miRTarBase - #MIRT000835 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ECHDC1   
Synonyms HEL-S-76, MMCD, dJ351K20.2
Description ethylmalonyl-CoA decarboxylase 1
Transcript NM_001105545   
Other Transcripts NM_001105544 , NM_001002030 , NM_001139510 , NM_018479   
Expression
Putative miRNA Targets on ECHDC1
3'UTR of ECHDC1
(miRNA target sites are highlighted)
>ECHDC1|NM_001105545|3'UTR
   1 TTTCAGGTTAATGACTCCAGAGAGTAAGATCAGATTCGTCCACAAAGAGATGGGCATAATACCAAGCTGGGGTGGCACCA
  81 CCCGGCTAGTTGAAATAATCGGAAGTAGACAAGCTCTCAAAGTGTTGAGTGGGGCCCTTAAACTGGATTCAAAAAATGCT
 161 CTAAACATAGGAATGGTTGAAGAGGTCTTGCAGTCTTCAGATGAAACTAAATCTCTAGAAGAGGCACAAGAATGGCTAAA
 241 GCAATTCATCCAAGGGCCACCGGAAGTAATTAGAGCTTTGAAAAAATCTGTTTGTTCAGGCAGAGAGCTATATTTGGAGG
 321 AAGCATTACAGAACGAAAGAGATCTTTTAGGAACAGTTTGGGGTGGGCCTGCAAATTTAGAGGCTATTGCTAAGAAAGGA
 401 AAATTTAATAAATAATTGGTTTTTCGTGTGGATGTACTCCAAGTAAAGCTCCAGTGACTAATATGTATAAATGTTAAATG
 481 ATATTAAATATGAACATCAGAATTACTTTGAAGGCTACTATTAATATGCAGACTTACTTTTAATCATTTGAATATCTGAA
 561 CTCATTTACCTCATTTCTTGCCAATTACTCACTTGGGTATTTACTGCGTAATCTGGAACATTTAGCTAAAATATACACTT
 641 TTGGCTTAAAAATTATTGCTGTCAATTCCAATAATAATTCTTAGCTTATAACCAAAGAGCAGTGTTTAAAAGGAGAGCTT
 721 CTATACAAAACCTATTCCTGGCGTTACTTTTCATACAATTTTTGTTCTGTTTTACCTGGAAATAATTTACCAAAATAACT
 801 GAGTGTTGCTGCTAAAGAACAAAAGTGGGGAGGTATCAGGGAACAAGAAAACAAGAAAGGGTATGATCAATCATTTTCTT
 881 CTGCTCCAAACAGCTGGAGTAAAATTCATGGGAAATGGCCCTTCATTTAAAAAAAGATGTACCTCACTACCCACTACAAA
 961 TTTGGAACTTTGTTCTTTTCAATAATTAGTTTTCTATTGTAAATTACCTACTAAACAGTGGTAGCCATGACATGGAAAGT
1041 CAACTGATTCTACAATTGGACATTCATTTGTGTGCCCTGGAATTTCCAACTAGTAATAAACAACTACTGTTGATGTAGTT
1121 TTAAACCACTTGAAGGGACTCATGAAGCATCCTGCAACATAAATTTGCATTTTTACATCAGATTTCTTTTTTTTCCTGAA
1201 AAACAACTAACCTTCTAACAACTATCTTTCAAAAGTAAATGTAATAAAAATGCACAACATAAAATGTTTATGATCCCAGC
1281 AATACACTTTTTAAAAAATGTGAAAGTCAAAGAATTAAGTTCTAGTTCTGACTCATCACAAGAGGTCAAAAGTATTTGCT
1361 ACTGTAACATTCAATTCACATTTGAGAATCATGGTAAAAATAACTTGCATTTGCCTTACCATCATGATCCTACTGTTGAG
1441 TTAGGAAAATATGGTTAGACAGACTCACATTACTTTTTTTCAGAGGTAAACTCTAGATTACTGTGTCAACCCAATACTAT
1521 TTGGCCATAGATGTAAAAACTACCAAATAAAAGTGGATTTTGTGGTCTACAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU--AAU-AC-ACGACGAu 5'
            |||| :|  | | || ||||||| 
Target 5' acCAAAATAACTGAGTGTTGCTGCTa 3'
789 - 814 154.00 -12.80
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||:|||| | | ||||| 
Target 5' gatcAATCATTTTCTTCTGCTc 3'
865 - 886 138.00 -9.40
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||  | ||| |||| || 
Target 5' gtCAAA--AGTATTTGCTACTg 3'
1345 - 1364 132.00 -7.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
978064 24513 ClinVar
COSM373247 4 COSMIC
COSM9291759 4 COSMIC
COSN18236659 17 COSMIC
COSN7688442 25 COSMIC
COSN18295777 176 COSMIC
COSN24106944 244 COSMIC
COSN30317738 402 COSMIC
COSN21684529 419 COSMIC
COSN14777744 830 COSMIC
COSN24638979 1024 COSMIC
COSN9295919 1029 COSMIC
COSN19731467 1231 COSMIC
COSN30592971 1328 COSMIC
COSN4855497 1421 COSMIC
COSN14751246 1520 COSMIC
COSN22087041 1557 COSMIC
COSN20187479 1627 COSMIC
COSN2140297 1755 COSMIC
COSN22052689 2178 COSMIC
COSN2140296 2195 COSMIC
COSN2140295 2253 COSMIC
COSN16157314 2444 COSMIC
COSN9966827 2455 COSMIC
COSN21807126 2466 COSMIC
COSN26400877 2579 COSMIC
COSN28455474 3019 COSMIC
COSN28533784 3128 COSMIC
COSN15715808 3161 COSMIC
COSN9295918 3193 COSMIC
COSN14511902 3286 COSMIC
COSN19471224 3443 COSMIC
COSN25018964 3826 COSMIC
COSN27140204 4142 COSMIC
COSN28032963 4183 COSMIC
COSN9295917 4364 COSMIC
COSN29969529 4384 COSMIC
COSN28967921 4416 COSMIC
COSN17575678 4785 COSMIC
COSN7688441 4973 COSMIC
COSN19211213 5308 COSMIC
COSN28532137 5332 COSMIC
COSN22683653 5448 COSMIC
COSN8793480 5540 COSMIC
COSN27953769 5771 COSMIC
COSN23683521 5806 COSMIC
COSN24522678 6129 COSMIC
COSN29926478 6459 COSMIC
COSN25065507 6976 COSMIC
COSN25060435 7040 COSMIC
COSN2140294 7051 COSMIC
COSN19293214 7169 COSMIC
COSN22528990 7192 COSMIC
COSN5620695 7280 COSMIC
COSN25606080 7900 COSMIC
COSN26145993 7926 COSMIC
COSN32197560 8052 COSMIC
COSN5164210 8439 COSMIC
COSN21839955 8658 COSMIC
COSN2140292 8710 COSMIC
COSN25267314 9787 COSMIC
COSN25273883 9932 COSMIC
COSN21168717 10598 COSMIC
COSN29596655 10615 COSMIC
COSN20941439 11045 COSMIC
COSN27540784 11768 COSMIC
COSN18289468 11775 COSMIC
COSN2140291 12436 COSMIC
COSN8793479 13159 COSMIC
COSN8398463 13176 COSMIC
COSN9295916 13257 COSMIC
COSN22467768 13287 COSMIC
COSN22750987 13560 COSMIC
COSN9295915 13653 COSMIC
COSN6302611 13736 COSMIC
COSN26138757 14292 COSMIC
COSN21873796 14613 COSMIC
COSN2140289 14777 COSMIC
COSN25681032 14853 COSMIC
COSN14739760 15017 COSMIC
COSN23174496 15025 COSMIC
COSN24153246 15171 COSMIC
COSN2140288 15182 COSMIC
COSN2140287 15186 COSMIC
COSN21691090 15303 COSMIC
COSN2140286 15318 COSMIC
COSN27614420 15780 COSMIC
COSN27770616 15870 COSMIC
COSN21144561 16112 COSMIC
COSN28230592 16221 COSMIC
COSN2140285 16323 COSMIC
COSN27095732 16482 COSMIC
COSN21834033 16565 COSMIC
COSN6302610 16593 COSMIC
COSN21949454 16621 COSMIC
COSN28458975 16813 COSMIC
COSN24003864 17594 COSMIC
COSN23998988 17625 COSMIC
COSN29703195 17799 COSMIC
COSN6302608 17879 COSMIC
COSN29811465 17989 COSMIC
COSN5620693 18070 COSMIC
COSN20317584 18071 COSMIC
COSN20967523 18254 COSMIC
COSN17860999 18288 COSMIC
COSN20967905 18747 COSMIC
COSN20967824 18785 COSMIC
COSN20967823 18931 COSMIC
COSN22571993 19215 COSMIC
COSN19360260 19362 COSMIC
COSN29278875 19433 COSMIC
COSN2140283 19621 COSMIC
COSN21644064 19941 COSMIC
COSN25276477 19984 COSMIC
COSN20967522 20312 COSMIC
COSN22678670 20396 COSMIC
COSN20967314 20475 COSMIC
COSN20967719 20588 COSMIC
COSN6302606 20821 COSMIC
COSN22727959 21395 COSMIC
COSN20967195 21431 COSMIC
COSN21702494 21477 COSMIC
COSN20967625 21482 COSMIC
COSN20967822 21485 COSMIC
COSN24770763 21910 COSMIC
COSN15288518 21915 COSMIC
COSN29004323 22209 COSMIC
COSN2140282 22225 COSMIC
COSN20220406 22620 COSMIC
COSN16489685 22634 COSMIC
COSN5620689 22693 COSMIC
COSN22585214 22891 COSMIC
COSN6512821 23496 COSMIC
COSN1324634 23527 COSMIC
COSN1324633 23606 COSMIC
COSN8793478 23608 COSMIC
COSN1324632 23985 COSMIC
COSN20069911 24336 COSMIC
COSM6651339 24551 COSMIC
COSM6651338 24553 COSMIC
COSM3994581 24572 COSMIC
COSM1620863 24574 COSMIC
COSM6651334 24575 COSMIC
COSM8130023 24579 COSMIC
COSM8873419 24592 COSMIC
COSM3777070 24594 COSMIC
COSM8879997 24599 COSMIC
COSM7111183 24610 COSMIC
COSM450441 24620 COSMIC
COSM1440280 24622 COSMIC
COSM3669540 24622 COSMIC
COSM6172555 24638 COSMIC
COSM7499100 24639 COSMIC
COSM9284277 24639 COSMIC
COSM6651340 24654 COSMIC
COSM7822173 24656 COSMIC
COSM1072978 24659 COSMIC
COSM7365814 24669 COSMIC
COSM7934978 24675 COSMIC
COSM1440279 24689 COSMIC
COSM5869242 24697 COSMIC
COSM3366285 24698 COSMIC
COSM6547626 24740 COSMIC
COSM5647923 24741 COSMIC
COSM7934947 24753 COSMIC
COSM7504892 24772 COSMIC
COSM5345020 24785 COSMIC
COSM7656696 24789 COSMIC
COSM8736236 24792 COSMIC
COSM8735256 24793 COSMIC
COSM269075 24799 COSMIC
COSM7676750 24816 COSMIC
COSM8853700 24818 COSMIC
COSM6651337 24836 COSMIC
COSM1187150 24841 COSMIC
COSM4943951 24844 COSMIC
COSM6248694 24862 COSMIC
COSM3744910 24864 COSMIC
COSM9010296 24882 COSMIC
COSM1072977 24883 COSMIC
COSM461910 24899 COSMIC
COSM5285118 24901 COSMIC
COSM7524333 24904 COSMIC
COSM8963478 24915 COSMIC
COSM8113247 24928 COSMIC
COSM6054466 24935 COSMIC
COSM1672731 24939 COSMIC
COSM6193359 24944 COSMIC
COSN30139084 24964 COSMIC
COSN30522106 24974 COSMIC
COSN28890491 24984 COSMIC
COSN31505237 24997 COSMIC
COSN30492523 25013 COSMIC
COSN30101999 25038 COSMIC
COSN1324630 25077 COSMIC
COSN21214039 25243 COSMIC
COSN9295913 25645 COSMIC
COSN20980134 26107 COSMIC
rs35311556 2763 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1176449539 1 dbSNP
rs1378849992 2 dbSNP
rs367812403 4 dbSNP
rs746287294 7 dbSNP
rs112248003 9 dbSNP
rs763131683 17 dbSNP
rs1171899990 18 dbSNP
rs368649472 19 dbSNP
rs769549965 26 dbSNP
rs747770040 27 dbSNP
rs759972555 30 dbSNP
rs1350038242 32 dbSNP
rs1405763614 34 dbSNP
rs1271039013 47 dbSNP
rs777251619 50 dbSNP
rs780925208 54 dbSNP
rs563645893 56 dbSNP
rs1233221937 59 dbSNP
rs1252353884 67 dbSNP
rs1344796455 72 dbSNP
rs1203374033 74 dbSNP
rs1272061404 76 dbSNP
rs776336868 77 dbSNP
rs1482558674 81 dbSNP
rs938827400 84 dbSNP
rs1056028826 90 dbSNP
rs371154778 101 dbSNP
rs1385901607 104 dbSNP
rs906909032 105 dbSNP
rs1373504633 115 dbSNP
rs1178153084 118 dbSNP
rs1044493300 131 dbSNP
rs1166542405 140 dbSNP
rs1236346343 143 dbSNP
rs948785961 143 dbSNP
rs1425578617 150 dbSNP
rs1295482102 153 dbSNP
rs1365608837 153 dbSNP
rs1386242521 168 dbSNP
rs914594403 169 dbSNP
rs1296926987 170 dbSNP
rs1206355239 171 dbSNP
rs1438120851 178 dbSNP
rs1288905431 215 dbSNP
rs1226821734 224 dbSNP
rs1226218801 232 dbSNP
rs1361199469 236 dbSNP
rs1360583991 242 dbSNP
rs990536556 251 dbSNP
rs907533312 257 dbSNP
rs955983468 259 dbSNP
rs924524275 266 dbSNP
rs931561911 269 dbSNP
rs1208663678 272 dbSNP
rs1248087996 274 dbSNP
rs986637623 285 dbSNP
rs1186559310 286 dbSNP
rs1389377390 301 dbSNP
rs150664893 302 dbSNP
rs920224076 309 dbSNP
rs1443585616 311 dbSNP
rs1457488468 314 dbSNP
rs1289568467 321 dbSNP
rs756286317 323 dbSNP
rs1390883869 324 dbSNP
rs532135928 333 dbSNP
rs559973721 334 dbSNP
rs866939410 339 dbSNP
rs1020088615 341 dbSNP
rs986870226 346 dbSNP
rs967479063 351 dbSNP
rs1407265888 364 dbSNP
rs1319608214 377 dbSNP
rs962752956 382 dbSNP
rs1020296725 388 dbSNP
rs1394887600 391 dbSNP
rs1268288835 404 dbSNP
rs1011620719 407 dbSNP
rs1206758244 411 dbSNP
rs1016624081 412 dbSNP
rs1158111669 413 dbSNP
rs1437980795 422 dbSNP
rs893026268 424 dbSNP
rs1183330277 426 dbSNP
rs1034275424 431 dbSNP
rs541309461 444 dbSNP
rs1382251968 449 dbSNP
rs1160173278 450 dbSNP
rs1302384103 453 dbSNP
rs1178829910 460 dbSNP
rs886729148 471 dbSNP
rs1455652943 475 dbSNP
rs1001749447 478 dbSNP
rs1470489447 478 dbSNP
rs1450794325 479 dbSNP
rs1048009918 483 dbSNP
rs768121947 499 dbSNP
rs560019621 503 dbSNP
rs1288526219 508 dbSNP
rs1330608276 511 dbSNP
rs1225998516 512 dbSNP
rs1004568050 515 dbSNP
rs1267451349 523 dbSNP
rs561635086 525 dbSNP
rs1219165974 528 dbSNP
rs750860622 532 dbSNP
rs79887585 535 dbSNP
rs1235588592 542 dbSNP
rs1170048446 543 dbSNP
rs182882263 548 dbSNP
rs559460983 557 dbSNP
rs1254161339 559 dbSNP
rs1350785624 565 dbSNP
rs771517934 572 dbSNP
rs1224792312 584 dbSNP
rs1416719496 589 dbSNP
rs1039970690 590 dbSNP
rs1367570541 599 dbSNP
rs942975660 601 dbSNP
rs375959975 604 dbSNP
rs1407206776 608 dbSNP
rs912712914 612 dbSNP
rs1287203376 614 dbSNP
rs1367687293 615 dbSNP
rs1220929682 616 dbSNP
rs1276344627 625 dbSNP
rs368013983 627 dbSNP
rs527950853 627 dbSNP
rs924577943 636 dbSNP
rs539027616 640 dbSNP
rs1482221457 644 dbSNP
rs370328458 648 dbSNP
rs554027379 668 dbSNP
rs1479017334 671 dbSNP
rs1189988715 673 dbSNP
rs990112843 676 dbSNP
rs9398838 682 dbSNP
rs957413503 684 dbSNP
rs962521473 687 dbSNP
rs1034650578 688 dbSNP
rs1189241977 690 dbSNP
rs1437900105 691 dbSNP
rs759096760 695 dbSNP
rs982488375 702 dbSNP
rs1299640558 710 dbSNP
rs1192424030 711 dbSNP
rs1487124700 712 dbSNP
rs1204725718 715 dbSNP
rs775932656 716 dbSNP
rs1024137644 717 dbSNP
rs1004706869 730 dbSNP
rs951034276 737 dbSNP
rs1246178868 738 dbSNP
rs1215951199 740 dbSNP
rs9398837 750 dbSNP
rs1277204620 751 dbSNP
rs1388766657 757 dbSNP
rs1048799021 770 dbSNP
rs994438493 776 dbSNP
rs1003145574 780 dbSNP
rs1166964871 781 dbSNP
rs555920352 786 dbSNP
rs1039134920 791 dbSNP
rs907427927 796 dbSNP
rs1321061360 797 dbSNP
rs540133474 802 dbSNP
rs1435800153 805 dbSNP
rs1277998084 819 dbSNP
rs12199287 830 dbSNP
rs893258906 831 dbSNP
rs1364409486 839 dbSNP
rs1289508781 841 dbSNP
rs1285028031 857 dbSNP
rs1358801095 864 dbSNP
rs1226790447 868 dbSNP
rs1272696380 873 dbSNP
rs1054473755 886 dbSNP
rs1211139987 891 dbSNP
rs913297867 897 dbSNP
rs1447474823 901 dbSNP
rs781471565 905 dbSNP
rs1188614548 916 dbSNP
rs1370537713 919 dbSNP
rs990245010 921 dbSNP
rs1357504068 936 dbSNP
rs551826721 938 dbSNP
rs1174104547 947 dbSNP
rs1416546655 949 dbSNP
rs1457250538 949 dbSNP
rs957714306 950 dbSNP
rs934714237 951 dbSNP
rs1381558158 954 dbSNP
rs903207539 960 dbSNP
rs1342038395 967 dbSNP
rs189844639 981 dbSNP
rs62437270 984 dbSNP
rs1292838717 989 dbSNP
rs1329934694 992 dbSNP
rs1230257268 997 dbSNP
rs1266802025 1001 dbSNP
rs878927008 1004 dbSNP
rs1350646133 1006 dbSNP
rs1201528672 1010 dbSNP
rs927295559 1021 dbSNP
rs1440996031 1022 dbSNP
rs1169753090 1023 dbSNP
rs1256320155 1025 dbSNP
rs980548368 1028 dbSNP
rs1476624422 1035 dbSNP
rs1263484418 1036 dbSNP
rs933947591 1037 dbSNP
rs867604606 1039 dbSNP
rs1186588248 1045 dbSNP
rs9388561 1046 dbSNP
rs1453050653 1060 dbSNP
rs573359196 1061 dbSNP
rs1004633414 1062 dbSNP
rs941192538 1070 dbSNP
rs1378685550 1071 dbSNP
rs1412474907 1073 dbSNP
rs909682194 1087 dbSNP
rs950570973 1110 dbSNP
rs1027474636 1118 dbSNP
rs1411870059 1128 dbSNP
rs1286571360 1139 dbSNP
rs548025662 1145 dbSNP
rs1234627740 1146 dbSNP
rs1324932702 1150 dbSNP
rs1257798455 1151 dbSNP
rs1343354024 1153 dbSNP
rs951087699 1162 dbSNP
rs1034705700 1167 dbSNP
rs1217244984 1175 dbSNP
rs185131060 1182 dbSNP
rs1008990166 1184 dbSNP
rs1164964856 1191 dbSNP
rs562279195 1192 dbSNP
rs1417941409 1195 dbSNP
rs1418324874 1202 dbSNP
rs1186804818 1206 dbSNP
rs543127974 1208 dbSNP
rs1306962842 1211 dbSNP
rs780189290 1230 dbSNP
rs1244769822 1234 dbSNP
rs1198533084 1238 dbSNP
rs1490500736 1241 dbSNP
rs1293995914 1245 dbSNP
rs1199494561 1246 dbSNP
rs1203075485 1256 dbSNP
rs141971214 1260 dbSNP
rs117030178 1261 dbSNP
rs1216550909 1265 dbSNP
rs1461059680 1266 dbSNP
rs1392575153 1273 dbSNP
rs946170526 1286 dbSNP
rs1365853936 1290 dbSNP
rs891954448 1298 dbSNP
rs1387389080 1301 dbSNP
rs545436206 1313 dbSNP
rs180732188 1317 dbSNP
rs1304082005 1322 dbSNP
rs1023634652 1327 dbSNP
rs1054649215 1328 dbSNP
rs1298890927 1330 dbSNP
rs1013130448 1335 dbSNP
rs563626132 1336 dbSNP
rs893304001 1339 dbSNP
rs1206868926 1340 dbSNP
rs1249190490 1341 dbSNP
rs1480043314 1344 dbSNP
rs553787693 1351 dbSNP
rs1410948612 1352 dbSNP
rs1268809636 1355 dbSNP
rs1483285045 1361 dbSNP
rs998913914 1365 dbSNP
rs1192924895 1366 dbSNP
rs1462145455 1380 dbSNP
rs542082358 1381 dbSNP
rs370551497 1382 dbSNP
rs983344481 1383 dbSNP
rs779987626 1404 dbSNP
rs189325461 1412 dbSNP
rs950659951 1416 dbSNP
rs1027442119 1419 dbSNP
rs933979094 1421 dbSNP
rs1252273809 1430 dbSNP
rs899788946 1431 dbSNP
rs1320189762 1440 dbSNP
rs574563819 1441 dbSNP
rs964460872 1444 dbSNP
rs1017775470 1446 dbSNP
rs1040033432 1449 dbSNP
rs1246881433 1452 dbSNP
rs941256785 1458 dbSNP
rs1383437775 1459 dbSNP
rs1466708129 1460 dbSNP
rs1308360105 1462 dbSNP
rs1389622214 1464 dbSNP
rs909733001 1466 dbSNP
rs1398302068 1468 dbSNP
rs1248528860 1470 dbSNP
rs1466106958 1473 dbSNP
rs1008542724 1477 dbSNP
rs1260740257 1478 dbSNP
rs1424685322 1484 dbSNP
rs186232331 1487 dbSNP
rs148141138 1489 dbSNP
rs1010472430 1494 dbSNP
rs927689477 1496 dbSNP
rs892090803 1499 dbSNP
rs570207221 1507 dbSNP
rs796857298 1516 dbSNP
rs1444641087 1519 dbSNP
rs13208719 1520 dbSNP
rs539456051 1530 dbSNP
rs969461439 1531 dbSNP
rs905906870 1541 dbSNP
rs1314353060 1547 dbSNP
rs1044893179 1553 dbSNP
rs916215992 1554 dbSNP
rs1421427370 1556 dbSNP
rs950051500 1560 dbSNP
rs1331192002 1561 dbSNP
rs992165224 1562 dbSNP
rs1213553109 1565 dbSNP
rs1259989035 1567 dbSNP
rs182194221 1571 dbSNP
rs1033166749 1586 dbSNP
rs1255620267 1589 dbSNP
rs1474933653 1590 dbSNP
rs547796845 1592 dbSNP
rs983455719 1595 dbSNP
rs998967914 1598 dbSNP
rs1294308338 1604 dbSNP
rs202217628 1608 dbSNP
rs1467866932 1610 dbSNP
rs1314359041 1614 dbSNP
rs1223507943 1622 dbSNP
rs1288504979 1625 dbSNP
rs71758926 1625 dbSNP
rs777160946 1625 dbSNP
rs1351787589 1627 dbSNP
rs1353007538 1627 dbSNP
rs1222021542 1643 dbSNP
rs967471895 1644 dbSNP
rs781355354 1646 dbSNP
rs973223971 1651 dbSNP
rs1284001098 1654 dbSNP
rs1029701537 1686 dbSNP
rs529555518 1691 dbSNP
rs987616282 1703 dbSNP
rs12529077 1723 dbSNP
rs376783870 1733 dbSNP
rs1177170376 1740 dbSNP
rs1020627371 1746 dbSNP
rs530075222 1748 dbSNP
rs537040840 1749 dbSNP
rs189909342 1750 dbSNP
rs1005903009 1752 dbSNP
rs1375218474 1753 dbSNP
rs1424922461 1755 dbSNP
rs776157311 1763 dbSNP
rs563848190 1776 dbSNP
rs768297349 1782 dbSNP
rs1439342930 1783 dbSNP
rs1359303423 1792 dbSNP
rs1368276309 1793 dbSNP
rs1220840737 1796 dbSNP
rs956240822 1801 dbSNP
rs888351440 1812 dbSNP
rs1156341173 1825 dbSNP
rs1000344557 1833 dbSNP
rs1229424601 1838 dbSNP
rs1046964859 1853 dbSNP
rs929791959 1855 dbSNP
rs1203980697 1861 dbSNP
rs1247337030 1866 dbSNP
rs1364941522 1868 dbSNP
rs141877517 1869 dbSNP
rs1394871677 1871 dbSNP
rs1479624782 1887 dbSNP
rs1271511687 1888 dbSNP
rs1200346450 1889 dbSNP
rs1421138406 1889 dbSNP
rs1044596883 1891 dbSNP
rs1014290612 1892 dbSNP
rs1488105513 1894 dbSNP
rs72961071 1895 dbSNP
rs1443081658 1897 dbSNP
rs1207028976 1898 dbSNP
rs1323741269 1899 dbSNP
rs560061682 1906 dbSNP
rs1047687525 1919 dbSNP
rs541446556 1931 dbSNP
rs185027349 1944 dbSNP
rs916251546 1947 dbSNP
rs920490167 1954 dbSNP
rs868608342 1956 dbSNP
rs1321085680 1958 dbSNP
rs1290755035 1962 dbSNP
rs758823679 1974 dbSNP
rs551394556 1977 dbSNP
rs1405142928 1986 dbSNP
rs1339500966 2003 dbSNP
rs943331758 2007 dbSNP
rs7453272 2008 dbSNP
rs386705657 2009 dbSNP
rs987358528 2024 dbSNP
rs1474258376 2025 dbSNP
rs954435714 2033 dbSNP
rs1413901459 2034 dbSNP
rs913660457 2037 dbSNP
rs556491863 2039 dbSNP
rs987766090 2046 dbSNP
rs1468722796 2048 dbSNP
rs1393709074 2058 dbSNP
rs957708445 2062 dbSNP
rs1320123832 2063 dbSNP
rs1033236292 2067 dbSNP
rs192739155 2071 dbSNP
rs765783825 2078 dbSNP
rs977599796 2079 dbSNP
rs967522826 2083 dbSNP
rs1477610258 2084 dbSNP
rs1029800592 2088 dbSNP
rs998694049 2096 dbSNP
rs1330473738 2098 dbSNP
rs964140312 2104 dbSNP
rs1018718302 2106 dbSNP
rs1447596106 2109 dbSNP
rs577069201 2113 dbSNP
rs1192026818 2115 dbSNP
rs1237652466 2124 dbSNP
rs1047822805 2125 dbSNP
rs1005548432 2127 dbSNP
rs888403640 2133 dbSNP
rs1185215847 2134 dbSNP
rs1416524710 2148 dbSNP
rs2144743 2157 dbSNP
rs1264744865 2161 dbSNP
rs1382516091 2165 dbSNP
rs1399857953 2169 dbSNP
rs539893746 2173 dbSNP
rs188570558 2178 dbSNP
rs906379076 2186 dbSNP
rs1292819895 2190 dbSNP
rs183787505 2191 dbSNP
rs910501245 2195 dbSNP
rs947819286 2198 dbSNP
rs1267981283 2201 dbSNP
rs138631051 2205 dbSNP
rs1201439017 2208 dbSNP
rs114222991 2212 dbSNP
rs936340734 2215 dbSNP
rs1208267369 2216 dbSNP
rs1256212701 2227 dbSNP
rs1472595801 2230 dbSNP
rs987901364 2244 dbSNP
rs923571402 2252 dbSNP
rs924922681 2253 dbSNP
rs977655249 2268 dbSNP
rs946276129 2272 dbSNP
rs1409006160 2290 dbSNP
rs1337795397 2309 dbSNP
rs922782651 2315 dbSNP
rs191265059 2323 dbSNP
rs145802147 2329 dbSNP
rs1433156856 2333 dbSNP
rs1417830527 2336 dbSNP
rs1371246435 2353 dbSNP
rs964509321 2359 dbSNP
rs1169821213 2360 dbSNP
rs1475880578 2361 dbSNP
rs980497363 2374 dbSNP
rs1335729906 2380 dbSNP
rs970681830 2383 dbSNP
rs1306169067 2392 dbSNP
rs149056296 2394 dbSNP
rs1231631848 2397 dbSNP
rs1279115571 2400 dbSNP
rs984164905 2404 dbSNP
rs1023221095 2406 dbSNP
rs1247766344 2410 dbSNP
rs538051998 2414 dbSNP
rs1194170913 2416 dbSNP
rs1244966571 2425 dbSNP
rs906053838 2431 dbSNP
rs1390963441 2432 dbSNP
rs1025623400 2433 dbSNP
rs1166296290 2434 dbSNP
rs994104449 2441 dbSNP
rs993526261 2461 dbSNP
rs1270651375 2468 dbSNP
rs1328436652 2479 dbSNP
rs1369283695 2481 dbSNP
rs1440568140 2483 dbSNP
rs577088870 2484 dbSNP
rs906432367 2489 dbSNP
rs1307753388 2497 dbSNP
rs770122981 2504 dbSNP
rs1229149653 2510 dbSNP
rs1249171334 2512 dbSNP
rs144971099 2525 dbSNP
rs375520263 2528 dbSNP
rs879067928 2540 dbSNP
rs1214245231 2542 dbSNP
rs1254767909 2543 dbSNP
rs1466983796 2544 dbSNP
rs1192823984 2557 dbSNP
rs1007564995 2569 dbSNP
rs1168534789 2574 dbSNP
rs368060637 2583 dbSNP
rs1372586895 2589 dbSNP
rs1458438826 2589 dbSNP
rs1313708390 2594 dbSNP
rs1243223802 2599 dbSNP
rs1392981852 2599 dbSNP
rs1321719896 2606 dbSNP
rs888991291 2614 dbSNP
rs1051698602 2620 dbSNP
rs933110381 2632 dbSNP
rs1384368635 2654 dbSNP
rs552003865 2665 dbSNP
rs370251409 2668 dbSNP
rs527418643 2669 dbSNP
rs1316276230 2670 dbSNP
rs1446724117 2672 dbSNP
rs1353075526 2674 dbSNP
rs761707758 2679 dbSNP
rs774283314 2683 dbSNP
rs1331334818 2684 dbSNP
rs1212980054 2685 dbSNP
rs188052709 2688 dbSNP
rs559972492 2689 dbSNP
rs1486686070 2705 dbSNP
rs1185035625 2706 dbSNP
rs925064914 2707 dbSNP
rs1410722552 2725 dbSNP
rs1390359247 2726 dbSNP
rs1190203989 2739 dbSNP
rs1161748621 2744 dbSNP
rs1415761808 2745 dbSNP
rs74879710 2753 dbSNP
rs75516688 2754 dbSNP
rs1160392006 2764 dbSNP
rs1452029147 2764 dbSNP
rs35311556 2764 dbSNP
rs397809561 2764 dbSNP
rs548212729 2769 dbSNP
rs936393076 2773 dbSNP
rs993029476 2775 dbSNP
rs35308535 2779 dbSNP
rs902204939 2783 dbSNP
rs1042015894 2789 dbSNP
rs768697885 2793 dbSNP
rs1232608548 2797 dbSNP
rs946328039 2815 dbSNP
rs972236160 2825 dbSNP
rs150323726 2835 dbSNP
rs1259901368 2837 dbSNP
rs1438035161 2838 dbSNP
rs963756560 2840 dbSNP
rs1290496043 2841 dbSNP
rs1219813562 2843 dbSNP
rs1016350585 2844 dbSNP
rs1178310446 2849 dbSNP
rs1410737472 2852 dbSNP
rs140255633 2856 dbSNP
rs749163162 2857 dbSNP
rs942885249 2862 dbSNP
rs1223683513 2865 dbSNP
rs1314258342 2867 dbSNP
rs911345234 2869 dbSNP
rs1446592578 2877 dbSNP
rs984217456 2881 dbSNP
rs1375499933 2885 dbSNP
rs952750184 2899 dbSNP
rs1306093378 2910 dbSNP
rs1281621788 2915 dbSNP
rs1052233632 2917 dbSNP
rs1236771083 2918 dbSNP
rs1025674488 2926 dbSNP
rs1301466662 2927 dbSNP
rs1205369585 2931 dbSNP
rs972717194 2933 dbSNP
rs373150102 2939 dbSNP
rs936520558 2943 dbSNP
rs1158166310 2962 dbSNP
rs775682946 2971 dbSNP
rs1044835372 2982 dbSNP
rs1455826093 2984 dbSNP
rs1175151127 2985 dbSNP
rs561318698 2986 dbSNP
rs894988169 2990 dbSNP
rs1032110985 2994 dbSNP
rs917566174 2995 dbSNP
rs1000593064 3004 dbSNP
rs1470355836 3006 dbSNP
rs991828612 3010 dbSNP
rs1267946347 3019 dbSNP
rs1196785890 3020 dbSNP
rs1442763226 3020 dbSNP
rs1490748854 3021 dbSNP
rs1275225981 3033 dbSNP
rs1347479045 3033 dbSNP
rs34759372 3033 dbSNP
rs1305774073 3041 dbSNP
rs1204479900 3049 dbSNP
rs577133492 3054 dbSNP
rs1254120456 3058 dbSNP
rs1268946467 3059 dbSNP
rs183850490 3063 dbSNP
rs1192201500 3067 dbSNP
rs71565642 3067 dbSNP
rs938926279 3067 dbSNP
rs1186685510 3069 dbSNP
rs1214523106 3071 dbSNP
rs1315651358 3072 dbSNP
rs540037861 3073 dbSNP
rs1462920129 3075 dbSNP
rs1323722965 3076 dbSNP
rs1330285274 3080 dbSNP
rs1286880413 3089 dbSNP
rs1224842537 3090 dbSNP
rs1323217684 3091 dbSNP
rs201704120 3092 dbSNP
rs1359983414 3094 dbSNP
rs368816556 3095 dbSNP
rs374333342 3099 dbSNP
rs370304312 3103 dbSNP
rs367747292 3107 dbSNP
rs1428804377 3108 dbSNP
rs1347050943 3111 dbSNP
rs1320148055 3112 dbSNP
rs139855229 3114 dbSNP
rs112539362 3115 dbSNP
rs1216099759 3115 dbSNP
rs142765007 3115 dbSNP
rs1447872886 3115 dbSNP
rs71024773 3115 dbSNP
rs1476179001 3116 dbSNP
rs1389788507 3118 dbSNP
rs200125572 3118 dbSNP
rs1401248912 3119 dbSNP
rs1343699418 3122 dbSNP
rs201333122 3122 dbSNP
rs1294047364 3123 dbSNP
rs1399629706 3123 dbSNP
rs28659826 3123 dbSNP
rs1231999761 3124 dbSNP
rs1351871194 3124 dbSNP
rs1428300592 3124 dbSNP
rs1256609313 3125 dbSNP
rs1189719891 3127 dbSNP
rs1207308330 3127 dbSNP
rs1484667035 3128 dbSNP
rs1444991156 3129 dbSNP
rs1481203583 3129 dbSNP
rs1279459189 3130 dbSNP
rs1486345241 3131 dbSNP
rs1185743897 3132 dbSNP
rs1367869765 3132 dbSNP
rs1470454474 3133 dbSNP
rs1160155031 3134 dbSNP
rs1277369696 3135 dbSNP
rs1349501136 3135 dbSNP
rs1405511103 3135 dbSNP
rs1429634790 3136 dbSNP
rs1412956384 3137 dbSNP
rs1185575042 3138 dbSNP
rs1336906909 3139 dbSNP
rs1241800236 3140 dbSNP
rs1278205419 3141 dbSNP
rs1484576045 3143 dbSNP
rs1353364802 3144 dbSNP
rs78741352 3150 dbSNP
rs1172132873 3153 dbSNP
rs1174518618 3153 dbSNP
rs1198270619 3153 dbSNP
rs1230969311 3153 dbSNP
rs1238980242 3153 dbSNP
rs1254870407 3153 dbSNP
rs1280540101 3153 dbSNP
rs1349572044 3153 dbSNP
rs1393658790 3153 dbSNP
rs1397166116 3153 dbSNP
rs1397283677 3153 dbSNP
rs1433054952 3153 dbSNP
rs1438387496 3153 dbSNP
rs1438804589 3153 dbSNP
rs1439083665 3153 dbSNP
rs1442163935 3153 dbSNP
rs71272311 3153 dbSNP
rs77662792 3153 dbSNP
rs1230597677 3154 dbSNP
rs1254921084 3154 dbSNP
rs1372811691 3154 dbSNP
rs1339400007 3156 dbSNP
rs1197519901 3157 dbSNP
rs1243370850 3160 dbSNP
rs1217086019 3177 dbSNP
rs193181834 3180 dbSNP
rs1194066482 3182 dbSNP
rs1254640917 3187 dbSNP
rs1431718238 3193 dbSNP
rs1261636187 3194 dbSNP
rs1373720528 3195 dbSNP
rs1225799704 3199 dbSNP
rs200797326 3200 dbSNP
rs146730347 3211 dbSNP
rs1295050346 3213 dbSNP
rs111954178 3217 dbSNP
rs902256138 3219 dbSNP
rs535851892 3224 dbSNP
rs1323530476 3231 dbSNP
rs764717204 3233 dbSNP
rs1460335996 3234 dbSNP
rs1364121257 3235 dbSNP
rs986219146 3237 dbSNP
rs368861113 3240 dbSNP
rs1369168986 3248 dbSNP
rs574445679 3252 dbSNP
rs1042069147 3254 dbSNP
rs1300121594 3256 dbSNP
rs556464512 3257 dbSNP
rs538117630 3260 dbSNP
rs1405333335 3264 dbSNP
rs901466562 3265 dbSNP
rs1470794168 3273 dbSNP
rs7449576 3274 dbSNP
rs942917129 3275 dbSNP
rs1430491426 3281 dbSNP
rs1030334434 3282 dbSNP
rs536308967 3286 dbSNP
rs781279908 3287 dbSNP
rs534125855 3293 dbSNP
rs956570621 3299 dbSNP
rs1457679857 3302 dbSNP
rs1186648282 3304 dbSNP
rs1444549737 3308 dbSNP
rs796545289 3309 dbSNP
rs544406035 3311 dbSNP
rs1339204049 3326 dbSNP
rs547933100 3329 dbSNP
rs1295007822 3331 dbSNP
rs970758269 3340 dbSNP
rs371970899 3349 dbSNP
rs917878290 3350 dbSNP
rs1214657427 3352 dbSNP
rs1309536693 3358 dbSNP
rs990766659 3361 dbSNP
rs1245418169 3363 dbSNP
rs529713403 3364 dbSNP
rs1045328596 3382 dbSNP
rs1011997822 3384 dbSNP
rs139986050 3388 dbSNP
rs146783006 3391 dbSNP
rs532482406 3395 dbSNP
rs1297436878 3396 dbSNP
rs919484478 3398 dbSNP
rs1295890486 3402 dbSNP
rs1414814628 3410 dbSNP
rs771072781 3411 dbSNP
rs1376971559 3415 dbSNP
rs142295340 3422 dbSNP
rs1307459813 3423 dbSNP
rs1318436770 3426 dbSNP
rs1020662892 3430 dbSNP
rs1238288443 3443 dbSNP
rs1285523439 3444 dbSNP
rs778094533 3450 dbSNP
rs1213158330 3460 dbSNP
rs942304803 3471 dbSNP
rs1168671098 3482 dbSNP
rs1423383349 3489 dbSNP
rs1178221985 3494 dbSNP
rs113105275 3501 dbSNP
rs986743232 3503 dbSNP
rs1156481478 3506 dbSNP
rs953435076 3510 dbSNP
rs1445807492 3521 dbSNP
rs1177679695 3525 dbSNP
rs1434944708 3525 dbSNP
rs572912516 3531 dbSNP
rs1175903793 3537 dbSNP
rs1298643833 3538 dbSNP
rs1039085706 3545 dbSNP
rs1007166405 3558 dbSNP
rs976057823 3568 dbSNP
rs756805539 3569 dbSNP
rs890029571 3573 dbSNP
rs1308217776 3584 dbSNP
rs1048627850 3593 dbSNP
rs1031038690 3596 dbSNP
rs1236751583 3598 dbSNP
rs1276602542 3604 dbSNP
rs1252038599 3608 dbSNP
rs546791138 3614 dbSNP
rs918722638 3630 dbSNP
rs1456806457 3636 dbSNP
rs1037127551 3637 dbSNP
rs1254007205 3645 dbSNP
rs949471659 3649 dbSNP
rs560639056 3652 dbSNP
rs1023461782 3657 dbSNP
rs991213848 3664 dbSNP
rs1422486912 3668 dbSNP
rs1341046797 3671 dbSNP
rs959349734 3675 dbSNP
rs1389528866 3676 dbSNP
rs541930417 3677 dbSNP
rs62437269 3678 dbSNP
rs966524321 3682 dbSNP
rs556175139 3693 dbSNP
rs1438881327 3695 dbSNP
rs997293267 3697 dbSNP
rs779434471 3700 dbSNP
rs758463310 3703 dbSNP
rs1215291706 3711 dbSNP
rs544180782 3714 dbSNP
rs755594640 3719 dbSNP
rs749888379 3729 dbSNP
rs1164986515 3730 dbSNP
rs1007629761 3732 dbSNP
rs767345692 3734 dbSNP
rs890081874 3735 dbSNP
rs1470076426 3740 dbSNP
rs1223350263 3743 dbSNP
rs577167156 3746 dbSNP
rs751452592 3755 dbSNP
rs1186663691 3756 dbSNP
rs995726672 3757 dbSNP
rs1157557152 3759 dbSNP
rs1476806460 3760 dbSNP
rs897342787 3761 dbSNP
rs1418344811 3764 dbSNP
rs763612145 3764 dbSNP
rs1491501213 3765 dbSNP
rs1037584834 3769 dbSNP
rs949523058 3771 dbSNP
rs558975689 3778 dbSNP
rs59717977 3782 dbSNP
rs888060839 3783 dbSNP
rs1431738405 3787 dbSNP
rs1300132390 3791 dbSNP
rs1198923740 3794 dbSNP
rs1218600054 3804 dbSNP
rs1294396598 3809 dbSNP
rs566903143 3814 dbSNP
rs969268804 3821 dbSNP
rs1227008860 3828 dbSNP
rs1289615888 3831 dbSNP
rs1450737181 3833 dbSNP
rs1215986684 3836 dbSNP
rs1055169149 3844 dbSNP
rs1489933486 3846 dbSNP
rs1264708924 3853 dbSNP
rs1486997602 3861 dbSNP
rs1192882517 3867 dbSNP
rs938014098 3871 dbSNP
rs925251879 3875 dbSNP
rs554668953 3892 dbSNP
rs932157552 3896 dbSNP
rs979330816 3901 dbSNP
rs945269982 3906 dbSNP
rs976153050 3907 dbSNP
rs560020173 3916 dbSNP
rs976308191 3919 dbSNP
rs1358729050 3924 dbSNP
rs923964185 3929 dbSNP
rs965857842 3936 dbSNP
rs979878055 3947 dbSNP
rs536319280 3953 dbSNP
rs1313528690 3966 dbSNP
rs879683190 3975 dbSNP
rs1342855577 3976 dbSNP
rs1017768858 3981 dbSNP
rs985859992 3984 dbSNP
rs763769842 3988 dbSNP
rs1240461153 4003 dbSNP
rs1236810101 4005 dbSNP
rs1027296134 4008 dbSNP
rs995779222 4011 dbSNP
rs1257597448 4018 dbSNP
rs568957168 4019 dbSNP
rs1185243837 4023 dbSNP
rs1236714161 4028 dbSNP
rs1470363200 4031 dbSNP
rs1180255903 4034 dbSNP
rs1198155358 4035 dbSNP
rs1343311902 4036 dbSNP
rs564359976 4042 dbSNP
rs1015796345 4052 dbSNP
rs993858308 4062 dbSNP
rs1413267211 4072 dbSNP
rs762771375 4079 dbSNP
rs1334034848 4082 dbSNP
rs1014165538 4087 dbSNP
rs1449526154 4101 dbSNP
rs550621946 4102 dbSNP
rs1287580141 4106 dbSNP
rs775315275 4117 dbSNP
rs6936813 4140 dbSNP
rs1256079799 4146 dbSNP
rs1346456596 4149 dbSNP
rs1005637908 4154 dbSNP
rs938068147 4158 dbSNP
rs888012929 4162 dbSNP
rs903880964 4168 dbSNP
rs571529187 4170 dbSNP
rs1479571533 4171 dbSNP
rs1236125241 4172 dbSNP
rs1431811432 4173 dbSNP
rs1199861288 4177 dbSNP
rs1439327901 4177 dbSNP
rs932250999 4192 dbSNP
rs1043688971 4193 dbSNP
rs1477052204 4194 dbSNP
rs1446445970 4196 dbSNP
rs1259773363 4197 dbSNP
rs945325392 4199 dbSNP
rs1172045104 4205 dbSNP
rs796500166 4206 dbSNP
rs1467637901 4207 dbSNP
rs6936621 4213 dbSNP
rs1399938258 4224 dbSNP
rs575713378 4243 dbSNP
rs935396723 4248 dbSNP
rs1332444411 4249 dbSNP
rs144262438 4250 dbSNP
rs979415139 4251 dbSNP
rs1318596005 4257 dbSNP
rs1321156446 4263 dbSNP
rs1200400610 4267 dbSNP
rs542399981 4268 dbSNP
rs117313363 4272 dbSNP
rs149591747 4275 dbSNP
rs1457119989 4276 dbSNP
rs946728524 4283 dbSNP
rs1269795049 4292 dbSNP
rs1233547849 4300 dbSNP
rs951754320 4308 dbSNP
rs140052741 4309 dbSNP
rs1424410498 4310 dbSNP
rs1479096418 4317 dbSNP
rs760394674 4326 dbSNP
rs1423384211 4335 dbSNP
rs1462340791 4345 dbSNP
rs776683408 4346 dbSNP
rs971713786 4351 dbSNP
rs563094546 4363 dbSNP
rs1392523687 4377 dbSNP
rs1384397967 4382 dbSNP
rs1384704999 4397 dbSNP
rs544237612 4399 dbSNP
rs577119958 4405 dbSNP
rs1220421925 4406 dbSNP
rs960636485 4408 dbSNP
rs559203285 4412 dbSNP
rs1016260342 4416 dbSNP
rs972575519 4423 dbSNP
rs1408780609 4425 dbSNP
rs1013801071 4426 dbSNP
rs1017113175 4427 dbSNP
rs1264035738 4427 dbSNP
rs1489284738 4427 dbSNP
rs1475230632 4428 dbSNP
rs1263155055 4441 dbSNP
rs1371381821 4443 dbSNP
rs1005188761 4444 dbSNP
rs188309797 4450 dbSNP
rs889436387 4455 dbSNP
rs961173297 4457 dbSNP
rs996427394 4468 dbSNP
rs1162233256 4472 dbSNP
rs902128657 4473 dbSNP
rs1248497158 4477 dbSNP
rs1401356311 4481 dbSNP
rs1295776562 4482 dbSNP
rs1033829252 4491 dbSNP
rs1339840410 4493 dbSNP
rs1396525051 4495 dbSNP
rs1314630812 4515 dbSNP
rs1040528826 4517 dbSNP
rs999694617 4527 dbSNP
rs1287069168 4539 dbSNP
rs1356084387 4542 dbSNP
rs902575246 4546 dbSNP
rs541909008 4556 dbSNP
rs1280507781 4562 dbSNP
rs1044213639 4564 dbSNP
rs1483870885 4568 dbSNP
rs946852174 4568 dbSNP
rs879698414 4570 dbSNP
rs1002267494 4572 dbSNP
rs573399805 4577 dbSNP
rs903933520 4581 dbSNP
rs1043742222 4583 dbSNP
rs1179630526 4585 dbSNP
rs554898922 4587 dbSNP
rs574418938 4588 dbSNP
rs1055089313 4594 dbSNP
rs6569482 4596 dbSNP
rs1451128822 4599 dbSNP
rs867855583 4600 dbSNP
rs927894483 4606 dbSNP
rs569018477 4611 dbSNP
rs1335328914 4616 dbSNP
rs1212893709 4620 dbSNP
rs772352910 4621 dbSNP
rs1254815311 4625 dbSNP
rs1483193109 4627 dbSNP
rs972501391 4635 dbSNP
rs961515051 4637 dbSNP
rs1441177503 4640 dbSNP
rs1176325369 4642 dbSNP
rs909745585 4643 dbSNP
rs1433314954 4645 dbSNP
rs541209941 4651 dbSNP
rs984257921 4652 dbSNP
rs557055215 4657 dbSNP
rs953858607 4661 dbSNP
rs1331803077 4662 dbSNP
rs1027982758 4663 dbSNP
rs1444877071 4675 dbSNP
rs1308732494 4677 dbSNP
rs748494974 4679 dbSNP
rs767996428 4680 dbSNP
rs1169872400 4682 dbSNP
rs577144889 4687 dbSNP
rs1219723798 4688 dbSNP
rs1260403533 4688 dbSNP
rs1384709981 4688 dbSNP
rs1456688102 4691 dbSNP
rs1198384650 4694 dbSNP
rs183511693 4709 dbSNP
rs755538834 4711 dbSNP
rs999672957 4712 dbSNP
rs558745685 4713 dbSNP
rs1480070182 4719 dbSNP
rs750012892 4724 dbSNP
rs1238966568 4727 dbSNP
rs962019759 4730 dbSNP
rs916892691 4731 dbSNP
rs1425530829 4739 dbSNP
rs1436858585 4745 dbSNP
rs1463917482 4763 dbSNP
rs1327908271 4765 dbSNP
rs1247899008 4767 dbSNP
rs1438861897 4774 dbSNP
rs1291875821 4794 dbSNP
rs1344891672 4795 dbSNP
rs1206873826 4801 dbSNP
rs992837897 4807 dbSNP
rs1043925149 4810 dbSNP
rs1290445512 4824 dbSNP
rs1316560827 4830 dbSNP
rs1218481917 4832 dbSNP
rs546889520 4842 dbSNP
rs895266458 4843 dbSNP
rs1359141699 4845 dbSNP
rs9285459 4854 dbSNP
rs10223649 4856 dbSNP
rs386705656 4857 dbSNP
rs1490028647 4858 dbSNP
rs1265302354 4860 dbSNP
rs1002321421 4861 dbSNP
rs927856849 4865 dbSNP
rs185269764 4884 dbSNP
rs1414180838 4890 dbSNP
rs530612477 4895 dbSNP
rs117349348 4902 dbSNP
rs1365060744 4904 dbSNP
rs909703791 4910 dbSNP
rs984003442 4913 dbSNP
rs1365001429 4919 dbSNP
rs1022340522 4920 dbSNP
rs1009573735 4921 dbSNP
rs182224151 4930 dbSNP
rs1163777061 4931 dbSNP
rs1289203680 4934 dbSNP
rs532557627 4940 dbSNP
rs565096603 4958 dbSNP
rs1009255407 4962 dbSNP
rs1287527906 4969 dbSNP
rs1487277413 4972 dbSNP
rs1230988444 4973 dbSNP
rs1237875592 4974 dbSNP
rs189712256 4975 dbSNP
rs1179880463 4976 dbSNP
rs1050287227 4978 dbSNP
rs1483203416 4982 dbSNP
rs375826838 4985 dbSNP
rs1160544342 4990 dbSNP
rs1358629792 4999 dbSNP
rs1219700254 5003 dbSNP
rs6930849 5004 dbSNP
rs1031373140 5006 dbSNP
rs965056818 5006 dbSNP
rs111381888 5007 dbSNP
rs1036124808 5011 dbSNP
rs1240352008 5012 dbSNP
rs543253416 5016 dbSNP
rs371878419 5017 dbSNP
rs992493066 5019 dbSNP
rs1204504691 5020 dbSNP
rs775259918 5022 dbSNP
rs557114364 5024 dbSNP
rs147516430 5029 dbSNP
rs143296199 5032 dbSNP
rs1180698521 5033 dbSNP
rs767192538 5038 dbSNP
rs6910763 5042 dbSNP
rs1003611637 5052 dbSNP
rs1173199367 5058 dbSNP
rs1405072254 5060 dbSNP
rs1324076151 5062 dbSNP
rs1336504331 5065 dbSNP
rs773592706 5070 dbSNP
rs1400079617 5072 dbSNP
rs187595046 5078 dbSNP
rs567492130 5079 dbSNP
rs939923419 5085 dbSNP
rs1022391354 5090 dbSNP
rs1472710499 5092 dbSNP
rs116252187 5098 dbSNP
rs1274911010 5099 dbSNP
rs1347052556 5110 dbSNP
rs762673485 5111 dbSNP
rs1221537307 5114 dbSNP
rs1262309294 5116 dbSNP
rs1196848737 5121 dbSNP
rs554620992 5128 dbSNP
rs1478696380 5130 dbSNP
rs1200278529 5141 dbSNP
rs536850251 5146 dbSNP
rs548796578 5151 dbSNP
rs569482869 5152 dbSNP
rs1199749713 5153 dbSNP
rs368163258 5170 dbSNP
rs770277042 5174 dbSNP
rs1270402048 5178 dbSNP
rs1379391041 5180 dbSNP
rs550673553 5194 dbSNP
rs976487894 5197 dbSNP
rs536774571 5201 dbSNP
rs889073328 5203 dbSNP
rs1467556865 5208 dbSNP
rs1028921261 5209 dbSNP
rs994726152 5210 dbSNP
rs1221180967 5218 dbSNP
rs899015990 5219 dbSNP
rs967331000 5220 dbSNP
rs1390402032 5221 dbSNP
rs1022548292 5229 dbSNP
rs565358525 5231 dbSNP
rs374496659 5239 dbSNP
rs1269718693 5245 dbSNP
rs990031546 5251 dbSNP
rs1282614374 5255 dbSNP
rs1318464190 5256 dbSNP
rs1386442780 5258 dbSNP
rs1249393472 5261 dbSNP
rs1322468302 5265 dbSNP
rs1210592162 5266 dbSNP
rs1457517976 5271 dbSNP
rs1405106082 5272 dbSNP
rs139389313 5273 dbSNP
rs1434585414 5276 dbSNP
rs1198763509 5280 dbSNP
rs940463763 5281 dbSNP
rs1264581555 5283 dbSNP
rs796154202 5284 dbSNP
rs1057240631 5286 dbSNP
rs1191969558 5286 dbSNP
rs1185487186 5292 dbSNP
rs1461198181 5292 dbSNP
rs1474711504 5293 dbSNP
rs1163427141 5296 dbSNP
rs1392401312 5300 dbSNP
rs1301980497 5304 dbSNP
rs1422255175 5304 dbSNP
rs1341116143 5306 dbSNP
rs1250375211 5307 dbSNP
rs1401708268 5308 dbSNP
rs1189789535 5310 dbSNP
rs1461111416 5311 dbSNP
rs1261700055 5312 dbSNP
rs868562765 5314 dbSNP
rs1245832431 5316 dbSNP
rs1267509944 5318 dbSNP
rs1003580336 5324 dbSNP
rs1212477270 5325 dbSNP
rs1256770456 5326 dbSNP
rs1032748866 5328 dbSNP
rs1001710094 5330 dbSNP
rs1185245673 5332 dbSNP
rs906003340 5336 dbSNP
rs1272363676 5339 dbSNP
rs1046328844 5340 dbSNP
rs1162396549 5342 dbSNP
rs1178552972 5342 dbSNP
rs1213703348 5342 dbSNP
rs1218548053 5342 dbSNP
rs1241618362 5342 dbSNP
rs1245432764 5342 dbSNP
rs1287001318 5342 dbSNP
rs1310115734 5342 dbSNP
rs1314608291 5342 dbSNP
rs1355883014 5342 dbSNP
rs1360535440 5342 dbSNP
rs1380931137 5342 dbSNP
rs1384135431 5342 dbSNP
rs1396430730 5342 dbSNP
rs1421479240 5342 dbSNP
rs1424804996 5342 dbSNP
rs1442375427 5342 dbSNP
rs58621326 5342 dbSNP
rs747239127 5342 dbSNP
rs748898980 5342 dbSNP
rs775055654 5342 dbSNP
rs778038526 5342 dbSNP
rs937025640 5342 dbSNP
rs1182557512 5344 dbSNP
rs1459706814 5344 dbSNP
rs1367452918 5345 dbSNP
rs926928684 5345 dbSNP
rs1299663270 5346 dbSNP
rs981003745 5348 dbSNP
rs946948309 5349 dbSNP
rs777012442 5356 dbSNP
rs1156274897 5361 dbSNP
rs866604369 5367 dbSNP
rs1363223350 5368 dbSNP
rs1381731038 5368 dbSNP
rs866187964 5368 dbSNP
rs915435074 5371 dbSNP
rs80202151 5372 dbSNP
rs869307817 5373 dbSNP
rs1300913400 5374 dbSNP
rs906659507 5375 dbSNP
rs112751657 5378 dbSNP
rs1452219901 5378 dbSNP
rs531473809 5378 dbSNP
rs768975431 5378 dbSNP
rs1379352538 5380 dbSNP
rs1467247998 5380 dbSNP
rs1359452069 5388 dbSNP
rs1169317856 5389 dbSNP
rs796304918 5397 dbSNP
rs1235987621 5399 dbSNP
rs957042952 5407 dbSNP
rs1261698630 5408 dbSNP
rs528476588 5413 dbSNP
rs370884041 5416 dbSNP
rs1391506892 5417 dbSNP
rs1169743239 5420 dbSNP
rs1238451130 5426 dbSNP
rs1444609201 5433 dbSNP
rs1019029929 5435 dbSNP
rs987923682 5437 dbSNP
rs953371119 5440 dbSNP
rs1028973517 5447 dbSNP
rs1048317498 5452 dbSNP
rs994777814 5463 dbSNP
rs1427087465 5465 dbSNP
rs1469137701 5468 dbSNP
rs899068212 5472 dbSNP
rs1184023922 5474 dbSNP
rs1356549887 5485 dbSNP
rs1014800078 5493 dbSNP
rs1440217144 5495 dbSNP
rs765150421 5506 dbSNP
rs1368349658 5512 dbSNP
rs543316614 5530 dbSNP
rs1232457378 5531 dbSNP
rs895600001 5548 dbSNP
rs1056890153 5551 dbSNP
rs1344354503 5553 dbSNP
rs1281990134 5577 dbSNP
rs1323417883 5581 dbSNP
rs1219705110 5583 dbSNP
rs1275493582 5585 dbSNP
rs1260383190 5590 dbSNP
rs1201924068 5592 dbSNP
rs1308909432 5592 dbSNP
rs1229025742 5594 dbSNP
rs1488549678 5611 dbSNP
rs575926414 5615 dbSNP
rs1266763790 5616 dbSNP
rs1310305015 5617 dbSNP
rs899650942 5635 dbSNP
rs1421298395 5638 dbSNP
rs563906953 5644 dbSNP
rs905556180 5648 dbSNP
rs1042688190 5651 dbSNP
rs1350667330 5654 dbSNP
rs1426672458 5664 dbSNP
rs943763012 5670 dbSNP
rs947000628 5677 dbSNP
rs915487439 5681 dbSNP
rs1272295385 5683 dbSNP
rs1214325843 5696 dbSNP
rs1452299497 5696 dbSNP
rs988756952 5698 dbSNP
rs935518845 5699 dbSNP
rs912017307 5704 dbSNP
rs987590206 5720 dbSNP
rs977452933 5721 dbSNP
rs947092512 5723 dbSNP
rs1217195207 5728 dbSNP
rs1243659496 5728 dbSNP
rs953423606 5728 dbSNP
rs921955254 5729 dbSNP
rs1161765414 5738 dbSNP
rs545564810 5747 dbSNP
rs989729526 5748 dbSNP
rs973393532 5755 dbSNP
rs1420870835 5758 dbSNP
rs963329118 5762 dbSNP
rs1014846097 5763 dbSNP
rs1005173330 5769 dbSNP
rs1430545355 5772 dbSNP
rs1367306879 5773 dbSNP
rs1167540258 5778 dbSNP
rs141603140 5782 dbSNP
rs1247628703 5803 dbSNP
rs1407752126 5816 dbSNP
rs182042093 5817 dbSNP
rs780251973 5819 dbSNP
rs1035909252 5829 dbSNP
rs147983151 5834 dbSNP
rs905608279 5843 dbSNP
rs1004589587 5848 dbSNP
rs1221927751 5853 dbSNP
rs1445209286 5865 dbSNP
rs545589768 5875 dbSNP
rs372944702 5878 dbSNP
rs1011196151 5883 dbSNP
rs1462829621 5887 dbSNP
rs1246929776 5901 dbSNP
rs891425846 5901 dbSNP
rs1181937663 5902 dbSNP
rs1322060687 5905 dbSNP
rs1306078144 5909 dbSNP
rs1440440293 5911 dbSNP
rs10457490 5921 dbSNP
rs536909350 5922 dbSNP
rs143479491 5929 dbSNP
rs1308108445 5939 dbSNP
rs912085856 5945 dbSNP
rs1040866690 5950 dbSNP
rs866799978 5956 dbSNP
rs1454264582 5958 dbSNP
rs1052350487 5968 dbSNP
rs1381550055 5976 dbSNP
rs1387974376 5979 dbSNP
rs770964841 5982 dbSNP
rs1280776979 5987 dbSNP
rs760706585 5988 dbSNP
rs1295756618 5989 dbSNP
rs1223077336 5995 dbSNP
rs1263565568 5996 dbSNP
rs1325360920 5997 dbSNP
rs1008068095 6011 dbSNP
rs922009009 6013 dbSNP
rs36000432 6014 dbSNP
rs772271677 6015 dbSNP
rs1231176280 6021 dbSNP
rs148856151 6024 dbSNP
rs1173619917 6029 dbSNP
rs1432057362 6037 dbSNP
rs1468610095 6038 dbSNP
rs1176159849 6042 dbSNP
rs1404981008 6049 dbSNP
rs370111297 6057 dbSNP
rs1412888121 6064 dbSNP
rs947148589 6069 dbSNP
rs1333438835 6080 dbSNP
rs1441421164 6086 dbSNP
rs186863156 6094 dbSNP
rs1347315799 6097 dbSNP
rs1035560052 6098 dbSNP
rs1001317596 6099 dbSNP
rs1340325036 6105 dbSNP
rs914239991 6110 dbSNP
rs969822162 6118 dbSNP
rs573425621 6129 dbSNP
rs1437363876 6140 dbSNP
rs1021335052 6145 dbSNP
rs1055420481 6156 dbSNP
rs1479737543 6163 dbSNP
rs6904520 6165 dbSNP
rs1259919945 6168 dbSNP
rs1462207172 6176 dbSNP
rs1169237660 6178 dbSNP
rs1393850853 6182 dbSNP
rs1408929910 6184 dbSNP
rs982219823 6187 dbSNP
rs1402948097 6192 dbSNP
rs970880551 6197 dbSNP
rs1206662555 6202 dbSNP
rs891476968 6203 dbSNP
rs549383678 6206 dbSNP
rs1053178748 6207 dbSNP
rs774766532 6210 dbSNP
rs952948851 6211 dbSNP
rs531262213 6215 dbSNP
rs1328813695 6217 dbSNP
rs1302832400 6226 dbSNP
rs1387845067 6230 dbSNP
rs890693611 6232 dbSNP
rs1222347562 6247 dbSNP
rs1319134674 6255 dbSNP
rs1430716950 6258 dbSNP
rs1191477571 6264 dbSNP
rs755292499 6276 dbSNP
rs769336825 6283 dbSNP
rs1163669849 6286 dbSNP
rs1366846712 6288 dbSNP
rs1422690226 6302 dbSNP
rs1302522792 6316 dbSNP
rs963918523 6328 dbSNP
rs1383777113 6332 dbSNP
rs1315948918 6333 dbSNP
rs530667513 6346 dbSNP
rs1246907796 6350 dbSNP
rs1389869930 6357 dbSNP
rs1317291546 6358 dbSNP
rs1357312898 6359 dbSNP
rs1245312312 6364 dbSNP
rs1261868789 6364 dbSNP
rs753690724 6366 dbSNP
rs1203768249 6367 dbSNP
rs1008035457 6377 dbSNP
rs1464185439 6394 dbSNP
rs903003351 6395 dbSNP
rs563972016 6405 dbSNP
rs907894656 6418 dbSNP
rs545319701 6424 dbSNP
rs1364371254 6426 dbSNP
rs533530124 6440 dbSNP
rs756853601 6447 dbSNP
rs1199748168 6450 dbSNP
rs1433702190 6453 dbSNP
rs746473513 6461 dbSNP
rs1383924296 6462 dbSNP
rs892883594 6468 dbSNP
rs1055347392 6478 dbSNP
rs1380820644 6484 dbSNP
rs1452078474 6488 dbSNP
rs937024477 6490 dbSNP
rs1319253390 6493 dbSNP
rs1237461063 6498 dbSNP
rs777291477 6501 dbSNP
rs1205934729 6506 dbSNP
rs1244663651 6514 dbSNP
rs1046616061 6516 dbSNP
rs1180788380 6525 dbSNP
rs1250534804 6532 dbSNP
rs949690276 6533 dbSNP
rs559183861 6541 dbSNP
rs553746211 6544 dbSNP
rs563314764 6545 dbSNP
rs1466053908 6548 dbSNP
rs1268569282 6556 dbSNP
rs952794568 6561 dbSNP
rs1342509791 6565 dbSNP
rs573315151 6566 dbSNP
rs975388944 6580 dbSNP
rs146719129 6582 dbSNP
rs1325360590 6586 dbSNP
rs1375555750 6590 dbSNP
rs1389721229 6596 dbSNP
rs1295983143 6598 dbSNP
rs1019656155 6606 dbSNP
rs1225799873 6608 dbSNP
rs986713256 6612 dbSNP
rs1437941628 6620 dbSNP
rs181448814 6622 dbSNP
rs1251410883 6633 dbSNP