miRTarBase - #MIRT001802 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BACE1   
Synonyms ASP2, BACE, HSPC104
Description beta-secretase 1
Transcript NM_012104   
Other Transcripts NM_138971 , NM_138972 , NM_138973   
Expression
Putative miRNA Targets on BACE1
3'UTR of BACE1
(miRNA target sites are highlighted)
>BACE1|NM_012104|3'UTR
   1 GGAGGCCCATGGGCAGAAGATAGAGATTCCCCTGGACCACACCTCCGTGGTTCACTTTGGTCACAAGTAGGAGACACAGA
  81 TGGCACCTGTGGCCAGAGCACCTCAGGACCCTCCCCACCCACCAAATGCCTCTGCCTTGATGGAGAAGGAAAAGGCTGGC
 161 AAGGTGGGTTCCAGGGACTGTACCTGTAGGAAACAGAAAAGAGAAGAAAGAAGCACTCTGCTGGCGGGAATACTCTTGGT
 241 CACCTCAAATTTAAGTCGGGAAATTCTGCTGCTTGAAACTTCAGCCCTGAACCTTTGTCCACCATTCCTTTAAATTCTCC
 321 AACCCAAAGTATTCTTCTTTTCTTAGTTTCAGAAGTACTGGCATCACACGCAGGTTACCTTGGCGTGTGTCCCTGTGGTA
 401 CCCTGGCAGAGAAGAGACCAAGCTTGTTTCCCTGCTGGCCAAAGTCAGTAGGAGAGGATGCACAGTTTGCTATTTGCTTT
 481 AGAGACAGGGACTGTATAAACAAGCCTAACATTGGTGCAAAGATTGCCTCTTGAATTAAAAAAAAAAACTAGATTGACTA
 561 TTTATACAAATGGGGGCGGCTGGAAAGAGGAGAAGGAGAGGGAGTACAAAGACAGGGAATAGTGGGATCAAAGCTAGGAA
 641 AGGCAGAAACACAACCACTCACCAGTCCTAGTTTTAGACCTCATCTCCAAGATAGCATCCCATCTCAGAAGATGGGTGTT
 721 GTTTTCAATGTTTTCTTTTCTGTGGTTGCAGCCTGACCAAAAGTGAGATGGGAAGGGCTTATCTAGCCAAAGAGCTCTTT
 801 TTTAGCTCTCTTAAATGAAGTGCCCACTAAGAAGTTCCACTTAACACATGAATTTCTGCCATATTAATTTCATTGTCTCT
 881 ATCTGAACCACCCTTTATTCTACATATGATAGGCAGCACTGAAATATCCTAACCCCCTAAGCTCCAGGTGCCCTGTGGGA
 961 GAGCAACTGGACTATAGCAGGGCTGGGCTCTGTCTTCCTGGTCATAGGCTCACTCTTTCCCCCAAATCTTCCTCTGGAGC
1041 TTTGCAGCCAAGGTGCTAAAAGGAATAGGTAGGAGACCTCTTCTATCTAATCCTTAAAAGCATAATGTTGAACATTCATT
1121 CAACAGCTGATGCCCTATAACCCCTGCCTGGATTTCTTCCTATTAGGCTATAAGAAGTAGCAAGATCTTTACATAATTCA
1201 GAGTGGTTTCATTGCCTTCCTACCCTCTCTAATGGCCCCTCCATTTATTTGACTAAAGCATCACACAGTGGCACTAGCAT
1281 TATACCAAGAGTATGAGAAATACAGTGCTTTATGGCTCTAACATTACTGCCTTCAGTATCAAGGCTGCCTGGAGAAAGGA
1361 TGGCAGCCTCAGGGCTTCCTTATGTCCTCCACCACAAGAGCTCCTTGATGAAGGTCATCTTTTTCCCCTATCCTGTTCTT
1441 CCCCTCCCCGCTCCTAATGGTACGTGGGTACCCAGGCTGGTTCTTGGGCTAGGTAGTGGGGACCAAGTTCATTACCTCCC
1521 TATCAGTTCTAGCATAGTAAACTACGGTACCAGTGTTAGTGGGAAGAGCTGGGTTTTCCTAGTATACCCACTGCATCCTA
1601 CTCCTACCTGGTCAACCCGCTGCTTCCAGGTATGGGACCTGCTAAGTGTGGAATTACCTGATAAGGGAGAGGGAAATACA
1681 AGGAGGGCCTCTGGTGTTCCTGGCCTCAGCCAGCTGCCCACAAGCCATAAACCAATAAAACAAGAATACTGAGTCAGTTT
1761 TTTATCTGGGTTCTCTTCATTCCCACTGCACTTGGTGCTGCTTTGGCTGACTGGGAACACCCCATAACTACAGAGTCTGA
1841 CAGGAAGACTGGAGACTGTCCACTTCTAGCTCGGAACTTACTGTGTAAATAAACTTTCAGAACTGCTACCATGAAGTGAA
1921 AATGCCACATTTTGCTTTATAATTTCTACCCATGTTGGGAAAAACTGGCTTTTTCCCAGCCCTTTCCAGGGCATAAAACT
2001 CAACCCCTTCGATAGCAAGTCCCATCAGCCTATTATTTTTTTAAAGAAAACTTGCACTTGTTTTTCTTTTTACAGTTACT
2081 TCCTTCCTGCCCCAAAATTATAAACTCTAAGTGTAAAAAAAAGTCTTAACAACAGCTTCTTGCTTGTAAAAATATGTATT
2161 ATACATCTGTATTTTTAAATTCTGCTCCTGAAAAATGACTGTCCCATTCTCCACTCACTGCATTTGGGGCCTTTCCCATT
2241 GGTCTGCATGTCTTTTATCATTGCAGGCCAGTGGACAGAGGGAGAAGGGAGAACAGGGGTCGCCAACACTTGTGTTGCTT
2321 TCTGACTGATCCTGAACAAGAAAGAGTAACACTGAGGCGCTCGCTCCCATGCACAACTCTCCAAAACACTTATCCTCCTG
2401 CAAGAGTGGGCTTTCCAGGGTCTTTACTGGGAAGCAGTTAAGCCCCCTCCTCACCCCTTCCTTTTTTCTTTCTTTACTCC
2481 TTTGGCTTCAAAGGATTTTGGAAAAGAAACAATATGCTTTACACTCATTTTCAATTTCTAAATTTGCAGGGGATACTGAA
2561 AAATACGGCAGGTGGCCTAAGGCTGCTGTAAAGTTGAGGGGAGAGGAAATCTTAAGATTACAAGATAAAAAACGAATCCC
2641 CTAAACAAAAAGAACAATAGAACTGGTCTTCCATTTTGCCACCTTTCCTGTTCATGACAGCTACTAACCTGGAGACAGTA
2721 ACATTTCATTAACCAAAGAAAGTGGGTCACCTGACCTCTGAAGAGCTGAGTACTCAGGCCACTCCAATCACCCTACAAGA
2801 TGCCAAGGAGGTCCCAGGAAGTCCAGCTCCTTAAACTGACGCTAGTCAATAAACCTGGGCAAGTGAGGCAAGAGAAATGA
2881 GGAAGAATCCATCTGTGAGGTGACAGGCAAGGATGAAAGACAAAGAAGGAAAAGAGTATCAAAGGCAGAAAGGAGATCAT
2961 TTAGTTGGGTCTGAAAGGAAAAGTCTTTGCTATCCGACATGTACTGCTAGTACCTGTAAGCATTTTAGGTCCCAGAATGG
3041 AAAAAAAAATCAGCTATTGGTAATATAATAATGTCCTTTCCCTGGAGTCAGTTTTTTTAAAAAGTTAACTCTTAGTTTTT
3121 ACTTGTTTAATTCTAAAAGAGAAGGGAGCTGAGGCCATTCCCTGTAGGAGTAAAGATAAAAGGATAGGAAAAGATTCAAA
3201 GCTCTAATAGAGTCACAGCTTTCCCAGGTATAAAACCTAAAATTAAGAAGTACAATAAGCAGAGGTGGAAAATGATCTAG
3281 TTCCTGATAGCTACCCACAGAGCAAGTGATTTATAAATTTGAAATCCAAACTACTTTCTTAATATCACTTTGGTCTCCAT
3361 TTTTCCCAGGACAGGAAATATGTCCCCCCCTAACTTTCTTGCTTCAAAAATTAAAATCCAGCATCCCAAGATCATTCTAC
3441 AAGTAATTTTGCACAGACATCTCCTCACCCCAGTGCCTGTCTGGAGCTCACCCAAGGTCACCAAACAACTTGGTTGTGAA
3521 CCAACTGCCTTAACCTTCTGGGGGAGGGGGATTAGCTAGACTAGGAGACCAGAAGTGAATGGGAAAGGGTGAGGACTTCA
3601 CAATGTTGGCCTGTCAGAGCTTGATTAGAAGCCAAGACAGTGGCAGCAAAGGAAGACTTGGCCCAGGAAAAACCTGTGGG
3681 TTGTGCTAATTTCTGTCCAGAAAATAGGGTGGACAGAAGCTTGTGGGGTACATGGAGGAATTGGGACCTGGTTATGTTGT
3761 TATTCTCGGACTGTGAATTTTGGTGATGTAAAACAGAATATTCTGTAAACCTAATGTCTGTATAAATAATGAGCGTTAAC
3841 ACAGTAAAATATTCAATAAGAAGTCAAACTACTAGGGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||   || |  |||||||| 
Target 5' ccCACTGCACTTGGTGCTGCTt 3'
1782 - 1803 152.00 -14.60
2
miRNA  3' guGUUUGGUAAU---ACACGACGAu 5'
            :||::|:  |   | ||||||| 
Target 5' ttTAAGTCGGGAAATTCTGCTGCTt 3'
250 - 274 148.00 -12.22
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||  || | ||||:|||| 
Target 5' gcCAA--CACT-TGTGTTGCTt 3'
2302 - 2320 143.00 -14.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27139267 34 COSMIC
COSN24386814 37 COSMIC
COSN30513395 152 COSMIC
COSN31588070 258 COSMIC
COSN31597629 285 COSMIC
COSN8640922 294 COSMIC
COSN31521070 308 COSMIC
COSN28693623 404 COSMIC
COSN26563408 419 COSMIC
COSN30172156 459 COSMIC
COSN27450380 537 COSMIC
COSN31536120 579 COSMIC
COSN15816832 622 COSMIC
COSN6987823 691 COSMIC
COSN22729737 900 COSMIC
COSN26602912 987 COSMIC
COSN26599548 1069 COSMIC
COSN31563859 1489 COSMIC
COSN1127188 1511 COSMIC
COSN31540513 1532 COSMIC
COSN30172853 1566 COSMIC
COSN31588804 1618 COSMIC
COSN31608100 1773 COSMIC
COSN31516305 2039 COSMIC
COSN31529336 2082 COSMIC
COSN19331515 2106 COSMIC
COSN6607217 2110 COSMIC
COSN17078462 2211 COSMIC
COSN30172338 2211 COSMIC
COSN22273165 2278 COSMIC
COSN31593979 2716 COSMIC
COSN26639525 2733 COSMIC
COSN31610963 2790 COSMIC
COSN26641545 2928 COSMIC
COSN31578947 3040 COSMIC
COSN6987822 3273 COSMIC
COSN31521948 3383 COSMIC
COSN26585982 3426 COSMIC
COSN26586561 3610 COSMIC
rs1047964 3389 GWAS
rs7083 3730 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762211123 2 dbSNP
rs776217371 3 dbSNP
rs768342094 4 dbSNP
rs746532169 10 dbSNP
rs372325762 21 dbSNP
rs1422781860 22 dbSNP
rs766544710 23 dbSNP
rs886672493 25 dbSNP
rs763190161 27 dbSNP
rs772169913 28 dbSNP
rs1260167759 29 dbSNP
rs369658783 31 dbSNP
rs1490662184 40 dbSNP
rs1271631722 41 dbSNP
rs995237671 42 dbSNP
rs778962622 46 dbSNP
rs757066405 47 dbSNP
rs1242471267 73 dbSNP
rs983873388 91 dbSNP
rs540925095 92 dbSNP
rs939456229 110 dbSNP
rs528381748 111 dbSNP
rs114109066 113 dbSNP
rs1163548722 118 dbSNP
rs1042599013 120 dbSNP
rs1384407293 122 dbSNP
rs768227046 124 dbSNP
rs183787306 132 dbSNP
rs1319574773 135 dbSNP
rs1326144661 137 dbSNP
rs191264852 142 dbSNP
rs1295294216 148 dbSNP
rs945250680 149 dbSNP
rs1232941664 159 dbSNP
rs915139410 164 dbSNP
rs1353005221 168 dbSNP
rs1392111498 169 dbSNP
rs1393921509 170 dbSNP
rs1206761758 185 dbSNP
rs970129232 190 dbSNP
rs1022829280 192 dbSNP
rs989422104 193 dbSNP
rs1014076593 201 dbSNP
rs1446164429 201 dbSNP
rs1191211435 206 dbSNP
rs1259404219 208 dbSNP
rs748813568 211 dbSNP
rs1366147495 213 dbSNP
rs1454901567 215 dbSNP
rs189225075 218 dbSNP
rs1158457541 219 dbSNP
rs1384893638 225 dbSNP
rs998931558 226 dbSNP
rs1315137027 233 dbSNP
rs920951507 234 dbSNP
rs976471633 239 dbSNP
rs1291681862 253 dbSNP
rs1337543966 256 dbSNP
rs144770291 257 dbSNP
rs1015376751 258 dbSNP
rs1182090945 261 dbSNP
rs751152578 264 dbSNP
rs1349833688 266 dbSNP
rs183867623 270 dbSNP
rs1282184355 275 dbSNP
rs1250647961 279 dbSNP
rs574779424 282 dbSNP
rs555012044 283 dbSNP
rs1253676167 288 dbSNP
rs1468503629 292 dbSNP
rs537362914 301 dbSNP
rs1203252026 303 dbSNP
rs1438377477 304 dbSNP
rs758400657 323 dbSNP
rs944866639 326 dbSNP
rs912132999 329 dbSNP
rs1434493208 340 dbSNP
rs1301268373 352 dbSNP
rs995101318 359 dbSNP
rs528651428 369 dbSNP
rs192015960 370 dbSNP
rs1047941226 371 dbSNP
rs1306382386 384 dbSNP
rs1240097818 385 dbSNP
rs1348279795 387 dbSNP
rs1233316656 389 dbSNP
rs895126863 393 dbSNP
rs1301394319 399 dbSNP
rs866649180 401 dbSNP
rs535860 404 dbSNP
rs1197272001 407 dbSNP
rs1249191604 411 dbSNP
rs973385145 414 dbSNP
rs970160158 416 dbSNP
rs1195977038 421 dbSNP
rs566395502 430 dbSNP
rs1042514798 432 dbSNP
rs1454261486 435 dbSNP
rs1174360310 447 dbSNP
rs1375211239 448 dbSNP
rs559158000 449 dbSNP
rs1297837759 450 dbSNP
rs539268981 454 dbSNP
rs1327776506 463 dbSNP
rs1371607887 477 dbSNP
rs570503330 486 dbSNP
rs1159500293 493 dbSNP
rs1309098404 494 dbSNP
rs932571510 499 dbSNP
rs1250418063 505 dbSNP
rs757104707 512 dbSNP
rs1214993270 517 dbSNP
rs976396938 519 dbSNP
rs777553664 525 dbSNP
rs34110772 530 dbSNP
rs78296456 531 dbSNP
rs998764812 535 dbSNP
rs1454340086 536 dbSNP
rs1240943384 537 dbSNP
rs968604662 538 dbSNP
rs1021273038 546 dbSNP
rs996438075 548 dbSNP
rs1463253564 549 dbSNP
rs982559141 549 dbSNP
rs777699306 550 dbSNP
rs1393921229 553 dbSNP
rs1435652834 560 dbSNP
rs758404287 561 dbSNP
rs866630508 564 dbSNP
rs920790426 566 dbSNP
rs950908181 566 dbSNP
rs1382602577 570 dbSNP
rs1277126068 571 dbSNP
rs530519233 573 dbSNP
rs1234825545 574 dbSNP
rs756941785 577 dbSNP
rs142434873 578 dbSNP
rs1486371866 579 dbSNP
rs575378545 580 dbSNP
rs1261526249 585 dbSNP
rs1476305749 586 dbSNP
rs1188987947 587 dbSNP
rs1048357588 588 dbSNP
rs1021419184 592 dbSNP
rs1278487174 593 dbSNP
rs1009674631 595 dbSNP
rs893603418 596 dbSNP
rs1269671049 597 dbSNP
rs765431872 599 dbSNP
rs1429316593 601 dbSNP
rs755195807 613 dbSNP
rs1053615732 616 dbSNP
rs1328673675 625 dbSNP
rs929569448 627 dbSNP
rs754121124 630 dbSNP
rs1319509505 631 dbSNP
rs1377763054 633 dbSNP
rs1226143396 637 dbSNP
rs1434508822 642 dbSNP
rs766605782 646 dbSNP
rs1318010523 650 dbSNP
rs188431739 656 dbSNP
rs34580925 657 dbSNP
rs1037719306 662 dbSNP
rs948676886 665 dbSNP
rs1284303891 667 dbSNP
rs528342713 684 dbSNP
rs559238761 693 dbSNP
rs551939234 695 dbSNP
rs1486864147 698 dbSNP
rs915985603 708 dbSNP
rs899748840 709 dbSNP
rs1179002016 713 dbSNP
rs1408892264 718 dbSNP
rs992894317 728 dbSNP
rs960393821 732 dbSNP
rs1157987303 736 dbSNP
rs1184234714 742 dbSNP
rs1358319870 748 dbSNP
rs1436393552 755 dbSNP
rs924509051 760 dbSNP
rs761116221 767 dbSNP
rs1476375573 768 dbSNP
rs28989506 769 dbSNP
rs1358199066 778 dbSNP
rs1041018644 780 dbSNP
rs943653260 784 dbSNP
rs1373497940 785 dbSNP
rs773792356 786 dbSNP
rs1307712427 792 dbSNP
rs563793798 792 dbSNP
rs1235508370 793 dbSNP
rs79351574 797 dbSNP
rs1278419962 798 dbSNP
rs968617548 803 dbSNP
rs35615085 804 dbSNP
rs908203524 807 dbSNP
rs1206960641 810 dbSNP
rs1259279113 817 dbSNP
rs1047227576 823 dbSNP
rs931088439 826 dbSNP
rs1213378455 827 dbSNP
rs1455573685 831 dbSNP
rs1174002468 849 dbSNP
rs1021471070 861 dbSNP
rs1412383719 862 dbSNP
rs1172103391 882 dbSNP
rs1272443493 883 dbSNP
rs1445439840 887 dbSNP
rs973523270 893 dbSNP
rs34502557 894 dbSNP
rs878946683 900 dbSNP
rs1212912279 905 dbSNP
rs1373799936 910 dbSNP
rs1341495931 917 dbSNP
rs1442334347 920 dbSNP
rs1274616519 928 dbSNP
rs1343331962 934 dbSNP
rs959571116 935 dbSNP
rs1274018102 943 dbSNP
rs1317324385 953 dbSNP
rs1271297332 956 dbSNP
rs1255009890 961 dbSNP
rs926869511 964 dbSNP
rs147682677 967 dbSNP
rs1414630272 975 dbSNP
rs982336035 977 dbSNP
rs1354030666 984 dbSNP
rs1476919710 991 dbSNP
rs1169243643 1003 dbSNP
rs1315162103 1003 dbSNP
rs996469046 1007 dbSNP
rs1167880634 1023 dbSNP
rs963712843 1033 dbSNP
rs1462372055 1042 dbSNP
rs1020968326 1048 dbSNP
rs1411177090 1053 dbSNP
rs1433357206 1060 dbSNP
rs768208733 1065 dbSNP
rs1019689577 1066 dbSNP
rs574879092 1070 dbSNP
rs963188169 1085 dbSNP
rs530105406 1094 dbSNP
rs958129931 1098 dbSNP
rs556927526 1102 dbSNP
rs886839286 1104 dbSNP
rs1259427278 1108 dbSNP
rs1188367072 1113 dbSNP
rs1335559833 1115 dbSNP
rs1210284790 1118 dbSNP
rs762543853 1123 dbSNP
rs1289097086 1133 dbSNP
rs1449605680 1138 dbSNP
rs1195033431 1140 dbSNP
rs1026513816 1142 dbSNP
rs1263681599 1170 dbSNP
rs1477288734 1175 dbSNP
rs1480162915 1177 dbSNP
rs1419307588 1178 dbSNP
rs1475267856 1186 dbSNP
rs1163137554 1193 dbSNP
rs1389180902 1195 dbSNP
rs561238337 1199 dbSNP
rs1319389735 1203 dbSNP
rs996676328 1205 dbSNP
rs899676963 1209 dbSNP
rs481285 1212 dbSNP
rs1008164631 1215 dbSNP
rs886744404 1216 dbSNP
rs182783303 1222 dbSNP
rs899434512 1226 dbSNP
rs1233273342 1228 dbSNP
rs930996292 1231 dbSNP
rs377523426 1242 dbSNP
rs755656769 1243 dbSNP
rs919682497 1259 dbSNP
rs28989507 1261 dbSNP
rs1295542087 1266 dbSNP
rs894513530 1266 dbSNP
rs1471432255 1275 dbSNP
rs926812638 1285 dbSNP
rs1372995332 1287 dbSNP
rs1418291912 1289 dbSNP
rs1296107820 1294 dbSNP
rs1314948809 1301 dbSNP
rs1057441535 1306 dbSNP
rs1443841084 1316 dbSNP
rs149986878 1318 dbSNP
rs924659617 1319 dbSNP
rs1332270010 1322 dbSNP
rs914163274 1328 dbSNP
rs1241014894 1331 dbSNP
rs977241456 1338 dbSNP
rs1352647399 1340 dbSNP
rs958315694 1347 dbSNP
rs1282248406 1352 dbSNP
rs1419905624 1356 dbSNP
rs1032395431 1358 dbSNP
rs752180000 1360 dbSNP
rs1439051762 1361 dbSNP
rs576602947 1371 dbSNP
rs1418294292 1373 dbSNP
rs1405431563 1383 dbSNP
rs1238127959 1385 dbSNP
rs1438441926 1387 dbSNP
rs1175886465 1388 dbSNP
rs947180697 1391 dbSNP
rs539435922 1396 dbSNP
rs556729680 1400 dbSNP
rs963846935 1407 dbSNP
rs1398677215 1414 dbSNP
rs1330820463 1415 dbSNP
rs1392056923 1415 dbSNP
rs1238920150 1417 dbSNP
rs1213110423 1422 dbSNP
rs1047857 1424 dbSNP
rs975335718 1425 dbSNP
rs887009136 1431 dbSNP
rs139237650 1432 dbSNP
rs1231997968 1434 dbSNP
rs190115472 1444 dbSNP
rs1305305220 1449 dbSNP
rs1019298867 1450 dbSNP
rs770570775 1457 dbSNP
rs986859531 1459 dbSNP
rs1198703737 1463 dbSNP
rs546025608 1464 dbSNP
rs1456822709 1469 dbSNP
rs1196119489 1474 dbSNP
rs1268424610 1487 dbSNP
rs1432999949 1500 dbSNP
rs1302114658 1501 dbSNP
rs1438101634 1506 dbSNP
rs28989508 1507 dbSNP
rs1374979498 1516 dbSNP
rs746809411 1519 dbSNP
rs1170051488 1520 dbSNP
rs1294044282 1524 dbSNP
rs777680867 1535 dbSNP
rs763444410 1536 dbSNP
rs1295220321 1537 dbSNP
rs757012233 1542 dbSNP
rs1025376405 1544 dbSNP
rs993668192 1545 dbSNP
rs78957731 1546 dbSNP
rs1218936135 1550 dbSNP
rs1256856002 1555 dbSNP
rs1315546892 1558 dbSNP
rs899300238 1559 dbSNP
rs906991759 1572 dbSNP
rs1266568827 1575 dbSNP
rs1488467584 1581 dbSNP
rs1046532012 1587 dbSNP
rs758387876 1588 dbSNP
rs1016436017 1589 dbSNP
rs1193228407 1591 dbSNP
rs1421483894 1593 dbSNP
rs1452676703 1604 dbSNP
rs1254896673 1613 dbSNP
rs565617311 1617 dbSNP
rs28989509 1618 dbSNP
rs185295326 1619 dbSNP
rs1350378050 1629 dbSNP
rs577757296 1630 dbSNP
rs1362287839 1632 dbSNP
rs748203323 1649 dbSNP
rs1400171272 1654 dbSNP
rs938656301 1659 dbSNP
rs563291305 1661 dbSNP
rs1229515422 1663 dbSNP
rs1312857786 1665 dbSNP
rs1041747111 1676 dbSNP
rs1279174289 1678 dbSNP
rs947467244 1679 dbSNP
rs964110250 1685 dbSNP
rs180978310 1687 dbSNP
rs1372620995 1692 dbSNP
rs1488822594 1699 dbSNP
rs986648066 1701 dbSNP
rs914445434 1710 dbSNP
rs200219385 1721 dbSNP
rs755108691 1732 dbSNP
rs1025524364 1733 dbSNP
rs1381628339 1735 dbSNP
rs1413251853 1736 dbSNP
rs1359743642 1744 dbSNP
rs1162615197 1750 dbSNP
rs139356113 1750 dbSNP
rs942661424 1753 dbSNP
rs1374565016 1764 dbSNP
rs898139357 1764 dbSNP
rs1358198365 1765 dbSNP
rs577970672 1787 dbSNP
rs986502359 1789 dbSNP
rs1302900910 1790 dbSNP
rs561399394 1791 dbSNP
rs951080332 1800 dbSNP
rs750544060 1821 dbSNP
rs1176856512 1824 dbSNP
rs1239854114 1825 dbSNP
rs1354809755 1825 dbSNP
rs1284378846 1826 dbSNP
rs1350322578 1833 dbSNP
rs541413972 1839 dbSNP
rs765160462 1842 dbSNP
rs1482320617 1843 dbSNP
rs372581846 1851 dbSNP
rs1239910323 1852 dbSNP
rs1440282293 1857 dbSNP
rs1157820864 1860 dbSNP
rs1188741968 1872 dbSNP
rs1415761194 1874 dbSNP
rs962453734 1890 dbSNP
rs949548556 1897 dbSNP
rs1016465817 1908 dbSNP
rs1052679855 1912 dbSNP
rs11540911 1916 dbSNP
rs1446784524 1917 dbSNP
rs1013489932 1925 dbSNP
rs1370202510 1930 dbSNP
rs1219966661 1950 dbSNP
rs959003447 1955 dbSNP
rs1257247152 1960 dbSNP
rs1310715552 1975 dbSNP
rs780331183 1982 dbSNP
rs572516883 1983 dbSNP
rs1002881195 1988 dbSNP
rs903223887 2001 dbSNP
rs552923507 2006 dbSNP
rs1236060464 2007 dbSNP
rs1011640619 2008 dbSNP
rs545338170 2011 dbSNP
rs576680711 2013 dbSNP
rs1393434416 2015 dbSNP
rs552962052 2022 dbSNP
rs893208439 2026 dbSNP
rs1226096504 2032 dbSNP
rs1329916832 2043 dbSNP
rs534930806 2043 dbSNP
rs987297207 2045 dbSNP
rs1039553227 2049 dbSNP
rs146245082 2052 dbSNP
rs1365750247 2054 dbSNP
rs912483894 2055 dbSNP
rs918433316 2056 dbSNP
rs1278857581 2057 dbSNP
rs1051419321 2058 dbSNP
rs1197885231 2059 dbSNP
rs190762131 2066 dbSNP
rs962584926 2075 dbSNP
rs1221994584 2078 dbSNP
rs1245982444 2079 dbSNP
rs1310833563 2089 dbSNP
rs1195420030 2098 dbSNP
rs1169103790 2109 dbSNP
rs764076131 2109 dbSNP
rs45497100 2114 dbSNP
rs1303607294 2119 dbSNP
rs1406528006 2123 dbSNP
rs528722309 2123 dbSNP
rs973717109 2124 dbSNP
rs554273984 2125 dbSNP
rs1402004038 2132 dbSNP
rs1299061560 2134 dbSNP
rs555630776 2135 dbSNP
rs1216846476 2146 dbSNP
rs1173532814 2160 dbSNP
rs187577640 2165 dbSNP
rs1358380394 2171 dbSNP
rs1163862717 2176 dbSNP
rs182042107 2177 dbSNP
rs1489800169 2188 dbSNP
rs916308089 2194 dbSNP
rs1263485392 2201 dbSNP
rs991674373 2213 dbSNP
rs371136858 2215 dbSNP
rs1417654247 2219 dbSNP
rs1053018643 2220 dbSNP
rs1473377791 2224 dbSNP
rs1001055346 2228 dbSNP
rs1486835631 2230 dbSNP
rs904100160 2237 dbSNP
rs1040013322 2242 dbSNP
rs1360094530 2248 dbSNP
rs1398460786 2249 dbSNP
rs369798383 2252 dbSNP
rs12288248 2261 dbSNP
rs1479374917 2265 dbSNP
rs1341161043 2267 dbSNP
rs1448585070 2268 dbSNP
rs912568386 2270 dbSNP
rs1356945104 2271 dbSNP
rs1252548219 2273 dbSNP
rs1352509134 2274 dbSNP
rs1203019732 2280 dbSNP
rs1219237739 2282 dbSNP
rs1257576964 2285 dbSNP
rs1442523355 2289 dbSNP
rs1003575926 2290 dbSNP
rs375256678 2291 dbSNP
rs752139307 2301 dbSNP
rs1380139056 2302 dbSNP
rs552151980 2302 dbSNP
rs1234942417 2319 dbSNP
rs974310915 2333 dbSNP
rs1174544072 2335 dbSNP
rs1020270115 2339 dbSNP
rs1011503229 2341 dbSNP
rs1332332415 2343 dbSNP
rs1335124275 2350 dbSNP
rs1448980031 2352 dbSNP
rs893241319 2354 dbSNP
rs1309639213 2358 dbSNP
rs962552231 2359 dbSNP
rs534893415 2362 dbSNP
rs1333418809 2364 dbSNP
rs1199356708 2366 dbSNP
rs979993114 2370 dbSNP
rs1459474411 2376 dbSNP
rs138603306 2381 dbSNP
rs1394433479 2388 dbSNP
rs890988808 2389 dbSNP
rs1417740562 2393 dbSNP
rs28989510 2397 dbSNP
rs929903403 2400 dbSNP
rs1174349550 2409 dbSNP
rs1473985857 2424 dbSNP
rs1369347771 2442 dbSNP
rs747147618 2443 dbSNP
rs1180728506 2454 dbSNP
rs1402561287 2457 dbSNP
rs1467058917 2464 dbSNP
rs1331993657 2468 dbSNP
rs918495534 2469 dbSNP
rs1239519251 2470 dbSNP
rs1038057070 2483 dbSNP
rs1303184033 2491 dbSNP
rs1467608015 2494 dbSNP
rs1032799103 2506 dbSNP
rs878928164 2506 dbSNP
rs549692327 2515 dbSNP
rs1215428699 2529 dbSNP
rs1199779995 2535 dbSNP
rs1356866054 2550 dbSNP
rs573620079 2556 dbSNP
rs916339360 2566 dbSNP
rs1479972375 2567 dbSNP
rs377288810 2573 dbSNP
rs991007970 2574 dbSNP
rs894665015 2576 dbSNP
rs1197541529 2583 dbSNP
rs960482565 2590 dbSNP
rs1425816112 2599 dbSNP
rs1478201815 2600 dbSNP
rs1170119738 2618 dbSNP
rs928819360 2619 dbSNP
rs28989511 2620 dbSNP
rs1311686515 2622 dbSNP
rs1295054853 2634 dbSNP
rs1391208793 2635 dbSNP
rs1403885342 2638 dbSNP
rs1300943060 2641 dbSNP
rs1341786654 2643 dbSNP
rs190505132 2648 dbSNP
rs1447635493 2655 dbSNP
rs1306268390 2658 dbSNP
rs891098910 2658 dbSNP
rs184627161 2660 dbSNP
rs967616225 2669 dbSNP
rs1266334279 2677 dbSNP
rs1370262254 2678 dbSNP
rs1051518009 2680 dbSNP
rs1265576700 2681 dbSNP
rs775710527 2683 dbSNP
rs527797262 2687 dbSNP
rs1193032213 2694 dbSNP
rs1259806355 2696 dbSNP
rs1426608583 2700 dbSNP
rs897224117 2712 dbSNP
rs372565851 2716 dbSNP
rs1391976881 2717 dbSNP
rs1362030938 2732 dbSNP
rs957334416 2741 dbSNP
rs941160505 2749 dbSNP
rs1451230350 2755 dbSNP
rs149465460 2756 dbSNP
rs1007426890 2759 dbSNP
rs979962269 2761 dbSNP
rs545411014 2766 dbSNP
rs1178816292 2771 dbSNP
rs1398261857 2789 dbSNP
rs531877381 2790 dbSNP
rs1314095525 2793 dbSNP
rs1453285781 2794 dbSNP
rs949960079 2796 dbSNP
rs1244196083 2798 dbSNP
rs891195387 2803 dbSNP
rs759096555 2807 dbSNP
rs563231030 2813 dbSNP
rs1240366347 2814 dbSNP
rs1484297339 2823 dbSNP
rs1029940180 2840 dbSNP
rs993974695 2841 dbSNP
rs776079662 2844 dbSNP
rs542832668 2851 dbSNP
rs1452084184 2856 dbSNP
rs770681672 2857 dbSNP
rs1181521010 2858 dbSNP
rs1419870609 2865 dbSNP
rs1157954389 2866 dbSNP
rs760449362 2872 dbSNP
rs1203194862 2876 dbSNP
rs573945243 2878 dbSNP
rs553953651 2891 dbSNP
rs1302958485 2897 dbSNP
rs894841537 2899 dbSNP
rs649555 2904 dbSNP
rs771886386 2911 dbSNP
rs1378120034 2919 dbSNP
rs1033141652 2922 dbSNP
rs1314218108 2927 dbSNP
rs1210869192 2933 dbSNP
rs1255553944 2934 dbSNP
rs978509793 2935 dbSNP
rs1201705805 2937 dbSNP
rs1239728405 2945 dbSNP
rs1440101320 2951 dbSNP
rs28989512 2957 dbSNP
rs28989513 2962 dbSNP
rs1332149638 2976 dbSNP
rs1404736667 2986 dbSNP
rs558232844 2996 dbSNP
rs778925458 2999 dbSNP
rs946180616 3000 dbSNP
rs867633062 3002 dbSNP
rs538659855 3008 dbSNP
rs569825879 3010 dbSNP
rs1029948080 3021 dbSNP
rs1441910378 3024 dbSNP
rs1278189297 3025 dbSNP
rs1380910305 3029 dbSNP
rs1362786958 3035 dbSNP
rs1158883196 3038 dbSNP
rs1433696878 3039 dbSNP
rs1392771640 3040 dbSNP
rs201057843 3050 dbSNP
rs1478045117 3051 dbSNP
rs1321515925 3058 dbSNP
rs1201636092 3059 dbSNP
rs1438366825 3064 dbSNP
rs1241468179 3072 dbSNP
rs897158490 3075 dbSNP
rs1250768041 3076 dbSNP
rs60447629 3087 dbSNP
rs990396411 3090 dbSNP
rs536439551 3098 dbSNP
rs1427943630 3099 dbSNP
rs1044189273 3109 dbSNP
rs1263623382 3122 dbSNP
rs1217697962 3128 dbSNP
rs1424934273 3139 dbSNP
rs1409964965 3143 dbSNP
rs1327254100 3148 dbSNP
rs188716928 3153 dbSNP
rs949951417 3156 dbSNP
rs917143990 3162 dbSNP
rs1347401712 3168 dbSNP
rs1276640495 3169 dbSNP
rs1302799621 3175 dbSNP
rs1343923461 3179 dbSNP
rs988749936 3182 dbSNP
rs1018716982 3185 dbSNP
rs1221047801 3187 dbSNP
rs985467521 3196 dbSNP
rs955658351 3198 dbSNP
rs879443960 3201 dbSNP
rs1029725414 3204 dbSNP
rs1323314254 3207 dbSNP
rs1222711311 3210 dbSNP
rs1267710079 3225 dbSNP
rs994007564 3226 dbSNP
rs1263345733 3227 dbSNP
rs1475341198 3240 dbSNP
rs1166669550 3244 dbSNP
rs1416360840 3245 dbSNP
rs1406296382 3253 dbSNP
rs28989514 3258 dbSNP
rs964443967 3261 dbSNP
rs1016772511 3264 dbSNP
rs1373268762 3265 dbSNP
rs1335725645 3273 dbSNP
rs749455008 3275 dbSNP
rs1325932089 3278 dbSNP
rs1017406196 3281 dbSNP
rs895048847 3286 dbSNP
rs28989515 3288 dbSNP
rs1246402936 3297 dbSNP
rs1290854376 3298 dbSNP
rs1356807535 3300 dbSNP
rs939006613 3302 dbSNP
rs141853466 3310 dbSNP
rs1284271268 3315 dbSNP
rs906277201 3319 dbSNP
rs1190456742 3320 dbSNP
rs1239692223 3334 dbSNP
rs1030287597 3337 dbSNP
rs551469937 3342 dbSNP
rs1166155193 3349 dbSNP
rs1183353797 3359 dbSNP
rs139297420 3362 dbSNP
rs1424133477 3365 dbSNP
rs756458668 3369 dbSNP
rs1421677264 3382 dbSNP
rs775784640 3383 dbSNP
rs565693313 3384 dbSNP
rs1005533699 3388 dbSNP
rs1047964 3389 dbSNP
rs757715251 3390 dbSNP
rs1443084011 3391 dbSNP
rs1272377092 3392 dbSNP
rs879032440 3403 dbSNP
rs184140400 3426 dbSNP
rs1280195451 3427 dbSNP
rs1462109110 3430 dbSNP
rs1203590018 3439 dbSNP
rs1320578788 3441 dbSNP
rs1241640972 3454 dbSNP
rs1208670484 3455 dbSNP
rs571792562 3459 dbSNP
rs1183048736 3461 dbSNP
rs1279343180 3463 dbSNP
rs1363408809 3467 dbSNP
rs1468858711 3468 dbSNP
rs751950078 3481 dbSNP
rs528807974 3496 dbSNP
rs764663717 3503 dbSNP
rs758964120 3509 dbSNP
rs1336039570 3534 dbSNP
rs146777719 3539 dbSNP
rs1403575241 3540 dbSNP
rs922588061 3541 dbSNP
rs1014467816 3543 dbSNP
rs1236442215 3550 dbSNP
rs544672445 3551 dbSNP
rs961433533 3557 dbSNP
rs1323662743 3566 dbSNP
rs1053421348 3567 dbSNP
rs1261789680 3591 dbSNP
rs753444396 3596 dbSNP
rs1285597549 3599 dbSNP
rs1196742153 3606 dbSNP
rs1016805268 3623 dbSNP
rs1250326113 3631 dbSNP
rs765924282 3632 dbSNP
rs760359513 3638 dbSNP
rs959569917 3641 dbSNP
rs1353475076 3657 dbSNP
rs561320153 3659 dbSNP
rs28989517 3662 dbSNP
rs943051346 3663 dbSNP
rs906232510 3673 dbSNP
rs771796796 3674 dbSNP
rs1463512403 3676 dbSNP
rs1298472398 3683 dbSNP
rs1395507447 3685 dbSNP
rs1042035402 3686 dbSNP
rs1389282309 3697 dbSNP
rs1009295635 3707 dbSNP
rs1325141492 3709 dbSNP
rs1345804965 3723 dbSNP
rs1403767744 3728 dbSNP
rs7083 3730 dbSNP
rs536505160 3741 dbSNP
rs1228811184 3748 dbSNP
rs1251048935 3750 dbSNP
rs1337895198 3751 dbSNP
rs936162419 3756 dbSNP
rs1269844924 3767 dbSNP
rs567589741 3768 dbSNP
rs911468066 3780 dbSNP
rs553977184 3782 dbSNP
rs1265440777 3783 dbSNP
rs1430161903 3784 dbSNP
rs1473243561 3797 dbSNP
rs1232410835 3800 dbSNP
rs1372238759 3805 dbSNP
rs934232358 3814 dbSNP
rs1459104513 3823 dbSNP
rs961633135 3834 dbSNP
rs1259280319 3835 dbSNP
rs1048162 3841 dbSNP
rs552960790 3842 dbSNP
rs1363460581 3843 dbSNP
rs749000939 3849 dbSNP
rs774152890 3852 dbSNP
rs1383232232 3857 dbSNP
rs3180616 3864 dbSNP
rs534011558 3867 dbSNP
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
     
Conditions HeLa - SK-N-SH
Location of target site 3'UTR
Original Description (Extracted from the article) ... We found that miR-29a (P = 0.008, Wilcoxon signed-rank test), miR-29b-1 (P = 0.0313), and miR-9 (P = 0.0313) affected significantly luciferase expression (Fig. 3B), whereas miR-15a, -19b, and -124a showed no effect in this assay. We could confirm that miR-29a and -29b-1 showed coregulated expression with BACE1 in brain development and AD (see below), whereas we did not find such correlation for miR-9 ...

- Hebert SS; Horre K; Nicolai L; Papadopoulou et al., 2008, Proceedings of the National Academy of Sciences of the United States of America.

Article - Hebert SS; Horre K; Nicolai L; Papadopoulou et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
Although the role of APP and PSEN genes in genetic Alzheimer's disease (AD) cases is well established, fairly little is known about the molecular mechanisms affecting Abeta generation in sporadic AD. Deficiency in Abeta clearance is certainly a possibility, but increased expression of proteins like APP or BACE1/beta-secretase may also be associated with the disease. We therefore investigated changes in microRNA (miRNA) expression profiles of sporadic AD patients and found that several miRNAs potentially involved in the regulation of APP and BACE1 expression appeared to be decreased in diseased brain. We show here that miR-29a, -29b-1, and -9 can regulate BACE1 expression in vitro. The miR-29a/b-1 cluster was significantly (and AD-dementia-specific) decreased in AD patients displaying abnormally high BACE1 protein. Similar correlations between expression of this cluster and BACE1 were found during brain development and in primary neuronal cultures. Finally, we provide evidence for a potential causal relationship between miR-29a/b-1 expression and Abeta generation in a cell culture model. We propose that loss of specific miRNAs can contribute to increased BACE1 and Abeta levels in sporadic AD.
LinkOut: [PMID: 18434550]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*