miRTarBase - #MIRT000888 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PDCD6IP   
Synonyms AIP1, ALIX, DRIP4, HP95
Description programmed cell death 6 interacting protein
Transcript NM_001162429   
Other Transcripts NM_013374   
Expression
Putative miRNA Targets on PDCD6IP
3'UTR of PDCD6IP
(miRNA target sites are highlighted)
>PDCD6IP|NM_001162429|3'UTR
   1 TATGTCTGCTCAGCAGCTCAGCTGATTCAGATCAGAGGGAAAGAAATACCAACCCTGCAATAAGTGTACTAAACTCTACG
  81 CTCTGGTTAATGTAATGTACTCTCCTGGACTGAATGCAGTGTATAATTTCTGTCTACAGCTAGAAGCTGTGCCCCAGTTC
 161 CACATTTGATTACACATGTGAGATTTGCTGCTGTTGCAGTATAAACACTAGGTATAATAGGATTTGAAATTGCATTACAG
 241 TTCATAAAAATTGAAAATGAGAAATTAAACCTGCAAGTGAAACATTTGAAACGATTATACTTTCTACATAAGACATGGTT
 321 GGGACATCAGATACTTACAAAGATGGTTTAAGTATGGATACTAGAGAAAATTAAGTTTTCTTTCTCTTTGGTTTATTGAT
 401 TTGGTTTAATTTCCATTATGCTATTTTGCATAATCAAGGCACTGTAAATCTTATAATTTTAAAATAAATTACTTAAGAAC
 481 AGTTGTCATTGTTATGTTTTGTTATTGATTCTCATTACTGTCTAATTTTTTTTCTGGTATTAGTCTCATTTTGTATGTAT
 561 ATAAGTTAAACAGATACTGTTTTTAAGTGCATGAATAGTACAAGTTATTATCAAGGATGTTTTACAGGGAAATCAAAAGA
 641 ATATTATCATACTTTATCTTTCGTATGCTGATTAGTAAACGATTTTTGACATTTATTTTAGAAAGTCCTATAATGTGGAA
 721 GAAACAAACAGTTGCTACCAAAGATTCTTCAAATAAACATACAAATAAATGTGTATATTTAATGTTTTATTGTTAGCTTC
 801 TCCAGAAAATTGATGCAAATTCTGGTAATAATTCTTGCATTTTTTCCCCATAACCTGGTTAAAATAAATACGCCATTGGC
 881 AATACTTCATAATGTAATGGAATTGTTTGGGGAACACTTACTGTACCCTCTCATCCTTTTTCCACCTTACTGTGTTAACT
 961 TAGTGACATTTAATGCCCAATATGTATGAATAGATCTAAGCCATTTAATTTTTTTTCCTTAAAGATTGGAGTATTTTATA
1041 ATTCAAGGAGCATACAAAACAATGGTTGGGAACATATGCCAATTATGGAATAGGCTATGTATTTAATATTAATCTCTGCC
1121 ATTAGGATATCTACTCACTGTATAAACCTCAGTAAAAATAGTGAAGACATGCATCATGGAATGAGAAAATGAGAAAGGAA
1201 TGAGTTGTCTAACATCACAGTGGGATCTGTTTTTTGTGAGGTTCATTTCTGAACACATTAGGCATATGAGCAGATTTCCA
1281 GTGAATCTATTTATGTTTATTTTCTGAGTTTCAACGCTGACCTTTTCTTGCATTATTGTTTCATTTTAATGATAGTGTTA
1361 CTTGTCCCACTGTTGTTTTCATTGAGTTTGGATTTATATTTTAAATGTTCGAATGAAAGTATGATTGTAAAAGGGAGTGA
1441 ATTGGTTTAAAAATATATGTATATTTTAAACTTTGTTGTGTGTAGGAAACATGAAGGCATGTTAATTCAATATAAATGAC
1521 CTTTGATTTCATGGAATATTAAAGTTGGTTTAAAGTCCAATAGTTAAACCTTAGCAAAAATAGCTTTTTACTTCATCAGT
1601 TGCTAAGATTTAATACTTTGGATTCATCAAAGTGTGACATGGGCTTGTTTGACTTCTGTAAGTGGCATTTAAGTTCCACA
1681 TTCTTATTACTTGAGGTACTTTATACTAACATAAGACAGTGAGAGTTAGAGGTATTACAAGTTGCTAGTTTATAATGTCT
1761 TACTAATGCAGAAACAAGGAAAAAAGCAAAATTGGCCTGAATATTCTCTTGGGGAAAGAGGGCACCAAAGAAAAGGGTAA
1841 GTGCATCTGAGGGCCAAAAGAGATGTATAAGCCTTTTAGCCCATTCCCCATGCTGGGCCTGCTCACAGAGCCACAGGAAG
1921 ATCATTCAGAAACTAGGAAAGGAGGCCCCCACAGCTGATCCTGCCACAGCACACCTGACTCACTCGGCTCTGTTAGTGTA
2001 ACCTTTTAAATGTAGCAACACAAACCCTTTCCCTCTTGTCAGTTCACTCATCCTTTGGTTTCTTTTTAATCACCTGTGTC
2081 TGGGCACAGACAATCACAATAAATGCAGCCCTTTATTACTGTTAAGGATCATACTGTTGGTTTGGAGTTGGAAGGGTACT
2161 ACTCTGTGATTCAGGTGTGTTGTACCCATATTTATAATTAGGCTTTATTATCTTCCTAAATCAAGGAAAGGAAATCATCC
2241 CCAGACCATTTATGCTGAGCTTTGGAATACTATTTTAAACTGGATTGTACTTAAATAATGAAGCTCTGCATAGAGGAACT
2321 AGTCAGAAGTGGGGAAAACACTGTCTAATTTTTATCAGTCTGGTATAAAGTATTGATCTAAGAGAACTCTCCCTGTGCCC
2401 CTTGGTCTTTATTCTCAATTAAGAAAAACAGTCACATGTCACGACAAACCAATCAATCTTTATGAGATATTCCTGTATCC
2481 ATACCCCAGCTTGTTTGCAATTTATAAACCTCCCCTTCAAAACTAAGGAGTTGCAGAAAAAAATGGATTTCACAGAGCCT
2561 TGTGTCCCTAAAGTTCTGTCCCAGTCAGCAGTCTTTATAGTCCAAACAGATTATAAAAAATGTTTTCCATTTGAACTTTA
2641 CAGTTTGCAAAAGTGCTTTTATACATTTTCTAATTTCAGAAACAGGATAATTTGTTAAGTGGGTTTCAGTTTGCTAATAG
2721 GGATTTTTTGTGTTTTGTTTTTTAATTTTCAGCATCTCTTGAAGAATCTTGCTACAGCCAAATGGCATCTCACTTTTTAA
2801 AGACGTTTGCAATTATTAGTTGATTCACAGTACAGAACAAGGTATAAAGGAAAAAACCCTGCTAGGTAGTGTTATAATTG
2881 CTAGATTAAAAATAGACTAGAACAGGTTCATTTTAAGATTTACTTGGAAGAGCAAAGAAGGAAAAATTATATTTTTAAAG
2961 AAAGAGAATATTCAGGCTTTATTTCTGGTATGAAGTTTATATTTTTTAAAAAAATCCTATATTATCACACCAGAGATTTT
3041 AGATTCTTTTCTGGTTAGAAACATTGCTGGTAGTTGGATTATATTTTTATTGTATTCATTTATCTTAGGGGGAACATTGT
3121 AAAGAAACAAAAAGGTCCAGATGAATGTATGCTAGAAATAAAAGTTGAAAGATTCTTACTTCAAAAAAAAAAAAAAAAAA
3201 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUG-GUA-A---UACACGACGAu 5'
               || ||| |   || ||||||| 
Target 5' tgattACACATGTGAGATTTGCTGCTg 3'
167 - 193 149.00 -14.72
2
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            ||:|||||| | |||||   
Target 5' ccCAGACCATT-TATGCTGagc 3'
2240 - 2260 135.00 -16.32
3
miRNA  3' guguuUGGUAA-UACACGACGAu 5'
               |:| || :| ||||| | 
Target 5' actttATCTTTCGTATGCTGATt 3'
651 - 673 121.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30481436 54 COSMIC
COSN26988342 56 COSMIC
COSN31597739 67 COSMIC
COSN30529334 79 COSMIC
COSN30149684 103 COSMIC
COSN30160685 235 COSMIC
COSN1946986 295 COSMIC
COSN6766167 361 COSMIC
COSN7606440 436 COSMIC
COSN15298360 440 COSMIC
COSN23232645 596 COSMIC
COSN1946987 1069 COSMIC
COSN27115349 1184 COSMIC
COSN22979116 1305 COSMIC
COSN20120212 1356 COSMIC
COSN5534949 1938 COSMIC
COSN21137226 1957 COSMIC
COSN15791738 1979 COSMIC
COSN15950686 2459 COSMIC
COSN16718753 2603 COSMIC
COSN20098276 2692 COSMIC
COSN1946988 2960 COSMIC
COSN25263773 3010 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1483819180 1 dbSNP
rs1277623537 3 dbSNP
rs141799309 4 dbSNP
rs1299760921 5 dbSNP
rs765467966 6 dbSNP
rs1296079342 8 dbSNP
rs750462456 12 dbSNP
rs758473513 13 dbSNP
rs780046470 19 dbSNP
rs748102640 34 dbSNP
rs1241272260 38 dbSNP
rs1280276394 41 dbSNP
rs878947421 42 dbSNP
rs368403170 43 dbSNP
rs370893220 50 dbSNP
rs543981115 53 dbSNP
rs1002534579 59 dbSNP
rs1288700775 62 dbSNP
rs1232184410 78 dbSNP
rs1055767213 80 dbSNP
rs1254487481 81 dbSNP
rs1312425257 82 dbSNP
rs894461763 84 dbSNP
rs1157345250 89 dbSNP
rs182744565 90 dbSNP
rs1413221802 91 dbSNP
rs755772927 92 dbSNP
rs951492398 97 dbSNP
rs1254941375 105 dbSNP
rs1186326891 107 dbSNP
rs1004307453 116 dbSNP
rs1280074175 120 dbSNP
rs1257477510 123 dbSNP
rs1203344330 124 dbSNP
rs1328368679 137 dbSNP
rs1268575830 139 dbSNP
rs150580224 143 dbSNP
rs1045442207 150 dbSNP
rs906642683 153 dbSNP
rs541882247 165 dbSNP
rs1268601799 166 dbSNP
rs1448947080 174 dbSNP
rs1003607708 178 dbSNP
rs1316285250 186 dbSNP
rs1400678350 192 dbSNP
rs559992773 194 dbSNP
rs186651872 197 dbSNP
rs976077776 199 dbSNP
rs1161895429 206 dbSNP
rs921565220 213 dbSNP
rs957939191 239 dbSNP
rs1162312829 241 dbSNP
rs139477012 249 dbSNP
rs543587988 262 dbSNP
rs563466281 262 dbSNP
rs1170823405 265 dbSNP
rs112852494 266 dbSNP
rs1017190090 272 dbSNP
rs143160830 274 dbSNP
rs1332421093 278 dbSNP
rs765989731 293 dbSNP
rs1229124935 295 dbSNP
rs981902947 309 dbSNP
rs550089266 311 dbSNP
rs114780240 314 dbSNP
rs1368134616 319 dbSNP
rs1434444813 320 dbSNP
rs1365945264 324 dbSNP
rs1323139949 332 dbSNP
rs1439288573 334 dbSNP
rs535690498 337 dbSNP
rs547831693 340 dbSNP
rs529228629 342 dbSNP
rs532435958 345 dbSNP
rs753510156 346 dbSNP
rs566083826 353 dbSNP
rs1405639998 355 dbSNP
rs1415505908 361 dbSNP
rs1165712480 364 dbSNP
rs1448365708 372 dbSNP
rs879283477 396 dbSNP
rs552244526 404 dbSNP
rs1342662808 415 dbSNP
rs937895526 419 dbSNP
rs1055451414 424 dbSNP
rs1277716903 431 dbSNP
rs539448145 436 dbSNP
rs947950489 438 dbSNP
rs3211001 451 dbSNP
rs1045093840 455 dbSNP
rs927946625 460 dbSNP
rs1223780660 462 dbSNP
rs1342998955 469 dbSNP
rs777349574 474 dbSNP
rs1299848634 475 dbSNP
rs34845135 479 dbSNP
rs1266583931 490 dbSNP
rs1232800658 493 dbSNP
rs1367482565 495 dbSNP
rs1294557422 496 dbSNP
rs1439038699 497 dbSNP
rs1488414367 518 dbSNP
rs1305803673 526 dbSNP
rs1428663653 527 dbSNP
rs1208483290 548 dbSNP
rs1370658860 556 dbSNP
rs191459037 558 dbSNP
rs931298526 562 dbSNP
rs939449248 566 dbSNP
rs1478637035 571 dbSNP
rs1424357187 572 dbSNP
rs1431434765 572 dbSNP
rs1193917734 579 dbSNP
rs1047187825 580 dbSNP
rs1478888523 581 dbSNP
rs1426223007 585 dbSNP
rs1166236365 586 dbSNP
rs887153297 596 dbSNP
rs1005740335 599 dbSNP
rs1038917994 605 dbSNP
rs1208818234 610 dbSNP
rs1312181659 612 dbSNP
rs371422120 626 dbSNP
rs1301104057 633 dbSNP
rs1362209176 637 dbSNP
rs1221371679 640 dbSNP
rs557761503 645 dbSNP
rs746561081 646 dbSNP
rs1277815353 648 dbSNP
rs1048394098 653 dbSNP
rs1230126848 663 dbSNP
rs184725696 664 dbSNP
rs997488940 666 dbSNP
rs1176740689 671 dbSNP
rs1416048020 672 dbSNP
rs1028656986 673 dbSNP
rs1181146262 673 dbSNP
rs954371605 676 dbSNP
rs1321687654 678 dbSNP
rs1004254841 681 dbSNP
rs1019746128 682 dbSNP
rs190621191 691 dbSNP
rs77748793 701 dbSNP
rs1028974011 703 dbSNP
rs958329402 721 dbSNP
rs956630895 722 dbSNP
rs989356934 727 dbSNP
rs915038348 728 dbSNP
rs989124067 745 dbSNP
rs1020635337 749 dbSNP
rs1377833887 751 dbSNP
rs1302891053 753 dbSNP
rs776770124 763 dbSNP
rs752188391 772 dbSNP
rs966416029 776 dbSNP
rs1158228045 794 dbSNP
rs1413840511 804 dbSNP
rs193140169 806 dbSNP
rs1161578881 817 dbSNP
rs1413820440 824 dbSNP
rs981086908 826 dbSNP
rs1423416122 829 dbSNP
rs1257012236 838 dbSNP
rs1382029025 839 dbSNP
rs765087416 840 dbSNP
rs541667119 846 dbSNP
rs1047073951 851 dbSNP
rs879220848 855 dbSNP
rs1331693746 856 dbSNP
rs1271603671 858 dbSNP
rs1242217562 864 dbSNP
rs553821208 866 dbSNP
rs1312889862 869 dbSNP
rs528215837 872 dbSNP
rs908643737 873 dbSNP
rs1319818149 874 dbSNP
rs1303567016 880 dbSNP
rs7628472 883 dbSNP
rs1390593272 893 dbSNP
rs1450468561 894 dbSNP
rs990699386 898 dbSNP
rs545793506 922 dbSNP
rs564102859 926 dbSNP
rs1369268304 927 dbSNP
rs1167108837 937 dbSNP
rs1447738309 939 dbSNP
rs531346086 941 dbSNP
rs1239906101 960 dbSNP
rs1282569206 979 dbSNP
rs1314802382 983 dbSNP
rs1211789950 984 dbSNP
rs1265752131 991 dbSNP
rs1209610254 993 dbSNP
rs930577873 994 dbSNP
rs997142623 997 dbSNP
rs1265680458 1009 dbSNP
rs1048340652 1012 dbSNP
rs1051294549 1014 dbSNP
rs1339496158 1029 dbSNP
rs7651053 1032 dbSNP
rs1229116727 1034 dbSNP
rs562245523 1039 dbSNP
rs1299012853 1045 dbSNP
rs1008530322 1056 dbSNP
rs1041523913 1057 dbSNP
rs770542735 1063 dbSNP
rs1428009428 1070 dbSNP
rs1370079865 1073 dbSNP
rs1169262799 1077 dbSNP
rs568129364 1078 dbSNP
rs547723100 1083 dbSNP
rs185221509 1088 dbSNP
rs1244001343 1090 dbSNP
rs1224284577 1094 dbSNP
rs533284758 1098 dbSNP
rs1481856523 1102 dbSNP
rs1157872520 1112 dbSNP
rs1405518493 1113 dbSNP
rs894023916 1124 dbSNP
rs969634153 1127 dbSNP
rs1011171150 1135 dbSNP
rs927885684 1137 dbSNP
rs960586853 1138 dbSNP
rs1021252098 1142 dbSNP
rs1358733428 1143 dbSNP
rs1350093647 1148 dbSNP
rs1308772214 1163 dbSNP
rs982811975 1167 dbSNP
rs1400077757 1168 dbSNP
rs533984063 1169 dbSNP
rs908526090 1170 dbSNP
rs1333389806 1171 dbSNP
rs551475830 1201 dbSNP
rs1180433130 1208 dbSNP
rs974556034 1211 dbSNP
rs1278211055 1222 dbSNP
rs921325244 1226 dbSNP
rs1182367731 1228 dbSNP
rs569687440 1229 dbSNP
rs1220116113 1230 dbSNP
rs1035171350 1233 dbSNP
rs745839551 1242 dbSNP
rs959163529 1243 dbSNP
rs1345586666 1259 dbSNP
rs991035480 1260 dbSNP
rs1226329278 1263 dbSNP
rs146225571 1265 dbSNP
rs934895745 1270 dbSNP
rs1052086826 1272 dbSNP
rs1201287095 1274 dbSNP
rs1259399115 1290 dbSNP
rs1333571148 1290 dbSNP
rs951928463 1293 dbSNP
rs1397165240 1309 dbSNP
rs1404978803 1309 dbSNP
rs1157482092 1315 dbSNP
rs771862704 1316 dbSNP
rs983323202 1317 dbSNP
rs1159471127 1323 dbSNP
rs556382161 1328 dbSNP
rs907836300 1329 dbSNP
rs1180985428 1332 dbSNP
rs1010536089 1333 dbSNP
rs781318836 1343 dbSNP
rs190098319 1344 dbSNP
rs1478890314 1355 dbSNP
rs775430090 1357 dbSNP
rs746088806 1361 dbSNP
rs1424748104 1362 dbSNP
rs181096280 1367 dbSNP
rs1172956367 1371 dbSNP
rs1344060800 1371 dbSNP
rs1464300147 1373 dbSNP
rs1401113966 1377 dbSNP
rs1041079465 1381 dbSNP
rs922655152 1397 dbSNP
rs1354471735 1406 dbSNP
rs1465610216 1409 dbSNP
rs1385012105 1411 dbSNP
rs553711985 1412 dbSNP
rs1002052455 1414 dbSNP
rs1327449115 1422 dbSNP
rs1034840809 1428 dbSNP
rs960639148 1429 dbSNP
rs572153247 1432 dbSNP
rs1015629744 1433 dbSNP
rs932755451 1435 dbSNP
rs1344525286 1437 dbSNP
rs963042490 1442 dbSNP
rs775547475 1443 dbSNP
rs139209262 1444 dbSNP
rs1139009 1450 dbSNP
rs536470825 1456 dbSNP
rs921360813 1457 dbSNP
rs1318018050 1458 dbSNP
rs932724303 1459 dbSNP
rs1011120518 1461 dbSNP
rs1295464395 1476 dbSNP
rs986953496 1480 dbSNP
rs557906315 1481 dbSNP
rs1270836320 1497 dbSNP
rs1453205461 1500 dbSNP
rs912724998 1501 dbSNP
rs1272342848 1502 dbSNP
rs1222090641 1517 dbSNP
rs1042646377 1518 dbSNP
rs1434773459 1521 dbSNP
rs1349589576 1522 dbSNP
rs1322507271 1534 dbSNP
rs1424851146 1537 dbSNP
rs902799169 1542 dbSNP
rs1003594019 1550 dbSNP
rs1034707247 1553 dbSNP
rs144015454 1556 dbSNP
rs1390698894 1561 dbSNP
rs934946529 1561 dbSNP
rs1188141751 1565 dbSNP
rs959340910 1568 dbSNP
rs185533992 1573 dbSNP
rs1012004404 1574 dbSNP
rs1053306337 1582 dbSNP
rs4678619 1595 dbSNP
rs1477537739 1605 dbSNP
rs951877750 1613 dbSNP
rs946394592 1614 dbSNP
rs536385227 1621 dbSNP
rs1342882703 1626 dbSNP
rs1217934393 1633 dbSNP
rs983270630 1644 dbSNP
rs907783804 1645 dbSNP
rs965947232 1648 dbSNP
rs1275792015 1658 dbSNP
rs977119190 1666 dbSNP
rs1166187285 1672 dbSNP
rs904971630 1674 dbSNP
rs1428556765 1685 dbSNP
rs1354550145 1687 dbSNP
rs146612667 1694 dbSNP
rs1412662944 1695 dbSNP
rs922635818 1697 dbSNP
rs932679156 1698 dbSNP
rs1481574854 1704 dbSNP
rs1249901446 1707 dbSNP
rs1181642652 1712 dbSNP
rs559486298 1713 dbSNP
rs1483439305 1716 dbSNP
rs1234620536 1718 dbSNP
rs1208704982 1723 dbSNP
rs1312095630 1724 dbSNP
rs1279869474 1739 dbSNP
rs1049835470 1741 dbSNP
rs1323395929 1742 dbSNP
rs1286076412 1752 dbSNP
rs1034891389 1756 dbSNP
rs896313221 1757 dbSNP
rs1004016326 1758 dbSNP
rs769185805 1776 dbSNP
rs1445816670 1796 dbSNP
rs1358493633 1798 dbSNP
rs774811037 1801 dbSNP
rs187994436 1809 dbSNP
rs1409434442 1816 dbSNP
rs1226088873 1819 dbSNP
rs915354195 1827 dbSNP
rs1267870866 1829 dbSNP
rs1358434285 1831 dbSNP
rs1180191785 1844 dbSNP
rs762218068 1848 dbSNP
rs772475467 1850 dbSNP
rs1489801114 1855 dbSNP
rs1463849337 1858 dbSNP
rs776213384 1860 dbSNP
rs1003799303 1864 dbSNP
rs974508772 1870 dbSNP
rs1056498982 1883 dbSNP
rs954167517 1894 dbSNP
rs894801529 1901 dbSNP
rs986837164 1901 dbSNP
rs1337341303 1902 dbSNP
rs1454461149 1903 dbSNP
rs1012364864 1905 dbSNP
rs912610361 1907 dbSNP
rs1454565424 1912 dbSNP
rs1365747943 1921 dbSNP
rs1027340882 1928 dbSNP
rs1446618356 1936 dbSNP
rs1021352131 1946 dbSNP
rs1385899365 1946 dbSNP
rs1185991237 1947 dbSNP
rs1191173316 1949 dbSNP
rs1370269792 1951 dbSNP
rs1473447666 1952 dbSNP
rs1206074687 1954 dbSNP
rs1487020368 1955 dbSNP
rs1262123630 1956 dbSNP
rs1163521717 1957 dbSNP
rs1218868302 1959 dbSNP
rs966738712 1960 dbSNP
rs1315107906 1961 dbSNP
rs887557277 1964 dbSNP
rs1248135941 1984 dbSNP
rs1004644542 1986 dbSNP
rs988969443 1991 dbSNP
rs1014713207 1993 dbSNP
rs1457552441 1999 dbSNP
rs966321567 2000 dbSNP
rs914823651 2011 dbSNP
rs1165540674 2017 dbSNP
rs570292503 2019 dbSNP
rs1381273421 2027 dbSNP
rs1029365770 2028 dbSNP
rs759231955 2032 dbSNP
rs1430695934 2039 dbSNP
rs926276012 2046 dbSNP
rs954055788 2051 dbSNP
rs1056235013 2057 dbSNP
rs896199146 2062 dbSNP
rs985895081 2067 dbSNP
rs1291958254 2075 dbSNP
rs915302504 2077 dbSNP
rs1314295642 2094 dbSNP
rs1004068788 2099 dbSNP
rs1273835120 2105 dbSNP
rs1228019299 2106 dbSNP
rs1328007225 2107 dbSNP
rs1357135238 2110 dbSNP
rs764741074 2111 dbSNP
rs180855630 2112 dbSNP
rs898429791 2117 dbSNP
rs978213688 2122 dbSNP
rs995433160 2124 dbSNP
rs1427902491 2128 dbSNP
rs1350319605 2130 dbSNP
rs1369982492 2133 dbSNP
rs1169020841 2134 dbSNP
rs924111191 2136 dbSNP
rs1203606156 2138 dbSNP
rs1463957980 2141 dbSNP
rs1376323521 2152 dbSNP
rs1175795023 2155 dbSNP
rs149181777 2157 dbSNP
rs1269173399 2159 dbSNP
rs954050813 2160 dbSNP
rs1273555884 2162 dbSNP
rs1249157284 2165 dbSNP
rs1196364075 2170 dbSNP
rs1056713354 2178 dbSNP
rs1443079518 2185 dbSNP
rs1341352219 2186 dbSNP
rs1254084354 2189 dbSNP
rs1222683756 2191 dbSNP
rs895410276 2192 dbSNP
rs186148300 2193 dbSNP
rs947732392 2195 dbSNP
rs752278541 2201 dbSNP
rs1285458780 2213 dbSNP
rs1408178818 2216 dbSNP
rs1350003203 2221 dbSNP
rs1048728406 2223 dbSNP
rs1329585393 2236 dbSNP
rs1241858149 2244 dbSNP
rs549155217 2246 dbSNP
rs887504966 2256 dbSNP
rs1179698847 2260 dbSNP
rs1302720993 2261 dbSNP
rs1470510515 2262 dbSNP
rs1431853678 2266 dbSNP
rs1178174643 2268 dbSNP
rs1471395020 2280 dbSNP
rs1004597354 2281 dbSNP
rs142474931 2284 dbSNP
rs116716124 2290 dbSNP
rs1202910361 2301 dbSNP
rs969418621 2314 dbSNP
rs764164476 2324 dbSNP
rs1201729774 2327 dbSNP
rs1028898214 2334 dbSNP
rs763258402 2335 dbSNP
rs1253492623 2337 dbSNP
rs1441153506 2340 dbSNP
rs1461622131 2355 dbSNP
rs1264746244 2356 dbSNP
rs1469894155 2358 dbSNP
rs1350222038 2359 dbSNP
rs1280274925 2364 dbSNP
rs980372980 2366 dbSNP
rs1338706873 2368 dbSNP
rs554121621 2370 dbSNP
rs1315005019 2371 dbSNP
rs751520047 2374 dbSNP
rs1335430902 2382 dbSNP
rs927495627 2385 dbSNP
rs565848264 2391 dbSNP
rs1448903526 2399 dbSNP
rs953433043 2406 dbSNP
rs1383806202 2408 dbSNP
rs1158717027 2432 dbSNP
rs1470894623 2433 dbSNP
rs985437546 2434 dbSNP
rs1182964460 2436 dbSNP
rs937664412 2436 dbSNP
rs1244814385 2437 dbSNP
rs1022305727 2443 dbSNP
rs1236528497 2444 dbSNP
rs968088556 2446 dbSNP
rs151320887 2453 dbSNP
rs924059282 2455 dbSNP
rs1247403004 2464 dbSNP
rs939516067 2473 dbSNP
rs539645580 2478 dbSNP
rs1037311495 2481 dbSNP
rs898320606 2482 dbSNP
rs995711995 2484 dbSNP
rs992764402 2485 dbSNP
rs889675495 2486 dbSNP
rs916809285 2488 dbSNP
rs1008195156 2494 dbSNP
rs1261301698 2501 dbSNP
rs557844821 2513 dbSNP
rs1019562101 2525 dbSNP
rs1474978906 2537 dbSNP
rs749505200 2537 dbSNP
rs948322928 2544 dbSNP
rs1250357965 2553 dbSNP
rs114634907 2554 dbSNP
rs1291220310 2555 dbSNP
rs1223307224 2567 dbSNP
rs1361594630 2569 dbSNP
rs1201405011 2571 dbSNP
rs1273141439 2572 dbSNP
rs887436123 2582 dbSNP
rs940401860 2584 dbSNP
rs1343239541 2594 dbSNP
rs980638479 2594 dbSNP
rs1036053018 2596 dbSNP
rs960252106 2597 dbSNP
rs901619066 2601 dbSNP
rs1466683277 2611 dbSNP
rs1298688842 2613 dbSNP
rs1409278671 2616 dbSNP
rs991847055 2621 dbSNP
rs997332503 2623 dbSNP
rs917586454 2626 dbSNP
rs1050706860 2628 dbSNP
rs1477197509 2631 dbSNP
rs1268448107 2634 dbSNP
rs889000958 2638 dbSNP
rs113706827 2639 dbSNP
rs1204488154 2647 dbSNP
rs140471642 2650 dbSNP
rs1011505674 2651 dbSNP
rs1217846632 2661 dbSNP
rs866276793 2661 dbSNP
rs1323193469 2664 dbSNP
rs1021583640 2666 dbSNP
rs1303109529 2672 dbSNP
rs10637025 2687 dbSNP
rs1295919628 2687 dbSNP
rs377454303 2688 dbSNP
rs889730257 2688 dbSNP
rs1330747851 2689 dbSNP
rs76569480 2693 dbSNP
rs1468063497 2694 dbSNP
rs1428277650 2703 dbSNP
rs1177478201 2705 dbSNP
rs1481521670 2710 dbSNP
rs1405967246 2715 dbSNP
rs750942083 2716 dbSNP
rs1281517296 2724 dbSNP
rs781032476 2725 dbSNP
rs1235105759 2731 dbSNP
rs1208592737 2735 dbSNP
rs999548947 2753 dbSNP
rs1461165404 2759 dbSNP
rs1031070699 2768 dbSNP
rs1264120157 2777 dbSNP
rs147034449 2780 dbSNP
rs1041065842 2788 dbSNP
rs1325242978 2793 dbSNP
rs1304311428 2794 dbSNP
rs1222721754 2795 dbSNP
rs891789691 2804 dbSNP
rs1281232225 2805 dbSNP
rs192260082 2806 dbSNP
rs916737857 2816 dbSNP
rs1021714872 2819 dbSNP
rs780486483 2820 dbSNP
rs969563598 2822 dbSNP
rs1479914780 2827 dbSNP
rs541337903 2831 dbSNP
rs138257608 2834 dbSNP
rs1490429063 2835 dbSNP
rs1158569957 2838 dbSNP
rs1419781260 2839 dbSNP
rs1410193017 2841 dbSNP
rs909493352 2843 dbSNP
rs1444531560 2845 dbSNP
rs1244209629 2851 dbSNP
rs1198260611 2857 dbSNP
rs993071264 2862 dbSNP
rs1015150935 2872 dbSNP
rs961072613 2876 dbSNP
rs1317036504 2881 dbSNP
rs1478534627 2895 dbSNP
rs1243767957 2896 dbSNP
rs972784184 2897 dbSNP
rs1315577019 2903 dbSNP
rs184048861 2904 dbSNP
rs919698199 2911 dbSNP
rs1372484713 2915 dbSNP
rs931041878 2918 dbSNP
rs985285182 2925 dbSNP
rs1454484846 2938 dbSNP
rs911054092 2948 dbSNP
rs1295135970 2949 dbSNP
rs1424653822 2950 dbSNP
rs545236296 2951 dbSNP
rs1185897345 2956 dbSNP
rs943994437 2956 dbSNP
rs1040950898 2957 dbSNP
rs780197507 2959 dbSNP
rs3436 2960 dbSNP
rs1404044171 2961 dbSNP
rs1301530324 2963 dbSNP
rs1264775277 2977 dbSNP
rs1219635258 2989 dbSNP
rs1036453726 2995 dbSNP
rs1342561405 2997 dbSNP
rs563436788 3000 dbSNP
rs186888001 3008 dbSNP
rs549340009 3009 dbSNP
rs1247614149 3012 dbSNP
rs1383056198 3015 dbSNP
rs1364339939 3024 dbSNP
rs1301466702 3026 dbSNP
rs1404418528 3029 dbSNP
rs1050233738 3031 dbSNP
rs1266492319 3031 dbSNP
rs1166066991 3033 dbSNP
rs888937424 3034 dbSNP
rs1490290999 3047 dbSNP
rs1171545090 3055 dbSNP
rs1430604119 3060 dbSNP
rs1264883526 3067 dbSNP
rs1011453420 3069 dbSNP
rs1490049850 3069 dbSNP
rs1268952628 3071 dbSNP
rs576557569 3090 dbSNP
rs904636732 3094 dbSNP
rs1001615702 3095 dbSNP
rs1042974776 3099 dbSNP
rs1250607933 3100 dbSNP
rs1220674361 3105 dbSNP
rs1034548500 3112 dbSNP
rs1308971287 3120 dbSNP
rs1281656127 3125 dbSNP
rs895992988 3136 dbSNP
rs1346272318 3146 dbSNP
rs1305024355 3152 dbSNP
rs1390224236 3168 dbSNP
rs1396427182 3173 dbSNP
rs1489054931 3174 dbSNP
rs1186640387 3175 dbSNP
rs903129926 3179 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*