNP
rs533501140 3696 dbSNP
rs564491556 3699 dbSNP
rs371660482 3700 dbSNP
rs550969694 3703 dbSNP
rs1444833530 3704 dbSNP
rs1238445391 3708 dbSNP
rs1250661846 3714 dbSNP
rs908522427 3730 dbSNP
rs779645807 3734 dbSNP
rs767222799 3737 dbSNP
rs866582446 3764 dbSNP
rs978052559 3767 dbSNP
rs982735700 3769 dbSNP
rs1469937536 3780 dbSNP
rs971912939 3780 dbSNP
rs967151197 3781 dbSNP
rs1193861515 3794 dbSNP
rs1254562864 3797 dbSNP
rs1426185819 3804 dbSNP
rs1024392971 3805 dbSNP
rs1191908747 3808 dbSNP
rs1360125785 3809 dbSNP
rs1025017531 3815 dbSNP
rs992659255 3823 dbSNP
rs958523630 3824 dbSNP
rs1033360112 3831 dbSNP
rs1462348148 3837 dbSNP
rs1413301805 3843 dbSNP
rs1328169053 3847 dbSNP
rs1425048327 3863 dbSNP
rs1169364845 3882 dbSNP
rs139676879 3885 dbSNP
rs146401263 3892 dbSNP
rs1296332587 3895 dbSNP
rs376108431 3897 dbSNP
rs567932613 3900 dbSNP
rs573772387 3901 dbSNP
rs1015558626 3902 dbSNP
rs747948089 3906 dbSNP
rs879789524 3917 dbSNP
rs560137440 3937 dbSNP
rs757540366 3940 dbSNP
rs1019984612 3941 dbSNP
rs1291421469 3942 dbSNP
rs780974006 3944 dbSNP
rs754722844 3956 dbSNP
rs1333877023 3959 dbSNP
rs537055172 3960 dbSNP
rs1239010051 3961 dbSNP
rs866365391 3966 dbSNP
rs890236353 3967 dbSNP
rs1207707638 3971 dbSNP
rs1261730792 3971 dbSNP
rs1050148859 3974 dbSNP
rs1311572901 3975 dbSNP
rs1273604023 3977 dbSNP
rs1230061681 3979 dbSNP
rs557407280 3983 dbSNP
rs1417825200 3984 dbSNP
rs558150100 3986 dbSNP
rs1296155221 3988 dbSNP
rs1167621278 3992 dbSNP
rs538265047 3996 dbSNP
rs575736728 4007 dbSNP
rs1452947005 4015 dbSNP
rs764400198 4016 dbSNP
rs1380840687 4031 dbSNP
rs1289697223 4032 dbSNP
rs34415244 4034 dbSNP
rs189702876 4042 dbSNP
rs1310993294 4043 dbSNP
rs1354809072 4047 dbSNP
rs941647586 4050 dbSNP
rs1294829121 4052 dbSNP
rs1314942641 4052 dbSNP
rs908782766 4053 dbSNP
rs10418580 4054 dbSNP
rs1193668452 4056 dbSNP
rs766012649 4057 dbSNP
rs936877652 4064 dbSNP
rs1486250822 4068 dbSNP
rs917322716 4069 dbSNP
rs925533828 4071 dbSNP
rs1418881236 4075 dbSNP
rs1432093554 4087 dbSNP
rs991563932 4092 dbSNP
rs1042619917 4107 dbSNP
rs1032872977 4111 dbSNP
rs1173023854 4119 dbSNP
rs945361748 4121 dbSNP
rs567050175 4122 dbSNP
rs1304537424 4123 dbSNP
rs967325716 4129 dbSNP
rs1390645536 4131 dbSNP
rs1307255137 4132 dbSNP
rs1318412810 4133 dbSNP
rs1020205129 4136 dbSNP
rs992231169 4138 dbSNP
rs1278902886 4145 dbSNP
rs200543678 4145 dbSNP
rs551342272 4145 dbSNP
rs879196842 4145 dbSNP
rs1482797960 4147 dbSNP
rs1252190153 4149 dbSNP
rs959702446 4156 dbSNP
rs926722941 4164 dbSNP
rs954364689 4167 dbSNP
rs546879980 4172 dbSNP
rs1273327696 4174 dbSNP
rs1246034918 4179 dbSNP
rs754376509 4181 dbSNP
rs962540059 4190 dbSNP
rs1310113659 4191 dbSNP
rs1015486556 4195 dbSNP
rs537681251 4201 dbSNP
rs1302260638 4203 dbSNP
rs1227035012 4216 dbSNP
rs1378913385 4220 dbSNP
rs1371058781 4222 dbSNP
rs955045063 4230 dbSNP
rs373159001 4245 dbSNP
rs1038528039 4246 dbSNP
rs1308957719 4248 dbSNP
rs540082702 4255 dbSNP
rs1005674225 4258 dbSNP
rs996557056 4264 dbSNP
rs1467435074 4266 dbSNP
rs1412252732 4274 dbSNP
rs1213277425 4275 dbSNP
rs764576131 4277 dbSNP
rs1455639134 4281 dbSNP
rs1369207887 4283 dbSNP
rs1184915387 4297 dbSNP
rs1418910828 4305 dbSNP
rs570823683 4309 dbSNP
rs1427779683 4316 dbSNP
rs1047271286 4330 dbSNP
rs950110057 4339 dbSNP
rs917226500 4353 dbSNP
rs1056185091 4357 dbSNP
rs1438191605 4363 dbSNP
rs1458456285 4383 dbSNP
rs564951279 4384 dbSNP
rs1360702296 4391 dbSNP
rs937465110 4391 dbSNP
rs1351895171 4395 dbSNP
rs926022834 4404 dbSNP
rs1274026210 4405 dbSNP
rs978625722 4410 dbSNP
rs1054169798 4418 dbSNP
rs1000947663 4419 dbSNP
rs761087770 4421 dbSNP
rs1486246337 4426 dbSNP
rs1412463968 4427 dbSNP
rs1184029999 4443 dbSNP
rs1042588491 4447 dbSNP
rs954541024 4466 dbSNP
rs1163873555 4467 dbSNP
rs1418315538 4469 dbSNP
rs1315814917 4474 dbSNP
rs1406702390 4474 dbSNP
rs576961318 4479 dbSNP
rs1250955372 4489 dbSNP
rs1344071515 4497 dbSNP
rs372181218 4504 dbSNP
rs945636654 4508 dbSNP
rs1209971422 4511 dbSNP
rs558629523 4516 dbSNP
rs1489170611 4517 dbSNP
rs1294216628 4520 dbSNP
rs996227718 4525 dbSNP
rs550930988 4526 dbSNP
rs918198446 4536 dbSNP
rs1263100437 4537 dbSNP
rs1015961327 4543 dbSNP
rs531195520 4545 dbSNP
rs1220395536 4548 dbSNP
rs1056853729 4554 dbSNP
rs534086058 4559 dbSNP
rs1289408463 4578 dbSNP
rs1156417745 4580 dbSNP
rs1406879896 4583 dbSNP
rs1400769952 4584 dbSNP
rs1159873476 4602 dbSNP
rs1373098795 4603 dbSNP
rs181409714 4603 dbSNP
rs201550238 4603 dbSNP
rs1230591784 4604 dbSNP
rs926654354 4606 dbSNP
rs1014534951 4608 dbSNP
rs1288256626 4611 dbSNP
rs1374258860 4617 dbSNP
rs1242599170 4619 dbSNP
rs974162823 4621 dbSNP
rs777864164 4624 dbSNP
rs1210046587 4632 dbSNP
rs1279296160 4636 dbSNP
rs1392985458 4649 dbSNP
rs1443925151 4654 dbSNP
rs1291809895 4657 dbSNP
rs149429774 4662 dbSNP
rs1055837421 4663 dbSNP
rs908394448 4663 dbSNP
rs1457621189 4668 dbSNP
rs1347170 4674 dbSNP
rs771045197 4678 dbSNP
rs1161159256 4683 dbSNP
rs1455428561 4688 dbSNP
rs1411234211 4706 dbSNP
rs1328526486 4708 dbSNP
rs1199503153 4709 dbSNP
rs1449218141 4716 dbSNP
rs1301587615 4719 dbSNP
rs560255139 4720 dbSNP
rs1043123072 4726 dbSNP
rs1235203863 4732 dbSNP
rs189442658 4738 dbSNP
rs1346964201 4739 dbSNP
rs1465102767 4746 dbSNP
rs996917318 4747 dbSNP
rs1458063252 4759 dbSNP
rs28588030 4763 dbSNP
rs533235995 4765 dbSNP
rs945882364 4770 dbSNP
rs963681800 4775 dbSNP
rs1453259025 4778 dbSNP
rs1032691762 4780 dbSNP
rs564351802 4785 dbSNP
rs1378869716 4789 dbSNP
rs913041091 4790 dbSNP
rs1269606597 4792 dbSNP
rs138744005 4802 dbSNP
rs1397635440 4803 dbSNP
rs999917070 4806 dbSNP
rs187064032 4812 dbSNP
rs1394097652 4817 dbSNP
rs1441935805 4819 dbSNP
rs1325531786 4822 dbSNP
rs1324794908 4824 dbSNP
rs904008540 4826 dbSNP
rs137921047 4830 dbSNP
rs1269573816 4832 dbSNP
rs1042517253 4833 dbSNP
rs1220305730 4838 dbSNP
rs555523610 4846 dbSNP
rs974470762 4869 dbSNP
rs181539039 4870 dbSNP
rs1056756308 4871 dbSNP
rs1444832768 4889 dbSNP
rs983133202 4894 dbSNP
rs1425058550 4895 dbSNP
rs1478999786 4900 dbSNP
rs950456134 4909 dbSNP
rs1417596781 4914 dbSNP
rs371729672 4915 dbSNP
rs937975987 4919 dbSNP
rs756408196 4924 dbSNP
rs1322798187 4928 dbSNP
rs1014833419 4931 dbSNP
rs905207020 4932 dbSNP
rs1341114646 4936 dbSNP
rs536224036 4950 dbSNP
rs1001537353 4963 dbSNP
rs1333922341 4972 dbSNP
rs769665482 4972 dbSNP
rs1245041376 4975 dbSNP
rs747923854 4983 dbSNP
rs1043177683 4986 dbSNP
rs781168646 4988 dbSNP
rs941406343 4989 dbSNP
rs568886020 4997 dbSNP
rs1424808278 5001 dbSNP
rs1167139371 5002 dbSNP
rs891869414 5003 dbSNP
rs573264237 5005 dbSNP
rs8105324 5009 dbSNP
rs1159265037 5011 dbSNP
rs933143378 5012 dbSNP
rs1421391466 5014 dbSNP
rs933876658 5016 dbSNP
rs922475089 5019 dbSNP
rs532635381 5020 dbSNP
rs1186286621 5021 dbSNP
rs963654111 5026 dbSNP
rs1464124355 5027 dbSNP
rs921882338 5029 dbSNP
rs1237886041 5034 dbSNP
rs189613466 5041 dbSNP
rs1201354811 5054 dbSNP
rs1355255390 5055 dbSNP
rs1347806679 5061 dbSNP
rs1254751449 5066 dbSNP
rs1483778550 5067 dbSNP
rs978423218 5077 dbSNP
rs1248873807 5091 dbSNP
rs1418653722 5098 dbSNP
rs28526267 5108 dbSNP
rs1179524780 5110 dbSNP
rs967088787 5111 dbSNP
rs867424429 5112 dbSNP
rs941710056 5117 dbSNP
rs1020067002 5130 dbSNP
rs545483268 5131 dbSNP
rs1171683075 5133 dbSNP
rs1358564293 5146 dbSNP
rs1466501264 5150 dbSNP
rs1342963418 5155 dbSNP
rs908909081 5157 dbSNP
rs746675438 5163 dbSNP
rs983059575 5164 dbSNP
rs1010147756 5171 dbSNP
rs1309592831 5172 dbSNP
rs1378435118 5178 dbSNP
rs1062806 5179 dbSNP
rs113517327 5180 dbSNP
rs1035651989 5181 dbSNP
rs1212862569 5182 dbSNP
rs1249933256 5199 dbSNP
rs1480541127 5201 dbSNP
rs1433200986 5208 dbSNP
rs1240336268 5217 dbSNP
rs1452648779 5223 dbSNP
rs767593411 5223 dbSNP
rs1364681999 5235 dbSNP
rs1425967301 5252 dbSNP
rs1433663305 5253 dbSNP
rs374244120 5265 dbSNP
rs12983742 5269 dbSNP
rs141975932 5269 dbSNP
rs71334276 5269 dbSNP
rs1397541714 5274 dbSNP
rs1002474439 5277 dbSNP
rs905465630 5289 dbSNP
rs757923008 5293 dbSNP
rs372965243 5299 dbSNP
rs1038365024 5313 dbSNP
rs1400054709 5336 dbSNP
rs749959555 5342 dbSNP
rs1292367306 5355 dbSNP
rs1353936496 5356 dbSNP
rs1302188143 5360 dbSNP
rs1367727494 5366 dbSNP
rs1221417054 5383 dbSNP
rs1294112151 5385 dbSNP
rs1307283928 5393 dbSNP
rs993018507 5402 dbSNP
rs1260412189 5407 dbSNP
rs1467257344 5412 dbSNP
rs1430255645 5415 dbSNP
rs1247317982 5419 dbSNP
rs941373740 5420 dbSNP
rs1034625304 5430 dbSNP
rs1259654128 5435 dbSNP
rs1001758156 5461 dbSNP
rs904763690 5476 dbSNP
rs1425507878 5477 dbSNP
rs1021659617 5483 dbSNP
rs887186027 5487 dbSNP
rs34044320 5493 dbSNP
rs778322404 5498 dbSNP
rs1349928102 5524 dbSNP
rs1438073015 5532 dbSNP
rs1287622849 5533 dbSNP
rs1368660547 5538 dbSNP
rs1188749368 5543 dbSNP
rs933787805 5556 dbSNP
rs1401149368 5563 dbSNP
rs1280448555 5564 dbSNP
rs1333177117 5569 dbSNP
rs774154145 5570 dbSNP
rs1290908059 5576 dbSNP
rs975714506 5579 dbSNP
rs1210809804 5580 dbSNP
rs1052248843 5587 dbSNP
rs150195059 5598 dbSNP
rs900312431 5600 dbSNP
rs753009883 5601 dbSNP
rs1264997036 5608 dbSNP
rs1474127911 5613 dbSNP
rs1180922040 5614 dbSNP
rs537399501 5616 dbSNP
rs941973777 5621 dbSNP
rs978390729 5623 dbSNP
rs1156233983 5633 dbSNP
rs568789680 5635 dbSNP
rs1339040035 5643 dbSNP
rs1420790776 5646 dbSNP
rs35741347 5648 dbSNP
rs1300644010 5657 dbSNP
rs767879406 5663 dbSNP
rs1353917805 5665 dbSNP
rs1971783 5666 dbSNP
rs1246806552 5693 dbSNP
rs1020414948 5697 dbSNP
rs574412446 5699 dbSNP
rs566468252 5700 dbSNP
rs992604809 5707 dbSNP
rs1410390581 5712 dbSNP
rs1354526068 5723 dbSNP
rs1971784 5728 dbSNP
rs1440471438 5731 dbSNP
rs1209096704 5733 dbSNP
rs779969562 5733 dbSNP
rs1428519441 5734 dbSNP
rs992294270 5734 dbSNP
rs1035175097 5735 dbSNP
rs114446804 5738 dbSNP
rs1164637913 5741 dbSNP
rs76246712 5744 dbSNP
rs1367114151 5749 dbSNP
rs1335189531 5753 dbSNP
rs367827284 5756 dbSNP
rs1361289518 5757 dbSNP
rs1440227770 5761 dbSNP
rs1017234617 5766 dbSNP
rs1005514268 5776 dbSNP
rs980248399 5781 dbSNP
rs1187635691 5783 dbSNP
rs968998898 5786 dbSNP
rs1342710418 5791 dbSNP
rs887126278 5795 dbSNP
rs544514118 5800 dbSNP
rs1010251336 5801 dbSNP
rs1443977894 5806 dbSNP
rs745432484 5807 dbSNP
rs558415107 5812 dbSNP
rs1237258658 5824 dbSNP
rs117355873 5825 dbSNP
rs1179906270 5831 dbSNP
rs367939331 5835 dbSNP
rs1354459757 5845 dbSNP
rs1477963274 5847 dbSNP
rs1173692296 5848 dbSNP
rs1427668157 5849 dbSNP
rs1408611298 5852 dbSNP
rs900563752 5855 dbSNP
rs35300135 5860 dbSNP
rs1292492645 5868 dbSNP
rs538747502 5872 dbSNP
rs1352320491 5879 dbSNP
rs1286371819 5888 dbSNP
rs773208137 5898 dbSNP
rs1441305151 5903 dbSNP
rs4802445 5906 dbSNP
rs1216631421 5907 dbSNP
rs1042957010 5913 dbSNP
rs1257204086 5914 dbSNP
rs945686850 5915 dbSNP
rs912915265 5924 dbSNP
rs1264591065 5929 dbSNP
rs992926159 5934 dbSNP
rs1403282011 5935 dbSNP
rs1450586897 5943 dbSNP
rs1200156758 5946 dbSNP
rs1249029328 5948 dbSNP
rs1393243145 5955 dbSNP
rs1477137523 5959 dbSNP
rs959803577 5959 dbSNP
rs927068164 5963 dbSNP
rs573258595 5966 dbSNP
rs1164721995 5967 dbSNP
rs1467333448 5970 dbSNP
rs1458086148 5974 dbSNP
rs184895229 5975 dbSNP
rs768578093 5978 dbSNP
rs1390069875 5980 dbSNP
rs1180655759 5989 dbSNP
rs746869446 5993 dbSNP
rs969545629 5994 dbSNP
rs1017161457 6002 dbSNP
rs779743680 6006 dbSNP
rs1056120025 6009 dbSNP
rs1971785 6010 dbSNP
rs1025627387 6015 dbSNP
rs1450136403 6021 dbSNP
rs998623943 6026 dbSNP
rs763291911 6028 dbSNP
rs901251832 6030 dbSNP
rs968840989 6035 dbSNP
rs1223166709 6038 dbSNP
rs914830963 6039 dbSNP
rs1264320071 6040 dbSNP
rs1479030893 6044 dbSNP
rs113436398 6050 dbSNP
rs1368175202 6058 dbSNP
rs1433650405 6061 dbSNP
rs989040682 6068 dbSNP
rs1297554277 6070 dbSNP
rs1417727871 6070 dbSNP
rs956081215 6070 dbSNP
rs368692361 6076 dbSNP
rs138408409 6079 dbSNP
rs1401682441 6088 dbSNP
rs1310331561 6090 dbSNP
rs1339448239 6092 dbSNP
rs147054148 6116 dbSNP
rs1391307752 6117 dbSNP
rs1157315582 6127 dbSNP
rs965189378 6128 dbSNP
rs904372850 6129 dbSNP
rs1287449251 6130 dbSNP
rs1426458814 6133 dbSNP
rs568676536 6134 dbSNP
rs1486134790 6139 dbSNP
rs1199031446 6155 dbSNP
rs1255905694 6156 dbSNP
rs367864867 6158 dbSNP
rs1042930749 6163 dbSNP
rs4802443 6177 dbSNP
rs1202573972 6182 dbSNP
rs566497250 6185 dbSNP
rs1361152721 6187 dbSNP
rs11665981 6188 dbSNP
rs1300826048 6189 dbSNP
rs1401261312 6198 dbSNP
rs1396230065 6199 dbSNP
rs1047651083 6207 dbSNP
rs1245992464 6216 dbSNP
rs1374014428 6225 dbSNP
rs376412685 6235 dbSNP
rs993851250 6235 dbSNP
rs1309372635 6241 dbSNP
rs143211021 6243 dbSNP
rs540397646 6261 dbSNP
rs1255718100 6265 dbSNP
rs1483811351 6278 dbSNP
rs1202363639 6280 dbSNP
rs937686009 6289 dbSNP
rs1457360023 6303 dbSNP
rs926369250 6318 dbSNP
rs1056791219 6320 dbSNP
rs759662768 6329 dbSNP
rs1043458695 6336 dbSNP
rs1173926178 6347 dbSNP
rs1376828763 6348 dbSNP
rs1346528282 6354 dbSNP
rs947556291 6356 dbSNP
rs1230188574 6357 dbSNP
rs1397608050 6358 dbSNP
rs914717747 6358 dbSNP
rs1362530743 6359 dbSNP
rs1287537424 6360 dbSNP
rs988974157 6360 dbSNP
rs1430445044 6361 dbSNP
rs1360314990 6362 dbSNP
rs1301233073 6364 dbSNP
rs1313143987 6366 dbSNP
rs934944695 6368 dbSNP
rs1336722581 6379 dbSNP
rs1433337162 6383 dbSNP
rs1178245043 6384 dbSNP
rs1189400059 6384 dbSNP
rs1199533827 6384 dbSNP
rs1240080145 6384 dbSNP
rs1256572930 6384 dbSNP
rs1266661606 6384 dbSNP
rs1274392783 6384 dbSNP
rs1317480416 6384 dbSNP
rs1343712418 6384 dbSNP
rs1355742761 6384 dbSNP
rs1374010588 6384 dbSNP
rs1421246616 6384 dbSNP
rs1433718529 6384 dbSNP
rs1487569812 6384 dbSNP
rs1491522021 6384 dbSNP
rs61047810 6384 dbSNP
rs869226905 6384 dbSNP
rs1260315358 6385 dbSNP
rs1319991612 6385 dbSNP
rs1340351970 6385 dbSNP
rs1491158731 6385 dbSNP
rs1394575531 6386 dbSNP
rs1169253428 6387 dbSNP
rs1488742153 6388 dbSNP
rs192349981 6396 dbSNP
rs1417615035 6397 dbSNP
rs1185777522 6399 dbSNP
rs1483453778 6404 dbSNP
rs71357807 6405 dbSNP
rs1207956050 6406 dbSNP
rs1485276509 6408 dbSNP
rs1403256659 6412 dbSNP
rs1274775297 6421 dbSNP
rs1163379561 6425 dbSNP
rs938384658 6428 dbSNP
rs550803422 6431 dbSNP
rs927020696 6443 dbSNP
rs976496350 6450 dbSNP
rs979853351 6454 dbSNP
rs530789774 6458 dbSNP
rs551639672 6459 dbSNP
rs1227994881 6463 dbSNP
rs189487245 6468 dbSNP
rs910072339 6469 dbSNP
rs1283877639 6471 dbSNP
rs1413501209 6475 dbSNP
rs1375336864 6476 dbSNP
rs781711153 6479 dbSNP
rs1216994943 6482 dbSNP
rs1243636681 6483 dbSNP
rs951649994 6485 dbSNP
rs1026351338 6488 dbSNP
rs984810484 6490 dbSNP
rs1170017206 6493 dbSNP
rs1157374268 6497 dbSNP
rs1424558715 6513 dbSNP
rs1415724359 6515 dbSNP
rs1320648938 6519 dbSNP
rs776887195 6520 dbSNP
rs1185482278 6521 dbSNP
rs145050849 6522 dbSNP
rs965763032 6523 dbSNP
rs1385074835 6526 dbSNP
rs1026128986 6528 dbSNP