miRTarBase - #MIRT000878 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MCL1   
Synonyms BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT
Description MCL1, BCL2 family apoptosis regulator
Transcript NM_021960   
Other Transcripts NM_182763   
Expression
Putative miRNA Targets on MCL1
3'UTR of MCL1
(miRNA target sites are highlighted)
>MCL1|NM_021960|3'UTR
   1 CCTTACTGTAAGTGCAATAGTTGACTTTTAACCAACCACCACCACCACCAAAACCAGTTTATGCAGTTGGACTCCAAGCT
  81 GTAACTTCCTAGAGTTGCACCCTAGCAACCTAGCCAGAAAAGCAAGTGGCAAGAGGATTATGGCTAACAAGAATAAATAC
 161 ATGGGAAGAGTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTG
 241 TTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAG
 321 GAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCA
 401 CTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCT
 481 TTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTG
 561 GCTTGGTTTCCATGATTCTTACTTTATTAGCCTAGTTTATCACCAATAATACTTGACGGAAGGCTCAGTAATTAGTTATG
 641 AATATGGATATCCTCAATTCTTAAGACAGCTTGTAAATGTATTTGTAAAAATTGTATATATTTTTACAGAAAGTCTATTT
 721 CTTTGAAACGAAGGAAGTATCGAATTTACATTAGTTTTTTTCATACCCTTTTGAACTTTGCAACTTCCGTAATTAGGAAC
 801 CTGTTTCTTACAGCTTTTCTATGCTAAACTTTGTTCTGTTCAGTTCTAGAGTGTATACAGAACGAATTGATGTGTAACTG
 881 TATGCAGACTGGTTGTAGTGGAACAAATCTGATAACTATGCAGGTTTAAATTTTCTTATCTGATTTTGGTAAGTATTCCT
 961 TAGATAGGTTTTTCTTTGAAAACCTGGGATTGAGAGGTTGATGAATGGAAATTCTTTCACTTCATTATATGCAAGTTTTC
1041 AATAATTAGGTCTAAGTGGAGTTTTAAGGTTACTGATGACTTACAAATAATGGGCTCTGATTGGGCAATACTCATTTGAG
1121 TTCCTTCCATTTGACCTAATTTAACTGGTGAAATTTAAAGTGAATTCATGGGCTCATCTTTAAAGCTTTTACTAAAAGAT
1201 TTTCAGCTGAATGGAACTCATTAGCTGTGTGCATATAAAAAGATCACATCAGGTGGATGGAGAGACATTTGATCCCTTGT
1281 TTGCTTAATAAATTATAAAATGATGGCTTGGAAAAGCAGGCTAGTCTAACCATGGTGCTATTATTAGGCTTGCTTGTTAC
1361 ACACACAGGTCTAAGCCTAGTATGTCAATAAAGCAAATACTTACTGTTTTGTTTCTATTAATGATTCCCAAACCTTGTTG
1441 CAAGTTTTTGCATTGGCATCTTTGGATTTCAGTCTTGATGTTTGTTCTATCAGACTTAACCTTTTATTTCCTGTCCTTCC
1521 TTGAAATTGCTGATTGTTCTGCTCCCTCTACAGATATTTATATCAATTCCTACAGCTTTCCCCTGCCATCCCTGAACTCT
1601 TTCTAGCCCTTTTAGATTTTGGCACTGTGAAACCCCTGCTGGAAACCTGAGTGACCCTCCCTCCCCACCAAGAGTCCACA
1681 GACCTTTCATCTTTCACGAACTTGATCCTGTTAGCAGGTGGTAATACCATGGGTGCTGTGACACTAACAGTCATTGAGAG
1761 GTGGGAGGAAGTCCCTTTTCCTTGGACTGGTATCTTTTCAACTATTGTTTTATCCTGTCTTTGGGGGCAATGTGTCAAAA
1841 GTCCCCTCAGGAATTTTCAGAGGAAAGAACATTTTATGAGGCTTTCTCTAAAGTTTCCTTTGTATAGGAGTATGCTCACT
1921 TAAATTTACAGAAAGAGGTGAGCTGTGTTAAACCTCAGAGTTTAAAAGCTACTGATAAACTGAAGAAAGTGTCTATATTG
2001 GAACTAGGGTCATTTGAAAGCTTCAGTCTCGGAACATGACCTTTAGTCTGTGGACTCCATTTAAAAATAGGTATGAATAA
2081 GATGACTAAGAATGTAATGGGGAAGAACTGCCCTGCCTGCCCATCTCAGAGCCATAAGGTCATCTTTGCTAGAGCTATTT
2161 TTACCTATGTATTTATCGTTCTTGATCATAAGCCGCTTATTTATATCATGTATCTCTAAGGACCTAAAAGCACTTTATGT
2241 AGTTTTTAATTAATCTTAAGATCTGGTTACGGTAACTAAAAAAGCCTGTCTGCCAAATCCAGTGGAAACAAGTGCATAGA
2321 TGTGAATTGGTTTTTAGGGGCCCCACTTCCCAATTCATTAGGTATGACTGTGGAAATACAGACAAGGATCTTAGTTGATA
2401 TTTTGGGCTTGGGGCAGTGAGGGCTTAGGACACCCCAAGTGGTTTGGGAAAGGAGGAGGGGAGTGGTGGGTTTATAGGGG
2481 GAGGAGGAGGCAGGTGGTCTAAGTGCTGACTGGCTACGTAGTTCGGGCAAATCCTCCAAAAGGGAAAGGGAGGATTTGCT
2561 TAGAAGGATGGCGCTCCCAGTGACTACTTTTTGACTTCTGTTTGTCTTACGCTTCTCTCAGGGAAAAACATGCAGTCCTC
2641 TAGTGTTTCATGTACATTCTGTGGGGGGTGAACACCTTGGTTCTGGTTAAACAGCTGTACTTTTGATAGCTGTGCCAGGA
2721 AGGGTTAGGACCAACTACAAATTAATGTTGGTTGTCAAATGTAGTGTGTTTCCCTAACTTTCTGTTTTTCCTGAGAAAAA
2801 AAAATAAATCTTTTATTCAAATACAGGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAU--ACACGACGAu 5'
             |||::: |:  ||| ||||| 
Target 5' ttgAAATTGCTGATTGTTCTGCTc 3'
1521 - 1544 129.00 -8.00
2
miRNA  3' guGUUUGGUA-AUACACGAC-GAu 5'
            ||::: :| || |||||| || 
Target 5' ggCAGGTGGTCTAAGTGCTGACTg 3'
2489 - 2512 128.00 -12.30
3
miRNA  3' guGUU-UGGUAAUACACGACGau 5'
            :|| |||| |: ||||||:  
Target 5' ggTAATACCA-TGGGTGCTGTga 3'
1720 - 1741 127.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15719619 12 COSMIC
COSN30503441 22 COSMIC
COSN19205666 53 COSMIC
COSN30189641 60 COSMIC
COSN31482088 66 COSMIC
COSN31512252 74 COSMIC
COSN26983960 79 COSMIC
COSN17159063 88 COSMIC
COSN8319677 99 COSMIC
COSN17151760 101 COSMIC
COSN13468327 107 COSMIC
COSN26983962 130 COSMIC
COSN26983961 131 COSMIC
COSN31502687 131 COSMIC
COSN32050047 145 COSMIC
COSN26983959 164 COSMIC
COSN31572461 176 COSMIC
COSN31554093 213 COSMIC
COSN30108134 245 COSMIC
COSN31769400 263 COSMIC
COSN30539072 441 COSMIC
COSN7177051 508 COSMIC
COSN24219896 537 COSMIC
COSN27358256 540 COSMIC
COSN31569236 564 COSMIC
COSN4900754 579 COSMIC
COSN4743875 697 COSMIC
COSN15720117 712 COSMIC
COSN31555441 725 COSMIC
COSN31533596 800 COSMIC
COSN21642722 915 COSMIC
COSN16353252 938 COSMIC
COSN20095347 960 COSMIC
COSN31486356 1019 COSMIC
COSN15776706 1123 COSMIC
COSN31515005 1133 COSMIC
COSN7177049 1238 COSMIC
COSN31513567 1247 COSMIC
COSN25557428 1286 COSMIC
COSN26561995 1358 COSMIC
COSN26351498 1368 COSMIC
COSN31539413 1368 COSMIC
COSN31546146 2102 COSMIC
COSN28735785 2104 COSMIC
COSN31769396 2123 COSMIC
COSN24219895 2383 COSMIC
COSN27958399 2597 COSMIC
COSN30175175 2619 COSMIC
COSN15367460 2686 COSMIC
COSN21460699 2788 COSMIC
COSN22775405 2791 COSMIC
rs34355066 325 GWAS
rs878471 2104 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1292349960 1 dbSNP
rs148874038 2 dbSNP
rs756583252 6 dbSNP
rs1282568624 9 dbSNP
rs1006737391 17 dbSNP
rs1447559895 19 dbSNP
rs200971785 21 dbSNP
rs764320835 23 dbSNP
rs1398488491 25 dbSNP
rs761136566 29 dbSNP
rs752831607 31 dbSNP
rs767628417 38 dbSNP
rs775760925 38 dbSNP
rs1427179365 41 dbSNP
rs148777636 51 dbSNP
rs34100999 51 dbSNP
rs370323092 51 dbSNP
rs755159122 51 dbSNP
rs1410972323 56 dbSNP
rs587649103 63 dbSNP
rs1042976493 66 dbSNP
rs1193266369 73 dbSNP
rs184099170 75 dbSNP
rs750615476 79 dbSNP
rs1187173132 83 dbSNP
rs1418825609 87 dbSNP
rs1408719924 90 dbSNP
rs1057212417 100 dbSNP
rs587696105 104 dbSNP
rs200590372 108 dbSNP
rs754272361 108 dbSNP
rs767651113 109 dbSNP
rs938732842 114 dbSNP
rs3841831 115 dbSNP
rs776912740 120 dbSNP
rs927416475 122 dbSNP
rs1430897430 129 dbSNP
rs1482631874 133 dbSNP
rs587618423 151 dbSNP
rs1359167302 155 dbSNP
rs1235091931 157 dbSNP
rs947052836 158 dbSNP
rs1333942657 159 dbSNP
rs912873227 161 dbSNP
rs980654943 167 dbSNP
rs942201431 172 dbSNP
rs1448972280 175 dbSNP
rs1194091315 176 dbSNP
rs1205052886 187 dbSNP
rs1476856228 202 dbSNP
rs587760732 210 dbSNP
rs1323721112 213 dbSNP
rs1419168635 213 dbSNP
rs983739832 217 dbSNP
rs951024572 232 dbSNP
rs988974605 233 dbSNP
rs192106468 234 dbSNP
rs34664576 237 dbSNP
rs369449181 237 dbSNP
rs1328046496 238 dbSNP
rs1317145588 239 dbSNP
rs1342947001 240 dbSNP
rs1416067732 240 dbSNP
rs775595778 245 dbSNP
rs1354730625 250 dbSNP
rs1231319475 263 dbSNP
rs34896634 266 dbSNP
rs1380518711 267 dbSNP
rs587745463 272 dbSNP
rs587597923 276 dbSNP
rs760153527 276 dbSNP
rs1487369881 282 dbSNP
rs1213098153 289 dbSNP
rs1018040703 291 dbSNP
rs774285339 298 dbSNP
rs1485637388 303 dbSNP
rs1185962495 305 dbSNP
rs1365943820 306 dbSNP
rs888457964 306 dbSNP
rs1470688499 309 dbSNP
rs762914760 310 dbSNP
rs1436106954 312 dbSNP
rs1312975995 315 dbSNP
rs968548970 317 dbSNP
rs1025562693 318 dbSNP
rs587683059 321 dbSNP
rs773069035 322 dbSNP
rs34355066 325 dbSNP
rs1399757105 329 dbSNP
rs1336184401 334 dbSNP
rs762962988 346 dbSNP
rs1166431044 350 dbSNP
rs895890737 350 dbSNP
rs747963232 362 dbSNP
rs74124936 363 dbSNP
rs905670084 364 dbSNP
rs1485364047 365 dbSNP
rs1057434930 366 dbSNP
rs1002896056 372 dbSNP
rs947252336 383 dbSNP
rs1181519233 384 dbSNP
rs1236668501 385 dbSNP
rs1455308605 386 dbSNP
rs587701070 386 dbSNP
rs912905047 393 dbSNP
rs587619526 394 dbSNP
rs748880490 399 dbSNP
rs1169615332 416 dbSNP
rs1397125967 419 dbSNP
rs1390666991 420 dbSNP
rs988487568 421 dbSNP
rs933095867 424 dbSNP
rs1478941020 432 dbSNP
rs923027312 432 dbSNP
rs1347308535 433 dbSNP
rs587734066 434 dbSNP
rs1253655793 437 dbSNP
rs1340697507 439 dbSNP
rs587658622 441 dbSNP
rs1193752321 447 dbSNP
rs1195662637 449 dbSNP
rs1256592447 455 dbSNP
rs1470064869 462 dbSNP
rs974876805 469 dbSNP
rs1251621686 474 dbSNP
rs1044516271 476 dbSNP
rs1431014403 481 dbSNP
rs1194684103 483 dbSNP
rs942168832 484 dbSNP
rs1240668283 485 dbSNP
rs909420519 487 dbSNP
rs984342387 489 dbSNP
rs587602041 491 dbSNP
rs1025631460 493 dbSNP
rs781700317 493 dbSNP
rs1326876622 494 dbSNP
rs769307146 495 dbSNP
rs745392352 504 dbSNP
rs587704688 506 dbSNP
rs1380408650 507 dbSNP
rs976799382 509 dbSNP
rs895910187 513 dbSNP
rs965096325 516 dbSNP
rs1317094920 518 dbSNP
rs1453457689 526 dbSNP
rs1035796553 527 dbSNP
rs1376303389 528 dbSNP
rs1206461446 531 dbSNP
rs1261859117 537 dbSNP
rs1427360554 543 dbSNP
rs910948027 548 dbSNP
rs587651106 552 dbSNP
rs985208441 554 dbSNP
rs1001994935 556 dbSNP
rs905702630 561 dbSNP
rs74586841 562 dbSNP
rs1290801902 581 dbSNP
rs1397519222 585 dbSNP
rs1021372832 586 dbSNP
rs1276932716 596 dbSNP
rs776287888 601 dbSNP
rs1357898600 603 dbSNP
rs1011534960 604 dbSNP
rs891704614 606 dbSNP
rs955936338 607 dbSNP
rs2737825 610 dbSNP
rs770494791 617 dbSNP
rs145589907 618 dbSNP
rs1260926762 623 dbSNP
rs933020913 626 dbSNP
rs1213820844 628 dbSNP
rs587640787 635 dbSNP
rs774728206 638 dbSNP
rs1003275247 639 dbSNP
rs1485961240 639 dbSNP
rs1038792068 640 dbSNP
rs1420630019 648 dbSNP
rs905898606 652 dbSNP
rs1364591445 655 dbSNP
rs587755230 657 dbSNP
rs1296441090 662 dbSNP
rs911432702 663 dbSNP
rs1415974691 665 dbSNP
rs984244238 667 dbSNP
rs1044873409 669 dbSNP
rs1006270309 670 dbSNP
rs1352510890 678 dbSNP
rs1250804563 682 dbSNP
rs1208960786 685 dbSNP
rs1357087106 695 dbSNP
rs887869962 696 dbSNP
rs1047896561 697 dbSNP
rs773958859 698 dbSNP
rs1209393303 700 dbSNP
rs758444438 701 dbSNP
rs1352924962 713 dbSNP
rs1235632400 717 dbSNP
rs186964898 717 dbSNP
rs2737826 722 dbSNP
rs1177552530 727 dbSNP
rs587693298 729 dbSNP
rs587642479 730 dbSNP
rs587764964 731 dbSNP
rs1157045188 734 dbSNP
rs1396994490 735 dbSNP
rs910927699 737 dbSNP
rs1176026338 738 dbSNP
rs970127587 741 dbSNP
rs775088934 745 dbSNP
rs1444886970 749 dbSNP
rs143379465 750 dbSNP
rs985092758 752 dbSNP
rs1444151608 753 dbSNP
rs1367899095 755 dbSNP
rs1371142076 756 dbSNP
rs1011397263 761 dbSNP
rs1276483614 762 dbSNP
rs755381292 762 dbSNP
rs1053057607 766 dbSNP
rs997810674 788 dbSNP
rs914343984 789 dbSNP
rs587711087 791 dbSNP
rs1255090352 793 dbSNP
rs955929495 795 dbSNP
rs116763104 796 dbSNP
rs1039110190 797 dbSNP
rs1423081957 798 dbSNP
rs943154746 799 dbSNP
rs908950866 801 dbSNP
rs746161484 811 dbSNP
rs1036010238 819 dbSNP
rs1400087752 821 dbSNP
rs780453278 823 dbSNP
rs1464361781 824 dbSNP
rs970383321 825 dbSNP
rs756166995 829 dbSNP
rs775407769 833 dbSNP
rs587655920 836 dbSNP
rs1156235914 837 dbSNP
rs1272574290 846 dbSNP
rs1363404835 847 dbSNP
rs1215114720 850 dbSNP
rs768440046 857 dbSNP
rs1364007110 858 dbSNP
rs1198325723 860 dbSNP
rs918720548 860 dbSNP
rs587758171 863 dbSNP
rs1489788850 864 dbSNP
rs587713527 867 dbSNP
rs750477615 878 dbSNP
rs887837372 879 dbSNP
rs1245077663 882 dbSNP
rs1026425062 883 dbSNP
rs960529938 909 dbSNP
rs993651725 911 dbSNP
rs1477077915 914 dbSNP
rs1167566461 915 dbSNP
rs941144676 919 dbSNP
rs1404432728 920 dbSNP
rs1321124819 923 dbSNP
rs769484322 930 dbSNP
rs1346507489 931 dbSNP
rs1041022603 936 dbSNP
rs200885702 939 dbSNP
rs980086429 946 dbSNP
rs1235000667 955 dbSNP
rs374572012 958 dbSNP
rs371616046 959 dbSNP
rs199586359 960 dbSNP
rs869227088 961 dbSNP
rs145243728 963 dbSNP
rs113912701 964 dbSNP
rs3065111 964 dbSNP
rs58090782 964 dbSNP
rs1287952188 973 dbSNP
rs1021737381 979 dbSNP
rs1217413278 980 dbSNP
rs1262491032 987 dbSNP
rs1190642382 993 dbSNP
rs1282077959 993 dbSNP
rs1369436224 995 dbSNP
rs1472664255 1002 dbSNP
rs1161140469 1004 dbSNP
rs1225525083 1016 dbSNP
rs943592135 1020 dbSNP
rs1274450430 1023 dbSNP
rs889372515 1024 dbSNP
rs1221971999 1025 dbSNP
rs1049363256 1027 dbSNP
rs587633503 1030 dbSNP
rs947080733 1034 dbSNP
rs955908006 1038 dbSNP
rs867946616 1041 dbSNP
rs1445534419 1048 dbSNP
rs34035628 1058 dbSNP
rs767707916 1066 dbSNP
rs1353122681 1071 dbSNP
rs1241054516 1072 dbSNP
rs1285435147 1075 dbSNP
rs1399788560 1078 dbSNP
rs1213707790 1080 dbSNP
rs1257445101 1080 dbSNP
rs1442275890 1081 dbSNP
rs1185852665 1082 dbSNP
rs1234902322 1084 dbSNP
rs1343891299 1084 dbSNP
rs914311424 1086 dbSNP
rs1157635051 1087 dbSNP
rs1320921391 1087 dbSNP
rs988555679 1093 dbSNP
rs1436006990 1096 dbSNP
rs1173154882 1099 dbSNP
rs934487328 1103 dbSNP
rs183559867 1104 dbSNP
rs190045126 1110 dbSNP
rs981689777 1111 dbSNP
rs969971940 1113 dbSNP
rs1336083483 1114 dbSNP
rs1479229047 1116 dbSNP
rs1430978025 1119 dbSNP
rs1199802680 1127 dbSNP
rs1474992758 1129 dbSNP
rs1022906171 1132 dbSNP
rs781531097 1136 dbSNP
rs984771424 1136 dbSNP
rs1236585764 1139 dbSNP
rs1217910976 1140 dbSNP
rs757541863 1142 dbSNP
rs1257160042 1150 dbSNP
rs1344940450 1153 dbSNP
rs1199177880 1160 dbSNP
rs1275590882 1162 dbSNP
rs1458458474 1164 dbSNP
rs1235972488 1169 dbSNP
rs1447629460 1169 dbSNP
rs1455238385 1174 dbSNP
rs1198966809 1177 dbSNP
rs1026392933 1184 dbSNP
rs139951222 1187 dbSNP
rs1802505 1188 dbSNP
rs868565095 1189 dbSNP
rs866785989 1191 dbSNP
rs1331014491 1198 dbSNP
rs1218397797 1207 dbSNP
rs901926337 1212 dbSNP
rs1388683075 1216 dbSNP
rs1302078042 1220 dbSNP
rs1019076056 1229 dbSNP
rs1001346754 1233 dbSNP
rs1272401468 1233 dbSNP
rs1432048153 1238 dbSNP
rs897323469 1249 dbSNP
rs1340431669 1260 dbSNP
rs1801298 1272 dbSNP
rs1335408419 1283 dbSNP
rs748026354 1284 dbSNP
rs763951743 1289 dbSNP
rs1407824704 1296 dbSNP
rs1266078131 1297 dbSNP
rs1430925658 1299 dbSNP
rs1176790497 1302 dbSNP
rs1424246567 1310 dbSNP
rs889358840 1316 dbSNP
rs1409119273 1317 dbSNP
rs587724088 1318 dbSNP
rs938980567 1319 dbSNP
rs1168293536 1320 dbSNP
rs1419674992 1322 dbSNP
rs1459669359 1326 dbSNP
rs762874897 1333 dbSNP
rs1043986201 1336 dbSNP
rs1390172132 1337 dbSNP
rs1385151061 1339 dbSNP
rs928862115 1340 dbSNP
rs1341694225 1344 dbSNP
rs1218490927 1345 dbSNP
rs980326528 1347 dbSNP
rs948713641 1349 dbSNP
rs1245127381 1352 dbSNP
rs1487259226 1356 dbSNP
rs947048119 1356 dbSNP
rs990238414 1364 dbSNP
rs35900369 1369 dbSNP
rs1052722318 1371 dbSNP
rs1191367337 1376 dbSNP
rs1259384903 1385 dbSNP
rs1242465302 1391 dbSNP
rs966010852 1392 dbSNP
rs1462759628 1396 dbSNP
rs1456530180 1398 dbSNP
rs934393359 1399 dbSNP
rs1204140908 1400 dbSNP
rs1361200080 1401 dbSNP
rs1306104962 1402 dbSNP
rs587599693 1402 dbSNP
rs1381845044 1404 dbSNP
rs41305052 1407 dbSNP
rs1045546748 1413 dbSNP
rs887450820 1414 dbSNP
rs780819753 1415 dbSNP
rs1464042467 1417 dbSNP
rs948582433 1421 dbSNP
rs1241788936 1430 dbSNP
rs1359275121 1437 dbSNP
rs1313624526 1446 dbSNP
rs915815863 1448 dbSNP
rs199960497 1450 dbSNP
rs1027236835 1453 dbSNP
rs1384411043 1453 dbSNP
rs199858277 1453 dbSNP
rs984738874 1456 dbSNP
rs993300523 1461 dbSNP
rs1483487357 1479 dbSNP
rs1181079503 1481 dbSNP
rs952021469 1485 dbSNP
rs1336951428 1494 dbSNP
rs1422315065 1499 dbSNP
rs765101383 1502 dbSNP
rs1352437722 1503 dbSNP
rs1037225944 1506 dbSNP
rs1419135893 1511 dbSNP
rs1361397101 1512 dbSNP
rs1466954452 1515 dbSNP
rs1302644795 1522 dbSNP
rs972481279 1526 dbSNP
rs938868340 1529 dbSNP
rs1375571238 1535 dbSNP
rs749275603 1535 dbSNP
rs1280053322 1536 dbSNP
rs966124333 1536 dbSNP
rs1254048678 1537 dbSNP
rs1384522440 1538 dbSNP
rs1044677373 1540 dbSNP
rs1019473337 1541 dbSNP
rs1051373 1543 dbSNP
rs1200799089 1545 dbSNP
rs1446488294 1546 dbSNP
rs1239014262 1547 dbSNP
rs769502746 1548 dbSNP
rs1007714788 1550 dbSNP
rs948912289 1553 dbSNP
rs1243877445 1556 dbSNP
rs953583260 1556 dbSNP
rs1176876451 1561 dbSNP
rs1022502274 1562 dbSNP
rs1427281879 1565 dbSNP
rs1176720346 1566 dbSNP
rs1434287722 1576 dbSNP
rs1479742699 1577 dbSNP
rs914617941 1579 dbSNP
rs1205644488 1580 dbSNP
rs990144063 1591 dbSNP
rs1011074989 1592 dbSNP
rs34164836 1597 dbSNP
rs1444033722 1601 dbSNP
rs1276136742 1608 dbSNP
rs1490307048 1626 dbSNP
rs759019033 1653 dbSNP
rs1248858792 1654 dbSNP
rs1299061241 1655 dbSNP
rs185535988 1657 dbSNP
rs1360817657 1662 dbSNP
rs924669292 1662 dbSNP
rs587598540 1664 dbSNP
rs906932161 1674 dbSNP
rs1202649957 1675 dbSNP
rs1248552184 1680 dbSNP
rs1488836234 1686 dbSNP
rs1017355736 1692 dbSNP
rs1370653503 1694 dbSNP
rs1045917761 1710 dbSNP
rs1479054659 1714 dbSNP
rs756724089 1719 dbSNP
rs1423306942 1726 dbSNP
rs1410205347 1728 dbSNP
rs986012651 1732 dbSNP
rs1350000378 1733 dbSNP
rs776000116 1742 dbSNP
rs1291772318 1745 dbSNP
rs951960639 1748 dbSNP
rs1301194343 1753 dbSNP
rs948572958 1761 dbSNP
rs1219099033 1771 dbSNP
rs1277368196 1777 dbSNP
rs1315786323 1780 dbSNP
rs1213080911 1786 dbSNP
rs1027310244 1796 dbSNP
rs1322475295 1797 dbSNP
rs1220913738 1800 dbSNP
rs770530379 1801 dbSNP
rs1489573720 1803 dbSNP
rs1048925634 1811 dbSNP
rs180679633 1812 dbSNP
rs961713066 1815 dbSNP
rs1164698699 1819 dbSNP
rs1385789757 1822 dbSNP
rs1035195899 1824 dbSNP
rs1162098989 1830 dbSNP
rs1158405602 1834 dbSNP
rs905608104 1846 dbSNP
rs907374226 1856 dbSNP
rs1410431849 1867 dbSNP
rs771982125 1870 dbSNP
rs1480300013 1872 dbSNP
rs1044583094 1881 dbSNP
rs1267146524 1883 dbSNP
rs930510353 1884 dbSNP
rs77328195 1885 dbSNP
rs893382714 1891 dbSNP
rs1289710640 1892 dbSNP
rs1355920976 1899 dbSNP
rs189748465 1906 dbSNP
rs1285920227 1911 dbSNP
rs35392872 1913 dbSNP
rs924604969 1916 dbSNP
rs1472280836 1918 dbSNP
rs1181322415 1930 dbSNP
rs911974039 1931 dbSNP
rs1214447109 1934 dbSNP
rs1419741255 1939 dbSNP
rs587713214 1943 dbSNP
rs1308658618 1945 dbSNP
rs587678342 1950 dbSNP
rs1170552026 1952 dbSNP
rs1416044795 1953 dbSNP
rs1334602656 1957 dbSNP
rs1281064151 1965 dbSNP
rs1406559036 1967 dbSNP
rs768964965 1973 dbSNP
rs1011043790 1978 dbSNP
rs587770746 1981 dbSNP
rs1313149796 1982 dbSNP
rs1451680321 1987 dbSNP
rs956930157 1991 dbSNP
rs1031695058 1992 dbSNP
rs985918906 2005 dbSNP
rs1202663484 2018 dbSNP
rs1279814046 2022 dbSNP
rs35176837 2024 dbSNP
rs373089781 2026 dbSNP
rs113945232 2027 dbSNP
rs770200959 2028 dbSNP
rs1481002751 2031 dbSNP
rs1261639799 2037 dbSNP
rs1334576510 2039 dbSNP
rs1478979800 2041 dbSNP
rs906895954 2044 dbSNP
rs753072919 2046 dbSNP
rs11549748 2047 dbSNP
rs971977954 2050 dbSNP
rs1045483324 2052 dbSNP
rs962022949 2055 dbSNP
rs1484595950 2060 dbSNP
rs1261921741 2063 dbSNP
rs1335038453 2064 dbSNP
rs587615689 2064 dbSNP
rs1322323136 2066 dbSNP
rs587756927 2072 dbSNP
rs894234830 2079 dbSNP
rs969120018 2080 dbSNP
rs1023169716 2082 dbSNP
rs1331509629 2088 dbSNP
rs1344837658 2091 dbSNP
rs587684292 2095 dbSNP
rs878471 2104 dbSNP
rs1380405568 2109 dbSNP
rs1457939669 2110 dbSNP
rs930479277 2113 dbSNP
rs1247861357 2115 dbSNP
rs1452800573 2116 dbSNP
rs1321222350 2120 dbSNP
rs1479381911 2123 dbSNP
rs893283022 2145 dbSNP
rs1469370606 2148 dbSNP
rs1466359428 2150 dbSNP
rs1404173222 2153 dbSNP
rs1178939056 2155 dbSNP
rs1466847772 2164 dbSNP
rs1324852668 2173 dbSNP
rs1372918585 2174 dbSNP
rs1403570461 2189 dbSNP
rs199815201 2190 dbSNP
rs1319007092 2191 dbSNP
rs1430772641 2199 dbSNP
rs200484447 2201 dbSNP
rs1036723903 2202 dbSNP
rs1357921316 2205 dbSNP
rs1209926333 2219 dbSNP
rs1460539547 2221 dbSNP
rs1240847149 2229 dbSNP
rs587675454 2232 dbSNP
rs903184066 2233 dbSNP
rs1345304713 2243 dbSNP
rs1040372059 2251 dbSNP
rs1170095173 2251 dbSNP
rs944723879 2252 dbSNP
rs587632369 2254 dbSNP
rs986157154 2257 dbSNP
rs932039435 2259 dbSNP
rs1423346995 2261 dbSNP
rs915346401 2265 dbSNP
rs587734531 2266 dbSNP
rs587679425 2267 dbSNP
rs587602461 2273 dbSNP
rs961985764 2274 dbSNP
rs375137223 2275 dbSNP
rs1380731127 2279 dbSNP
rs34659089 2280 dbSNP
rs927656022 2282 dbSNP
rs982810065 2284 dbSNP
rs1396777116 2285 dbSNP
rs981789190 2289 dbSNP
rs969152527 2296 dbSNP
rs1286648055 2297 dbSNP
rs1396081985 2299 dbSNP
rs1184579907 2305 dbSNP
rs1023406200 2312 dbSNP
rs989198768 2313 dbSNP
rs1166450017 2316 dbSNP
rs957531979 2325 dbSNP
rs1463903119 2335 dbSNP
rs1422813734 2342 dbSNP
rs35351880 2345 dbSNP
rs758210233 2349 dbSNP
rs1391321649 2351 dbSNP
rs758430062 2352 dbSNP
rs1024354219 2353 dbSNP
rs1453590850 2360 dbSNP
rs35609481 2369 dbSNP
rs397844453 2369 dbSNP
rs35150036 2371 dbSNP
rs1396301607 2378 dbSNP
rs894205339 2383 dbSNP
rs1027427799 2388 dbSNP
rs1241666710 2389 dbSNP
rs1382796331 2390 dbSNP
rs1019391623 2391 dbSNP
rs587607080 2397 dbSNP
rs994667164 2403 dbSNP
rs1189052601 2406 dbSNP
rs1257566691 2409 dbSNP
rs1483435625 2411 dbSNP
rs1008834641 2422 dbSNP
rs1442565909 2424 dbSNP
rs1249394401 2427 dbSNP
rs1242741421 2430 dbSNP
rs1442942838 2440 dbSNP
rs1180591970 2455 dbSNP
rs897694347 2456 dbSNP
rs1036203981 2458 dbSNP
rs1157528303 2459 dbSNP
rs1379775709 2470 dbSNP
rs1466872192 2473 dbSNP
rs182383007 2474 dbSNP
rs1448453494 2477 dbSNP
rs1331482151 2481 dbSNP
rs1371927680 2487 dbSNP
rs1481532851 2489 dbSNP
rs930690609 2493 dbSNP
rs1303309099 2497 dbSNP
rs899034752 2502 dbSNP
rs890392214 2503 dbSNP
rs765448623 2513 dbSNP
rs759377888 2514 dbSNP
rs1176054465 2520 dbSNP
rs915314010 2520 dbSNP
rs1427596179 2521 dbSNP
rs1466885294 2521 dbSNP
rs989558208 2526 dbSNP
rs1353483393 2538 dbSNP
rs1439374849 2559 dbSNP
rs2737827 2568 dbSNP
rs935498669 2569 dbSNP
rs1404215278 2576 dbSNP
rs1327180593 2578 dbSNP
rs1281167837 2580 dbSNP
rs1319708151 2582 dbSNP
rs587666563 2590 dbSNP
rs765841176 2594 dbSNP
rs1273972213 2596 dbSNP
rs1383036899 2598 dbSNP
rs1202541686 2602 dbSNP
rs11850 2604 dbSNP
rs1490666337 2606 dbSNP
rs587738041 2606 dbSNP
rs1033630338 2607 dbSNP
rs968058800 2607 dbSNP
rs1164426344 2609 dbSNP
rs1418362404 2610 dbSNP
rs13677 2611 dbSNP
rs1407786830 2611 dbSNP
rs1023906569 2614 dbSNP
rs1019212361 2616 dbSNP
rs771722861 2619 dbSNP
rs1472875502 2622 dbSNP
rs1009069990 2624 dbSNP
rs587631294 2625 dbSNP
rs587763507 2628 dbSNP
rs1473440020 2629 dbSNP
rs78625781 2633 dbSNP
rs1292150409 2635 dbSNP
rs1221507603 2638 dbSNP
rs11549747 2644 dbSNP
rs899233424 2645 dbSNP
rs1222456770 2649 dbSNP
rs1290198064 2652 dbSNP
rs1489522765 2653 dbSNP
rs1036627235 2658 dbSNP
rs1293876363 2661 dbSNP
rs940551229 2664 dbSNP
rs1183215712 2666 dbSNP
rs1385357315 2670 dbSNP
rs10206 2671 dbSNP
rs1443473150 2686 dbSNP
rs897582969 2691 dbSNP
rs1420160990 2699 dbSNP
rs1350095219 2701 dbSNP
rs1317417397 2712 dbSNP
rs1343169933 2713 dbSNP
rs1015142685 2718 dbSNP
rs1383709885 2719 dbSNP
rs1245350623 2725 dbSNP
rs1312927968 2729 dbSNP
rs1008749260 2730 dbSNP
rs890352368 2732 dbSNP
rs1206185856 2734 dbSNP
rs1284067734 2736 dbSNP
rs1445606137 2743 dbSNP
rs36123358 2755 dbSNP
rs947915498 2760 dbSNP
rs916290226 2761 dbSNP
rs1241390432 2763 dbSNP
rs1351366686 2764 dbSNP
rs1282960907 2766 dbSNP
rs587767833 2768 dbSNP
rs1381584082 2770 dbSNP
rs893846645 2777 dbSNP
rs936447757 2779 dbSNP
rs754763165 2780 dbSNP
rs1405574288 2789 dbSNP
rs1415960036 2790 dbSNP
rs1337080078 2791 dbSNP
rs1407115465 2791 dbSNP
rs1053717294 2792 dbSNP
rs935379041 2793 dbSNP
rs746333411 2794 dbSNP
rs912021679 2797 dbSNP
rs1156330061 2801 dbSNP
rs1221309835 2801 dbSNP
rs1349054923 2801 dbSNP
rs1264072841 2805 dbSNP
rs781738829 2806 dbSNP
rs1473318030 2809 dbSNP
rs3178056 2811 dbSNP
rs1201335075 2816 dbSNP
rs3178057 2818 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*