miRTarBase - #MIRT000922 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF559   
Synonyms NBLA00121
Description zinc finger protein 559
Transcript NM_032497   
Expression
Putative miRNA Targets on ZNF559
3'UTR of ZNF559
(miRNA target sites are highlighted)
>ZNF559|NM_032497|3'UTR
   1 ATTGGGGCTGATACTTGGAAAGAATGTGGTAAAGCCACTACTTCCTCACACTTACTGAACATGTACTCATTCATAGTGGC
  81 AATGTACACAGTCATAAGGAATGTGGGAAGCCTTCCTTGGTGTCTCAGATCTTAACAATTCCAATAGAAGAGAAGACATA
 161 TGAATGTAAGGAATGTGGGAAAATCTTGGCTCCTTCCATAGGCCTTACTATTCATGTGTCTGTGCATCCTAGGAAACAAA
 241 CTGAACGTAGGAAACCTGTCGATGCTTACATCTTACTGAGTCTGTTTGAACTCATGCTGGAGAGAAATGCTATGAATGTG
 321 AGGAAGGTGGAAAAGCTTTCATTATTTTCCTCGGGCCTTACTGAGCTTGTGAGCACATTGGATATAAATGCACGTCCTCT
 401 GGCTGTAAGGAATGTGTTGAAACCTTTCACTCTGCCTTATACCTTAATATTCAGCTGTGATCTCACAAGTGTGAAAAATC
 481 TTATGAATGTAAAATGTGTGGAGATTCTTCTTTGTTTTTAGCTTCCACTTTGGGAACATGTCAAAGCACACATTGAGAAG
 561 TCCCATGAGTGAAAGAGATGTTGGAAAGCCCTTGAACTTGGTCGTTAGGAAACATCCACACTGAAGAGGAACCTGACTGT
 641 ATGGAAGGTCAAAAAGGCTGTATTAATTTACATGCAAAAAGTCACACTAGAGGAATGCCATATCAGAATGCTTTTGGTAA
 721 ATATACATGTTTTAAAGAGGTTATATATCATTAATAAAAATATCTAGCTGGTCTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAA-UACAC-GACGau 5'
               ||:||| ||||| |||:  
Target 5' gccttACTATTCATGTGTCTGTgc 3'
202 - 225 105.00 -12.00
2
miRNA  3' gugUUUGGUAAUAC------ACGACgau 5'
             |: |::|| ||      |||||   
Target 5' ctgAGTCTGTT-TGAACTCATGCTGgag 3'
276 - 302 104.00 -9.10
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            || |:||  |  |||| :| 
Target 5' gcCATATCAGAA--TGCTTTTg 3'
697 - 716 104.00 -6.74
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30716114 8 COSMIC
COSN31561943 9 COSMIC
COSN27006248 11 COSMIC
COSN27006249 23 COSMIC
COSN30134083 23 COSMIC
COSN30147746 27 COSMIC
COSN31503959 29 COSMIC
COSN30466710 45 COSMIC
COSN30164723 83 COSMIC
COSN30150413 116 COSMIC
COSN30482340 116 COSMIC
COSN30154985 134 COSMIC
COSN30469675 142 COSMIC
COSN8263170 411 COSMIC
COSN21488620 765 COSMIC
COSN26093535 1031 COSMIC
COSN27746649 1443 COSMIC
COSN28439384 1935 COSMIC
COSN17252550 1952 COSMIC
COSN25167767 2009 COSMIC
COSN26499146 2115 COSMIC
COSN20315725 2541 COSMIC
COSN27666203 2637 COSMIC
COSN6670304 2772 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753294800 1 dbSNP
rs143871308 2 dbSNP
rs764641738 7 dbSNP
rs758303717 10 dbSNP
rs1475468308 19 dbSNP
rs779869318 29 dbSNP
rs746753830 35 dbSNP
rs1423514384 39 dbSNP
rs368757306 41 dbSNP
rs749340119 46 dbSNP
rs1317735310 48 dbSNP
rs771098571 49 dbSNP
rs1053450267 51 dbSNP
rs913608303 55 dbSNP
rs756032377 56 dbSNP
rs1289744934 70 dbSNP
rs1474600451 76 dbSNP
rs945015502 83 dbSNP
rs140022935 84 dbSNP
rs1419057667 86 dbSNP
rs900902292 86 dbSNP
rs1385832725 87 dbSNP
rs1165370623 94 dbSNP
rs997103396 94 dbSNP
rs1442314141 96 dbSNP
rs112547151 103 dbSNP
rs1466122879 105 dbSNP
rs1186753619 111 dbSNP
rs542632344 112 dbSNP
rs867076024 113 dbSNP
rs988851500 116 dbSNP
rs1005387735 121 dbSNP
rs1015464207 137 dbSNP
rs561371149 139 dbSNP
rs531704304 144 dbSNP
rs543945322 145 dbSNP
rs1358829024 146 dbSNP
rs1327304270 149 dbSNP
rs947522586 150 dbSNP
rs1216574542 158 dbSNP
rs1288481178 158 dbSNP
rs1399222243 162 dbSNP
rs1286188430 163 dbSNP
rs1304883639 166 dbSNP
rs748644794 186 dbSNP
rs565383822 187 dbSNP
rs1376625882 189 dbSNP
rs1025506517 190 dbSNP
rs1367405170 193 dbSNP
rs549434515 194 dbSNP
rs1291876367 199 dbSNP
rs779172126 204 dbSNP
rs970805879 205 dbSNP
rs1417007169 209 dbSNP
rs532712914 211 dbSNP
rs548026436 215 dbSNP
rs1187917039 216 dbSNP
rs746248584 221 dbSNP
rs1271419556 222 dbSNP
rs772659054 224 dbSNP
rs1213857670 226 dbSNP
rs981353731 229 dbSNP
rs1485984040 231 dbSNP
rs922119796 238 dbSNP
rs1212914253 240 dbSNP
rs1033811513 245 dbSNP
rs566350366 247 dbSNP
rs3745574 248 dbSNP
rs1454016301 249 dbSNP
rs890124271 257 dbSNP
rs1284905308 261 dbSNP
rs192920947 261 dbSNP
rs1403059581 262 dbSNP
rs114556235 263 dbSNP
rs1463117391 265 dbSNP
rs1352252022 267 dbSNP
rs1414073141 268 dbSNP
rs976421973 273 dbSNP
rs922357402 276 dbSNP
rs1197666130 278 dbSNP
rs932385775 280 dbSNP
rs537446639 281 dbSNP
rs1050029741 282 dbSNP
rs1179449914 283 dbSNP
rs1437186687 287 dbSNP
rs898929674 291 dbSNP
rs1204571722 297 dbSNP
rs76385929 310 dbSNP
rs1261463367 311 dbSNP
rs1167268627 313 dbSNP
rs941191647 314 dbSNP
rs571023003 317 dbSNP
rs538416410 321 dbSNP
rs771365869 324 dbSNP
rs1370561757 328 dbSNP
rs1023448462 330 dbSNP
rs1470024790 337 dbSNP
rs905053364 341 dbSNP
rs1173788704 342 dbSNP
rs1465905800 345 dbSNP
rs75534465 353 dbSNP
rs571994701 354 dbSNP
rs374393305 359 dbSNP
rs1417800569 374 dbSNP
rs1237678670 378 dbSNP
rs778082544 378 dbSNP
rs1024938994 380 dbSNP
rs1184331446 382 dbSNP
rs1462691654 394 dbSNP
rs959988685 395 dbSNP
rs1414445408 399 dbSNP
rs1344034871 403 dbSNP
rs1261038979 408 dbSNP
rs1241132066 418 dbSNP
rs1311239515 427 dbSNP
rs906611263 429 dbSNP
rs13535 430 dbSNP
rs1034171523 438 dbSNP
rs1334363196 440 dbSNP
rs1020294781 441 dbSNP
rs555857274 447 dbSNP
rs1290958878 448 dbSNP
rs1221408484 465 dbSNP
rs979285759 470 dbSNP
rs922118573 471 dbSNP
rs1281559649 483 dbSNP
rs770192974 485 dbSNP
rs1021235678 493 dbSNP
rs1230709647 495 dbSNP
rs1187119088 496 dbSNP
rs1447752909 505 dbSNP
rs779780323 508 dbSNP
rs1208322208 511 dbSNP
rs987702587 511 dbSNP
rs576341111 524 dbSNP
rs1264800609 535 dbSNP
rs966923437 538 dbSNP
rs1191920926 539 dbSNP
rs1239859088 540 dbSNP
rs1478990322 541 dbSNP
rs183261142 545 dbSNP
rs922254434 551 dbSNP
rs1394273745 555 dbSNP
rs940310462 558 dbSNP
rs1380939353 563 dbSNP
rs1360281512 566 dbSNP
rs1304280852 571 dbSNP
rs1036048961 574 dbSNP
rs932307083 576 dbSNP
rs985263058 581 dbSNP
rs1475766281 584 dbSNP
rs774208984 590 dbSNP
rs909624281 598 dbSNP
rs1476758106 603 dbSNP
rs1262120193 604 dbSNP
rs565344912 605 dbSNP
rs1036804437 611 dbSNP
rs1287605317 633 dbSNP
rs897084112 639 dbSNP
rs930396737 650 dbSNP
rs1339456652 651 dbSNP
rs1045251709 653 dbSNP
rs1382972923 660 dbSNP
rs1317802677 666 dbSNP
rs905020928 670 dbSNP
rs1216335288 677 dbSNP
rs1324742374 682 dbSNP
rs1284269848 688 dbSNP
rs565832641 690 dbSNP
rs1003787099 693 dbSNP
rs1439249659 694 dbSNP
rs949956302 695 dbSNP
rs551856130 696 dbSNP
rs1347619328 699 dbSNP
rs906566670 701 dbSNP
rs1398723702 702 dbSNP
rs1166375079 725 dbSNP
rs1465245482 732 dbSNP
rs1232477200 734 dbSNP
rs768323514 742 dbSNP
rs1199932126 744 dbSNP
rs1002601686 748 dbSNP
rs1244969165 764 dbSNP
rs141953527 768 dbSNP
rs376885002 768 dbSNP
rs1033786579 770 dbSNP
rs188721887 781 dbSNP
rs1194219383 782 dbSNP
rs1011092515 783 dbSNP
rs953538184 791 dbSNP
rs151097454 794 dbSNP
rs530324244 796 dbSNP
rs192386626 804 dbSNP
rs184621230 805 dbSNP
rs953768025 806 dbSNP
rs1326883569 809 dbSNP
rs912125933 811 dbSNP
rs985513859 820 dbSNP
rs1407173809 834 dbSNP
rs1178834401 839 dbSNP
rs1470871919 844 dbSNP
rs1422709783 848 dbSNP
rs772867576 850 dbSNP
rs1470442159 854 dbSNP
rs940904021 862 dbSNP
rs1176287558 864 dbSNP
rs1456914930 866 dbSNP
rs972335921 874 dbSNP
rs920250672 875 dbSNP
rs1310814183 877 dbSNP
rs1278290114 882 dbSNP
rs1224848672 886 dbSNP
rs909646927 888 dbSNP
rs1307677416 899 dbSNP
rs1239588480 900 dbSNP
rs962400288 903 dbSNP
rs1439338830 906 dbSNP
rs1311972503 916 dbSNP
rs972550934 919 dbSNP
rs918455114 930 dbSNP
rs554650960 942 dbSNP
rs949922989 943 dbSNP
rs531299103 947 dbSNP
rs760171839 948 dbSNP
rs549385163 961 dbSNP
rs570986175 963 dbSNP
rs1357852994 966 dbSNP
rs1213709103 969 dbSNP
rs766229128 970 dbSNP
rs538379694 972 dbSNP
rs1200419692 973 dbSNP
rs547181836 974 dbSNP
rs893898096 975 dbSNP
rs1237299035 982 dbSNP
rs189458096 984 dbSNP
rs775150708 987 dbSNP
rs1042487440 992 dbSNP
rs1317182478 993 dbSNP
rs1476302998 993 dbSNP
rs1226851656 994 dbSNP
rs902718719 1003 dbSNP
rs371966169 1004 dbSNP
rs1378768999 1013 dbSNP
rs998741599 1028 dbSNP
rs753809196 1029 dbSNP
rs954409394 1031 dbSNP
rs1296275857 1036 dbSNP
rs1362218584 1036 dbSNP
rs1460384071 1038 dbSNP
rs1333895038 1041 dbSNP
rs1006528143 1042 dbSNP
rs1016523363 1047 dbSNP
rs1365684089 1047 dbSNP
rs759306034 1048 dbSNP
rs953607488 1050 dbSNP
rs1186738233 1051 dbSNP
rs1476595802 1053 dbSNP
rs1009010264 1056 dbSNP
rs1216544437 1057 dbSNP
rs1391114759 1058 dbSNP
rs962348259 1060 dbSNP
rs1019109164 1062 dbSNP
rs1294544221 1064 dbSNP
rs972498019 1066 dbSNP
rs536063481 1068 dbSNP
rs962237190 1069 dbSNP
rs11666541 1070 dbSNP
rs1216484397 1071 dbSNP
rs537545924 1074 dbSNP
rs1276016343 1076 dbSNP
rs538213963 1080 dbSNP
rs1399362380 1082 dbSNP
rs980857599 1097 dbSNP
rs981653659 1098 dbSNP
rs368375424 1099 dbSNP
rs926368134 1105 dbSNP
rs191238779 1106 dbSNP
rs557450857 1111 dbSNP
rs559021155 1112 dbSNP
rs149816623 1113 dbSNP
rs1486800695 1115 dbSNP
rs1193442846 1117 dbSNP
rs1480953634 1121 dbSNP
rs541583847 1123 dbSNP
rs1189981170 1126 dbSNP
rs902580591 1128 dbSNP
rs559889151 1130 dbSNP
rs574935605 1131 dbSNP
rs1173168535 1139 dbSNP
rs1257631518 1142 dbSNP
rs184666828 1145 dbSNP
rs577555201 1156 dbSNP
rs1323984046 1157 dbSNP
rs1374077677 1158 dbSNP
rs890044530 1164 dbSNP
rs1007132974 1165 dbSNP
rs8100139 1166 dbSNP
rs1298209474 1167 dbSNP
rs1000179104 1171 dbSNP
rs1377617301 1171 dbSNP
rs1448307981 1171 dbSNP
rs898191827 1172 dbSNP
rs1415068202 1175 dbSNP
rs748157357 1176 dbSNP
rs1353030687 1177 dbSNP
rs1219876907 1178 dbSNP
rs1251377466 1178 dbSNP
rs1050840678 1179 dbSNP
rs1204474043 1179 dbSNP
rs889151189 1179 dbSNP
rs993782835 1179 dbSNP
rs1461612501 1180 dbSNP
rs1295661328 1185 dbSNP
rs563977262 1189 dbSNP
rs1019078116 1199 dbSNP
rs971531708 1206 dbSNP
rs146881955 1208 dbSNP
rs1374012527 1220 dbSNP
rs1027875402 1221 dbSNP
rs772979044 1223 dbSNP
rs1034563710 1227 dbSNP
rs549348786 1230 dbSNP
rs1211902357 1231 dbSNP
rs8103043 1233 dbSNP
rs914472787 1238 dbSNP
rs1465829380 1239 dbSNP
rs1410867150 1243 dbSNP
rs1484739610 1245 dbSNP
rs532077177 1247 dbSNP
rs926275458 1251 dbSNP
rs1379707688 1253 dbSNP
rs1262506466 1255 dbSNP
rs1184465196 1260 dbSNP
rs960402370 1261 dbSNP
rs978056430 1272 dbSNP
rs924065665 1273 dbSNP
rs1261311046 1279 dbSNP
rs934026578 1281 dbSNP
rs547046180 1287 dbSNP
rs879698708 1288 dbSNP
rs565650070 1290 dbSNP
rs1051182535 1293 dbSNP
rs1168920786 1302 dbSNP
rs1397310255 1312 dbSNP
rs1395872113 1314 dbSNP
rs1435657408 1315 dbSNP
rs1386043656 1317 dbSNP
rs573445033 1325 dbSNP
rs1172644382 1330 dbSNP
rs1373304940 1339 dbSNP
rs889993095 1343 dbSNP
rs1432456080 1344 dbSNP
rs1360016111 1355 dbSNP
rs1418355466 1355 dbSNP
rs1164336178 1357 dbSNP
rs1288985087 1367 dbSNP
rs1366995647 1371 dbSNP
rs140693571 1374 dbSNP
rs1423035975 1376 dbSNP
rs1380481775 1384 dbSNP
rs1038621048 1385 dbSNP
rs1303264947 1392 dbSNP
rs1195791825 1396 dbSNP
rs1348326877 1398 dbSNP
rs1487247373 1401 dbSNP
rs766063491 1407 dbSNP
rs898723322 1411 dbSNP
rs993813898 1412 dbSNP
rs761818167 1416 dbSNP
rs925164702 1416 dbSNP
rs548108085 1428 dbSNP
rs906959905 1429 dbSNP
rs1261433691 1436 dbSNP
rs565394771 1438 dbSNP
rs1340498075 1442 dbSNP
rs1304263002 1443 dbSNP
rs765161889 1445 dbSNP
rs1034100376 1453 dbSNP
rs1388590007 1461 dbSNP
rs1162908285 1465 dbSNP
rs958550906 1468 dbSNP
rs989968867 1469 dbSNP
rs1424117656 1482 dbSNP
rs1172607761 1484 dbSNP
rs144625876 1487 dbSNP
rs1193480257 1488 dbSNP
rs1040448110 1493 dbSNP
rs1199488019 1498 dbSNP
rs537379242 1499 dbSNP
rs1393625917 1503 dbSNP
rs1208901983 1506 dbSNP
rs1259559901 1509 dbSNP
rs1217243292 1513 dbSNP
rs1317676662 1515 dbSNP
rs967261905 1516 dbSNP
rs558988265 1523 dbSNP
rs978118876 1525 dbSNP
rs1322932178 1528 dbSNP
rs570812395 1531 dbSNP
rs923902235 1536 dbSNP
rs370037600 1537 dbSNP
rs987315141 1543 dbSNP
rs372646035 1545 dbSNP
rs746375442 1546 dbSNP
rs991800713 1547 dbSNP
rs1020638275 1550 dbSNP
rs574855436 1551 dbSNP
rs371383991 1553 dbSNP
rs1371712677 1555 dbSNP
rs1038479938 1558 dbSNP
rs1440075679 1560 dbSNP
rs898754341 1566 dbSNP
rs1457611591 1570 dbSNP
rs1301026494 1572 dbSNP
rs1279726769 1575 dbSNP
rs1375222677 1580 dbSNP
rs1221465648 1581 dbSNP
rs1329570621 1581 dbSNP
rs1379207693 1581 dbSNP
rs1446256177 1581 dbSNP
rs34300605 1581 dbSNP
rs528036367 1581 dbSNP
rs565351801 1581 dbSNP
rs571301980 1581 dbSNP
rs930194815 1582 dbSNP
rs200283558 1587 dbSNP
rs932539404 1589 dbSNP
rs200788771 1591 dbSNP
rs55993813 1591 dbSNP
rs906902265 1592 dbSNP
rs912491264 1593 dbSNP
rs1002524040 1594 dbSNP
rs146077531 1596 dbSNP
rs201151472 1597 dbSNP
rs1213809173 1598 dbSNP
rs77363050 1601 dbSNP
rs897850412 1602 dbSNP
rs1441040439 1603 dbSNP
rs762757149 1608 dbSNP
rs575884045 1616 dbSNP
rs534900634 1621 dbSNP
rs1251548393 1623 dbSNP
rs1355966294 1638 dbSNP
rs1307122864 1642 dbSNP
rs1239474640 1643 dbSNP
rs1380224739 1643 dbSNP
rs564445761 1644 dbSNP
rs1021427467 1645 dbSNP
rs10418104 1647 dbSNP
rs1002386546 1658 dbSNP
rs1034320646 1661 dbSNP
rs896760821 1663 dbSNP
rs1361934905 1664 dbSNP
rs1013815083 1665 dbSNP
rs10418267 1668 dbSNP
rs1414151068 1669 dbSNP
rs1030232115 1672 dbSNP
rs1183238357 1675 dbSNP
rs1472018932 1676 dbSNP
rs1237208779 1684 dbSNP
rs146660057 1687 dbSNP
rs1489577825 1689 dbSNP
rs1284472140 1690 dbSNP
rs1416925261 1692 dbSNP
rs986791168 1693 dbSNP
rs911326147 1696 dbSNP
rs1460898255 1700 dbSNP
rs964058635 1700 dbSNP
rs1323750330 1708 dbSNP
rs1292408376 1711 dbSNP
rs1400351165 1713 dbSNP
rs1296254809 1714 dbSNP
rs1356091358 1714 dbSNP
rs1429503709 1718 dbSNP
rs979587708 1721 dbSNP
rs1442594923 1722 dbSNP
rs1297384084 1727 dbSNP
rs1372962332 1732 dbSNP
rs1166494714 1740 dbSNP
rs372722326 1744 dbSNP
rs1032094289 1747 dbSNP
rs1171888294 1750 dbSNP
rs1478997897 1753 dbSNP
rs1261735799 1759 dbSNP
rs1295254435 1764 dbSNP
rs1335496881 1766 dbSNP
rs1248477728 1767 dbSNP
rs974221113 1771 dbSNP
rs985323686 1772 dbSNP
rs1258930312 1777 dbSNP
rs529781037 1778 dbSNP
rs1288271834 1780 dbSNP
rs10413707 1788 dbSNP
rs972673075 1790 dbSNP
rs1276236879 1793 dbSNP
rs1205732416 1794 dbSNP
rs1232658476 1798 dbSNP
rs1294812543 1802 dbSNP
rs1479477128 1810 dbSNP
rs1433643870 1811 dbSNP
rs1189593102 1817 dbSNP
rs1393345753 1817 dbSNP
rs569792990 1833 dbSNP
rs1417974655 1834 dbSNP
rs1467515279 1834 dbSNP
rs181398559 1837 dbSNP
rs919258930 1837 dbSNP
rs929328093 1843 dbSNP
rs771861566 1849 dbSNP
rs772929579 1850 dbSNP
rs1189597227 1852 dbSNP
rs1474570191 1853 dbSNP
rs1488191119 1855 dbSNP
rs1162705512 1856 dbSNP
rs1421640350 1858 dbSNP
rs751805794 1859 dbSNP
rs928889376 1859 dbSNP
rs909315301 1861 dbSNP
rs758847879 1862 dbSNP
rs1327984607 1864 dbSNP
rs186590243 1869 dbSNP
rs760168621 1871 dbSNP
rs894230066 1872 dbSNP
rs896688665 1873 dbSNP
rs1448469419 1875 dbSNP
rs1398595828 1884 dbSNP
rs770458970 1890 dbSNP
rs570775478 1891 dbSNP
rs1414183529 1893 dbSNP
rs1042817954 1917 dbSNP
rs79126606 1918 dbSNP
rs903044914 1922 dbSNP
rs1361469568 1924 dbSNP
rs1282485915 1927 dbSNP
rs1380938897 1928 dbSNP
rs567828044 1931 dbSNP
rs1438021838 1933 dbSNP
rs534987933 1934 dbSNP
rs543120037 1939 dbSNP
rs143507845 1940 dbSNP
rs776480912 1945 dbSNP
rs10408489 1953 dbSNP
rs189148357 1954 dbSNP
rs1286054751 1955 dbSNP
rs1241641788 1963 dbSNP
rs1257694834 1969 dbSNP
rs1374262208 1974 dbSNP
rs752511086 1984 dbSNP
rs965239276 1991 dbSNP
rs1008648589 1993 dbSNP
rs972607754 1997 dbSNP
rs1434594547 1999 dbSNP
rs1018196996 2001 dbSNP
rs370885841 2002 dbSNP
rs181713944 2003 dbSNP
rs575388542 2014 dbSNP
rs1243318962 2019 dbSNP
rs1188422558 2025 dbSNP
rs1475731387 2027 dbSNP
rs984829631 2029 dbSNP
rs909228057 2031 dbSNP
rs186415721 2042 dbSNP
rs1417168068 2046 dbSNP
rs1286624173 2047 dbSNP
rs1281971791 2051 dbSNP
rs7255812 2053 dbSNP
rs918083724 2060 dbSNP
rs1175774757 2064 dbSNP
rs1310980297 2064 dbSNP
rs1376355106 2065 dbSNP
rs1434335472 2070 dbSNP
rs1332319724 2077 dbSNP
rs982941613 2080 dbSNP
rs191227438 2088 dbSNP
rs755971750 2092 dbSNP
rs1398230647 2093 dbSNP
rs1270082059 2094 dbSNP
rs1055474393 2098 dbSNP
rs1384268410 2101 dbSNP
rs915611362 2109 dbSNP
rs1366902117 2117 dbSNP
rs1162585116 2136 dbSNP
rs1053436613 2137 dbSNP
rs1474751632 2137 dbSNP
rs1363468598 2138 dbSNP
rs947019829 2143 dbSNP
rs1006635369 2152 dbSNP
rs1281494034 2157 dbSNP
rs1019379189 2158 dbSNP
rs541000644 2162 dbSNP
rs1042859906 2169 dbSNP
rs1346758985 2181 dbSNP
rs1270864308 2190 dbSNP
rs1233125730 2208 dbSNP
rs1318955523 2208 dbSNP
rs902907277 2213 dbSNP
rs911904540 2217 dbSNP
rs767616235 2220 dbSNP
rs1325961015 2230 dbSNP
rs750936262 2231 dbSNP
rs952641894 2241 dbSNP
rs1325472479 2242 dbSNP
rs1447037164 2248 dbSNP
rs1051567622 2250 dbSNP
rs890377266 2253 dbSNP
rs1424000211 2258 dbSNP
rs1007509492 2261 dbSNP
rs1474365200 2262 dbSNP
rs868175933 2263 dbSNP
rs1372399487 2265 dbSNP
rs1017473007 2268 dbSNP
rs1452827464 2270 dbSNP
rs528391235 2271 dbSNP
rs1250756599 2273 dbSNP
rs1016259819 2274 dbSNP
rs1458507566 2275 dbSNP
rs559121134 2279 dbSNP
rs1194404867 2282 dbSNP
rs756708083 2284 dbSNP
rs990823491 2285 dbSNP
rs918006877 2287 dbSNP
rs1027039084 2288 dbSNP
rs1394217791 2290 dbSNP
rs1434390536 2301 dbSNP
rs1333170783 2303 dbSNP
rs749628003 2305 dbSNP
rs1395762762 2311 dbSNP
rs1173018942 2314 dbSNP
rs1170987948 2326 dbSNP
rs1387274592 2327 dbSNP
rs978246534 2328 dbSNP
rs1401289829 2331 dbSNP
rs780645191 2332 dbSNP
rs1193663241 2334 dbSNP
rs749671986 2336 dbSNP
rs1318261944 2337 dbSNP
rs757575631 2338 dbSNP
rs34439490 2342 dbSNP
rs1239592586 2350 dbSNP
rs529788392 2354 dbSNP
rs1035827687 2356 dbSNP
rs1180178387 2362 dbSNP
rs1437606456 2364 dbSNP
rs541511987 2366 dbSNP
rs1054479214 2368 dbSNP
rs936925707 2368 dbSNP
rs1304691968 2378 dbSNP
rs1240929942 2381 dbSNP
rs73920753 2383 dbSNP
rs1277994416 2388 dbSNP
rs1439754884 2392 dbSNP
rs1334769975 2400 dbSNP
rs1373520157 2402 dbSNP
rs1172528678 2406 dbSNP
rs1419761435 2406 dbSNP
rs1175050939 2408 dbSNP
rs1381853987 2408 dbSNP
rs1469959753 2409 dbSNP
rs942352121 2430 dbSNP
rs1190262896 2439 dbSNP
rs916154356 2451 dbSNP
rs1485002110 2452 dbSNP
rs1230652410 2454 dbSNP
rs1257411723 2457 dbSNP
rs777346709 2458 dbSNP
rs1040788431 2461 dbSNP
rs73506752 2463 dbSNP
rs1282435303 2465 dbSNP
rs1223378688 2472 dbSNP
rs1349726004 2479 dbSNP
rs7253373 2487 dbSNP
rs1416367439 2489 dbSNP
rs934394883 2493 dbSNP
rs1469796157 2494 dbSNP
rs1214218875 2501 dbSNP
rs564347975 2502 dbSNP
rs1156523120 2509 dbSNP
rs1431191652 2513 dbSNP
rs1197028808 2514 dbSNP
rs890335295 2515 dbSNP
rs943187647 2516 dbSNP
rs1365695819 2517 dbSNP
rs1417861233 2519 dbSNP
rs1470626272 2520 dbSNP
rs1194952049 2523 dbSNP
rs1489322573 2528 dbSNP
rs1158111321 2535 dbSNP
rs1038956263 2539 dbSNP
rs1452456367 2545 dbSNP
rs1409823390 2546 dbSNP
rs1292273534 2549 dbSNP
rs888313336 2552 dbSNP
rs899057344 2554 dbSNP
rs995484057 2558 dbSNP
rs770388503 2562 dbSNP
rs1429389512 2569 dbSNP
rs1394216615 2573 dbSNP
rs887197781 2574 dbSNP
rs1385398322 2576 dbSNP
rs182368509 2579 dbSNP
rs1417526351 2580 dbSNP
rs1036179009 2584 dbSNP
rs1172047842 2584 dbSNP
rs1186062322 2585 dbSNP
rs546961053 2585 dbSNP
rs960265857 2587 dbSNP
rs991629593 2588 dbSNP
rs1285964676 2589 dbSNP
rs1023242682 2590 dbSNP
rs112955304 2590 dbSNP
rs1272270671 2590 dbSNP
rs978175262 2593 dbSNP
rs1233856310 2594 dbSNP
rs968921752 2594 dbSNP
rs1460517444 2595 dbSNP
rs1213552327 2598 dbSNP
rs398120810 2599 dbSNP
rs1487389904 2600 dbSNP
rs568406950 2602 dbSNP
rs535847609 2603 dbSNP
rs924336997 2609 dbSNP
rs1393234312 2611 dbSNP
rs1332518613 2615 dbSNP
rs1438660062 2629 dbSNP
rs934318719 2641 dbSNP
rs548733497 2642 dbSNP
rs1396916359 2643 dbSNP
rs569028873 2644 dbSNP
rs1040715485 2648 dbSNP
rs745334409 2649 dbSNP
rs1179086824 2653 dbSNP
rs900870727 2654 dbSNP
rs1249554059 2665 dbSNP
rs1038819013 2666 dbSNP
rs539619481 2677 dbSNP
rs888248957 2683 dbSNP
rs186124672 2693 dbSNP
rs568474191 2700 dbSNP
rs1309524104 2702 dbSNP
rs1393504978 2710 dbSNP
rs1371556060 2719 dbSNP
rs1298126941 2720 dbSNP
rs887152512 2735 dbSNP
rs1014146736 2742 dbSNP
rs1356819829 2744 dbSNP
rs1024918862 2754 dbSNP
rs1434170855 2756 dbSNP
rs1381228158 2761 dbSNP
rs1161475746 2764 dbSNP
rs1420673638 2764 dbSNP
rs1004600930 2765 dbSNP
rs147998393 2772 dbSNP
rs1259510180 2774 dbSNP
rs1208185545 2782 dbSNP
rs1229492515 2783 dbSNP
rs557538547 2794 dbSNP
rs1240680517 2796 dbSNP
rs1315538740 2796 dbSNP
rs1306786813 2799 dbSNP
rs895882027 2800 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Location of target site 3'UTR
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*