miRTarBase - #MIRT003081 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANK2   
Synonyms ANK-2, LQT4, brank-2
Description ankyrin 2
Transcript NM_001127493   
Other Transcripts NM_001148 , NM_020977   
Expression
Putative miRNA Targets on ANK2
3'UTR of ANK2
(miRNA target sites are highlighted)
>ANK2|NM_001127493|3'UTR
   1 AGCCATCACACAGAAGAGGGCTGTGGTGAAGGACCAGCATGGAAAACGCATTGACTTGGAGCACCTGGAGGATGTACCAG
  81 AAGCACTAGACCAGGACGACCTCCAGCGCGATCTCCAGCAGCTCCTTCGGCATTTCTGCAAGGAGGACTTGAAGCAAGAG
 161 GCCAAGTGAGGGGCTGCCCAGTTCTCACACCAGAAACCACACATTCACTCAATATGCAGCTTCCTGTTTCAGTAGGGGAG
 241 TGACCTAACTGGCCTAATTAATGGGATACCCCGACATTTCCACTGTTAGCAAATATACGGCATTTTGCTTTAGTTTTCCC
 321 CCATCCTCTTTAACTATAAAGCTAATTTGTGACCAAAGATGGCATCCTTCATACTGGATGCTGTATCCAATACTTTGTTG
 401 TGTCTGTGCTAACCTGGGAACTGGCCACCTCCATTGTTCTTTGCTTCTGCACAAGATCCATGAAAATCCATTGATCAGAA
 481 GAACTTCACCTGCAGACCTCTTCAAGTGACACTATGTAGGAATCCTTCCAAGGAATATCTATGTACAATGTATATAGCTG
 561 AAATGCTCAGATGAACAACATATTAAAATTAAAACCACTGCCTATTGTAACTACACTGGGCATCAGAATAAAAGGCCTCT
 641 AGAAATTGCTGAACAATGGTTAATTAAGATATTGCTAACACAATCGAGTGATAATACAGTTTTACTGCAAAAGAAGCACT
 721 TCAAACCTATTATGTCCTTAGAACTTCCAGAGTAGCCACTGCTCCCAGTTAAAGGTGGGTCAGTAGCCTTGCAGAACTGT
 801 CCTGAGAAGTTATTGCTGGTGCTGGCCAGCCATGGCTTAGGACTCCAACAGCCACTCTGAGGGAGGGGAGAAGGGAGCAG
 881 AGGCCACGCAGAATGAACCGATGGGGTATTCAGTTGCTGGCAGCTACATTGTGTGGCATTCTAGCATCTTCAGGTCTTTA
 961 GATCTTGGACAAGTTGGCAGGGTATTTTAAAAGCTATAACTACTGTAGTTTTCCAGTTTTCATTGCTGCTTTAGCAAACC
1041 ACGCTGTCTTACAGTGGTACTTTCTTCTGGCCACTGCACTGTAGATAATTCATTGGAAACAAGATTTACCCACTACATAA
1121 AAGGTTAAACTCCTTCAGTATGTTGGAGTGGTTTCTTTTTTTTTTTCTTTCTTTCTTTTTTTTCTTCAGGTTTATATCTT
1201 CTCTAATACCTGCATGTGGCGTTTAAAAATCAAGACCACGGTCAAACCCCTCTTCTAATCACATTAATTGTTTCCATTCT
1281 TTTTACCCTGAGTGAGCACTTTTCACTTTCCAGCTAGGTCTGTTTTTCAGCTTGCAGACAAGATTGAGAAATCCTTGAAA
1361 ATTTGGTTTTGGTTAAAATTTTTGGTTTATTTATTTGAAATCCACACTCCCTTGGAAACTCTTAAGTGCATTTGTGCACT
1441 TCTGTTTGTTTGTCTCAAAGAAGGGACTGTAACAATCTGAGTAATTTCCATGTCCTCTTCCTTATTCCTCTAGTGGTTGA
1521 AGCTGTGTAGCATTTTAACATATATATATTCACAAATATATTCATATAAACAGTATACATTTTGAATCAGTCATTTGTTA
1601 AAGAAAAGTATATTCAATGAAGATGAAATTTAAATAAAAAAGGACAGAGTCTATCCTCCAGGGATTGAACATTTTCCAAT
1681 TATCTGGTCTTTTCCTGTTGTGCAAAAATGACTCATTGCTCCGAATGTCAAAAACAAATGCGACAAACAATGGCACTTCA
1761 TCATTTAAAGTAATGTTGCCAAGAGAAAAAATTTCCTGGGAGGGAGGTTTCCCACAAGCCAAATCTCCTAAGCCTCAAAT
1841 GCTAGCACTTTTTGGCAGTTGGATAGGAAATGAGACATTCTTTGGCAGCCAAAATAAGAGAGGCCGATGGTGAAACTTTT
1921 TGAGACACCCTATGGCCTTCTTGTCAAAACCTTCACTGGAGCTCAAGAAAAGCATTTCTGTTGTGTTATTTGCAGTGCAG
2001 ATGATGTCTGTGTAACAACATAATGGTTATTCACCTTTTTTTGATTTTGATTTTTGCTGTGTTATCAAAAACTTGAATAC
2081 TGTGAGAAGAAGTGAATTTTCAGTTGACGAATCAGCATCTTGTTCCCATGGTGATAACACTAATTGAATATATCTATGAG
2161 GGCATGTATTAGTTAATGGAAAAAAAAATACAACACTAACAATACATAGCTGCAATGTGTACAATGGCTGATTTAATTAA
2241 ATAAAATGTACAAGTGTTAAATGTGGCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       |||||||| 
Target 5' tttatttgaaatcCACACTCCc 3'
1390 - 1411 145.00 -12.00
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:::|  |||| :||||:| 
Target 5' taAGTGCATTTGT-GCACTTCt 3'
1423 - 1443 127.00 -13.30
3
miRNA  3' guuUGUG-GUAACAGUGUGAGGu 5'
             |||:  |  ||:| ||||| 
Target 5' actACATAAAAGGTTAAACTCCt 3'
1112 - 1134 123.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
136400 8 ClinVar
347351 48 ClinVar
347352 74 ClinVar
902275 75 ClinVar
902276 95 ClinVar
347353 109 ClinVar
191418 141 ClinVar
903141 237 ClinVar
903142 244 ClinVar
903143 300 ClinVar
347354 447 ClinVar
903144 521 ClinVar
347355 534 ClinVar
347356 636 ClinVar
347357 648 ClinVar
903145 709 ClinVar
903146 841 ClinVar
899521 844 ClinVar
899522 907 ClinVar
347358 909 ClinVar
347359 929 ClinVar
899523 952 ClinVar
347360 957 ClinVar
899524 1118 ClinVar
347361 1156 ClinVar
347362 1240 ClinVar
900598 1397 ClinVar
347363 1611 ClinVar
347364 1742 ClinVar
900599 1755 ClinVar
900600 1789 ClinVar
347365 1800 ClinVar
347366 1951 ClinVar
900601 1952 ClinVar
900602 1966 ClinVar
347367 2011 ClinVar
347368 2109 ClinVar
COSN30498459 2 COSMIC
COSN31515098 6 COSMIC
COSN30101242 10 COSMIC
COSN30132113 14 COSMIC
COSN30471853 43 COSMIC
COSN31480430 48 COSMIC
COSN2382532 49 COSMIC
COSN31491644 62 COSMIC
COSN30530221 79 COSMIC
COSN30104924 80 COSMIC
COSN25350183 91 COSMIC
COSN30166287 96 COSMIC
COSN30138551 98 COSMIC
COSN31580210 101 COSMIC
COSN20057484 108 COSMIC
COSN30505386 109 COSMIC
COSN30752143 110 COSMIC
COSN14090034 111 COSMIC
COSN30140480 129 COSMIC
COSN30161309 137 COSMIC
COSN30577957 273 COSMIC
COSN6791457 300 COSMIC
COSN31512945 370 COSMIC
COSN30165397 471 COSMIC
COSN31575979 608 COSMIC
COSN31519557 812 COSMIC
COSN25823481 889 COSMIC
COSN31962321 930 COSMIC
COSN26649552 1026 COSMIC
COSN32058756 1096 COSMIC
COSN31539020 1107 COSMIC
COSN31561962 1158 COSMIC
COSN31541935 1164 COSMIC
COSN9585324 1176 COSMIC
COSN32106768 1333 COSMIC
COSN30172269 1478 COSMIC
COSN29350326 1522 COSMIC
COSN26621689 1569 COSMIC
COSN5050917 1608 COSMIC
COSN31582609 1631 COSMIC
COSN16043635 1688 COSMIC
COSN31532721 1780 COSMIC
COSN20091098 2006 COSMIC
COSN19568370 2129 COSMIC
COSN27260695 2189 COSMIC
COSN31562863 2189 COSMIC
COSN31571591 2191 COSMIC
COSN8370127 2232 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200250942 4 dbSNP
rs35446871 8 dbSNP
rs1331039077 10 dbSNP
rs546864425 12 dbSNP
rs771704541 13 dbSNP
rs779879367 20 dbSNP
rs746831163 21 dbSNP
rs1235292118 28 dbSNP
rs1472241482 29 dbSNP
rs371328203 33 dbSNP
rs1277373548 36 dbSNP
rs776659840 37 dbSNP
rs865981540 39 dbSNP
rs761605278 41 dbSNP
rs1428548567 43 dbSNP
rs1016673917 44 dbSNP
rs770041429 48 dbSNP
rs773394091 49 dbSNP
rs763325510 50 dbSNP
rs374681713 51 dbSNP
rs773932179 52 dbSNP
rs751667239 55 dbSNP
rs1352038903 57 dbSNP
rs1465857897 58 dbSNP
rs759977804 59 dbSNP
rs767727113 60 dbSNP
rs1309741411 62 dbSNP
rs1345661065 63 dbSNP
rs1202146013 66 dbSNP
rs753299388 74 dbSNP
rs567890291 77 dbSNP
rs756585334 81 dbSNP
rs1440732806 93 dbSNP
rs778466477 94 dbSNP
rs538318153 95 dbSNP
rs556427828 98 dbSNP
rs1317593973 99 dbSNP
rs1180496153 101 dbSNP
rs1212532613 101 dbSNP
rs779758092 102 dbSNP
rs571725477 108 dbSNP
rs180795690 109 dbSNP
rs780825620 110 dbSNP
rs554162056 111 dbSNP
rs1332833713 112 dbSNP
rs1308794243 113 dbSNP
rs1352598517 116 dbSNP
rs1407715068 122 dbSNP
rs769841099 129 dbSNP
rs773227656 130 dbSNP
rs1235308496 131 dbSNP
rs763131855 133 dbSNP
rs771096922 140 dbSNP
rs1346431604 141 dbSNP
rs786205419 141 dbSNP
rs1205287753 143 dbSNP
rs1276271585 146 dbSNP
rs572770924 148 dbSNP
rs1194916929 151 dbSNP
rs1250256855 154 dbSNP
rs774658182 158 dbSNP
rs1407366654 161 dbSNP
rs777088977 167 dbSNP
rs759078123 168 dbSNP
rs1376436061 173 dbSNP
rs748973308 174 dbSNP
rs977907921 178 dbSNP
rs1179404050 180 dbSNP
rs1372543797 182 dbSNP
rs1428059651 187 dbSNP
rs1297877792 193 dbSNP
rs754434170 200 dbSNP
rs944726073 202 dbSNP
rs1388297975 216 dbSNP
rs1321459546 217 dbSNP
rs1386920240 219 dbSNP
rs1453070284 232 dbSNP
rs1290395400 237 dbSNP
rs1227639932 239 dbSNP
rs1357272564 243 dbSNP
rs186133938 244 dbSNP
rs900485314 247 dbSNP
rs997208184 254 dbSNP
rs1240166436 263 dbSNP
rs990909706 267 dbSNP
rs555122530 273 dbSNP
rs573547525 274 dbSNP
rs544287872 278 dbSNP
rs1459833561 283 dbSNP
rs1423278309 296 dbSNP
rs762399367 299 dbSNP
rs1015370392 300 dbSNP
rs1439123810 301 dbSNP
rs1405917783 312 dbSNP
rs1193117072 318 dbSNP
rs1478499977 318 dbSNP
rs1417946460 326 dbSNP
rs1247058595 328 dbSNP
rs940761068 336 dbSNP
rs1489801728 342 dbSNP
rs768200520 344 dbSNP
rs1156303565 345 dbSNP
rs142883951 353 dbSNP
rs1352272383 365 dbSNP
rs1037755783 367 dbSNP
rs1014000667 375 dbSNP
rs1220594452 390 dbSNP
rs899246952 391 dbSNP
rs996169989 392 dbSNP
rs546292693 395 dbSNP
rs969746503 397 dbSNP
rs13124509 399 dbSNP
rs13124510 402 dbSNP
rs1362881980 406 dbSNP
rs1299295873 407 dbSNP
rs13124517 408 dbSNP
rs750781830 410 dbSNP
rs926191597 427 dbSNP
rs1404314398 431 dbSNP
rs1449470073 434 dbSNP
rs114488000 447 dbSNP
rs1343481442 454 dbSNP
rs756591689 458 dbSNP
rs988913373 461 dbSNP
rs555204892 471 dbSNP
rs944819609 474 dbSNP
rs1390237204 479 dbSNP
rs1303460513 480 dbSNP
rs1040460386 499 dbSNP
rs1223085982 500 dbSNP
rs1197539373 503 dbSNP
rs560205760 511 dbSNP
rs1194269552 516 dbSNP
rs967553723 533 dbSNP
rs886059018 534 dbSNP
rs1258419461 538 dbSNP
rs1200325534 542 dbSNP
rs116499162 543 dbSNP
rs1032052353 548 dbSNP
rs55917368 549 dbSNP
rs561461204 555 dbSNP
rs754120860 558 dbSNP
rs1279281295 576 dbSNP
rs531849305 583 dbSNP
rs990486251 605 dbSNP
rs1175456554 606 dbSNP
rs1305122546 611 dbSNP
rs1005455239 613 dbSNP
rs1036896669 621 dbSNP
rs916273546 635 dbSNP
rs550353802 636 dbSNP
rs982056996 638 dbSNP
rs1467425530 647 dbSNP
rs886059019 648 dbSNP
rs907798207 654 dbSNP
rs1427718476 660 dbSNP
rs896984743 660 dbSNP
rs11153 669 dbSNP
rs571623699 670 dbSNP
rs867855889 671 dbSNP
rs1183557465 672 dbSNP
rs1483261076 686 dbSNP
rs1175182778 687 dbSNP
rs539141259 688 dbSNP
rs1319637315 698 dbSNP
rs754944447 709 dbSNP
rs547461523 721 dbSNP
rs920662850 724 dbSNP
rs932089906 728 dbSNP
rs1397148906 733 dbSNP
rs1378504754 739 dbSNP
rs970136146 741 dbSNP
rs559893674 766 dbSNP
rs372646091 768 dbSNP
rs779062726 774 dbSNP
rs890496899 780 dbSNP
rs1295825963 782 dbSNP
rs1330937101 784 dbSNP
rs573570573 785 dbSNP
rs879190489 793 dbSNP
rs1041919281 795 dbSNP
rs1424366103 799 dbSNP
rs533833058 802 dbSNP
rs111682887 803 dbSNP
rs1181285865 808 dbSNP
rs957639703 822 dbSNP
rs573609566 823 dbSNP
rs1281553042 837 dbSNP
rs1000339556 838 dbSNP
rs189421233 844 dbSNP
rs201858399 845 dbSNP
rs1176655613 849 dbSNP
rs913435346 853 dbSNP
rs893538208 857 dbSNP
rs148026405 858 dbSNP
rs78263766 875 dbSNP
rs966144811 883 dbSNP
rs976583178 888 dbSNP
rs113227406 889 dbSNP
rs1313570437 890 dbSNP
rs931996533 891 dbSNP
rs1377781580 892 dbSNP
rs1308735563 900 dbSNP
rs981775314 901 dbSNP
rs1014824067 906 dbSNP
rs41279313 907 dbSNP
rs11550170 909 dbSNP
rs1364829259 911 dbSNP
rs920450264 917 dbSNP
rs941293423 921 dbSNP
rs764823244 922 dbSNP
rs886059020 929 dbSNP
rs932084545 937 dbSNP
rs1180620933 942 dbSNP
rs1416981698 946 dbSNP
rs139693273 952 dbSNP
rs143635798 957 dbSNP
rs543332817 980 dbSNP
rs1419194783 982 dbSNP
rs1045903371 983 dbSNP
rs944672105 995 dbSNP
rs905588639 997 dbSNP
rs1279074874 1005 dbSNP
rs748977332 1009 dbSNP
rs1167448395 1028 dbSNP
rs146298443 1040 dbSNP
rs1032665907 1043 dbSNP
rs139776932 1044 dbSNP
rs892795070 1069 dbSNP
rs1344673358 1076 dbSNP
rs1350991971 1076 dbSNP
rs1424653492 1079 dbSNP
rs1010448483 1082 dbSNP
rs550075007 1083 dbSNP
rs771819247 1094 dbSNP
rs1360571589 1095 dbSNP
rs976255436 1109 dbSNP
rs1362588554 1113 dbSNP
rs1054627744 1115 dbSNP
rs1269858938 1125 dbSNP
rs1360930372 1126 dbSNP
rs1212601442 1138 dbSNP
rs565511111 1141 dbSNP
rs767997394 1142 dbSNP
rs953518366 1144 dbSNP
rs1480285832 1145 dbSNP
rs532478716 1147 dbSNP
rs894669450 1149 dbSNP
rs1013096829 1154 dbSNP
rs1203403328 1156 dbSNP
rs1488940310 1156 dbSNP
rs531092201 1156 dbSNP
rs886059021 1156 dbSNP
rs1003180023 1164 dbSNP
rs909252224 1164 dbSNP
rs200388497 1168 dbSNP
rs1221711676 1172 dbSNP
rs940631707 1173 dbSNP
rs1014629006 1176 dbSNP
rs1281188072 1176 dbSNP
rs1288936213 1176 dbSNP
rs1488997838 1185 dbSNP
rs1216015230 1187 dbSNP
rs773902023 1188 dbSNP
rs1474600917 1191 dbSNP
rs1183953803 1195 dbSNP
rs1415066694 1197 dbSNP
rs1444537202 1199 dbSNP
rs1162244920 1202 dbSNP
rs972652040 1208 dbSNP
rs961970956 1221 dbSNP
rs375692026 1222 dbSNP
rs1469003007 1237 dbSNP
rs1427630956 1238 dbSNP
rs886059022 1240 dbSNP
rs949941185 1241 dbSNP
rs1045590450 1244 dbSNP
rs905677706 1264 dbSNP
rs937138642 1272 dbSNP
rs1444157919 1280 dbSNP
rs1257015085 1296 dbSNP
rs985930499 1307 dbSNP
rs1321759667 1310 dbSNP
rs1261008951 1315 dbSNP
rs1343638889 1319 dbSNP
rs911954644 1323 dbSNP
rs1054128935 1335 dbSNP
rs1383321783 1336 dbSNP
rs944820977 1337 dbSNP
rs1336890912 1340 dbSNP
rs1451441486 1367 dbSNP
rs1403367204 1386 dbSNP
rs977373748 1386 dbSNP
rs924644947 1397 dbSNP
rs1419282458 1410 dbSNP
rs1312874835 1423 dbSNP
rs1166643684 1428 dbSNP
rs936258609 1431 dbSNP
rs868020630 1434 dbSNP
rs1055081049 1439 dbSNP
rs1369125260 1440 dbSNP
rs748047997 1443 dbSNP
rs1460048590 1448 dbSNP
rs1240219796 1451 dbSNP
rs181785144 1452 dbSNP
rs892813214 1455 dbSNP
rs1272072315 1461 dbSNP
rs1193998127 1468 dbSNP
rs761265932 1469 dbSNP
rs1020514058 1470 dbSNP
rs902118998 1471 dbSNP
rs1283017209 1474 dbSNP
rs536206075 1476 dbSNP
rs1379985864 1478 dbSNP
rs186440511 1480 dbSNP
rs1211857888 1490 dbSNP
rs1354283542 1491 dbSNP
rs998164037 1495 dbSNP
rs1244073899 1506 dbSNP
rs1407564268 1508 dbSNP
rs1366670642 1511 dbSNP
rs1461167427 1518 dbSNP
rs948840514 1526 dbSNP
rs1182208873 1531 dbSNP
rs1240585359 1544 dbSNP
rs1382298894 1552 dbSNP
rs1029197404 1554 dbSNP
rs1045943741 1572 dbSNP
rs567419487 1575 dbSNP
rs1232074667 1577 dbSNP
rs1179323995 1579 dbSNP
rs1453113947 1587 dbSNP
rs1292353808 1588 dbSNP
rs1221690401 1593 dbSNP
rs56095450 1595 dbSNP
rs773876171 1598 dbSNP
rs1223991277 1600 dbSNP
rs906270539 1600 dbSNP
rs1277425969 1602 dbSNP
rs538157245 1611 dbSNP
rs1346562530 1614 dbSNP
rs1016321456 1616 dbSNP
rs1423338115 1618 dbSNP
rs1036028810 1623 dbSNP
rs1406495760 1632 dbSNP
rs897520016 1641 dbSNP
rs994521805 1645 dbSNP
rs1286632992 1649 dbSNP
rs1451655008 1650 dbSNP
rs1193170625 1663 dbSNP
rs1478861365 1664 dbSNP
rs962051431 1682 dbSNP
rs972034551 1687 dbSNP
rs1489859220 1700 dbSNP
rs1264692081 1710 dbSNP
rs762914798 1719 dbSNP
rs1007319609 1723 dbSNP
rs950025737 1724 dbSNP
rs556069947 1742 dbSNP
rs927187478 1743 dbSNP
rs937137919 1750 dbSNP
rs796142821 1754 dbSNP
rs1054146622 1755 dbSNP
rs1342866756 1763 dbSNP
rs1289969875 1766 dbSNP
rs1430937538 1781 dbSNP
rs924726337 1786 dbSNP
rs892865030 1789 dbSNP
rs144480929 1800 dbSNP
rs1202152089 1803 dbSNP
rs1178482629 1812 dbSNP
rs753947178 1819 dbSNP
rs990182563 1826 dbSNP
rs901500896 1834 dbSNP
rs916119364 1853 dbSNP
rs1479342490 1857 dbSNP
rs997819686 1862 dbSNP
rs1421490427 1865 dbSNP
rs1438867867 1873 dbSNP
rs1187069234 1888 dbSNP
rs1485246032 1889 dbSNP
rs1239900939 1904 dbSNP
rs1051078757 1906 dbSNP
rs1461535852 1907 dbSNP
rs1262132564 1910 dbSNP
rs1045915475 1911 dbSNP
rs1231200621 1917 dbSNP
rs928829512 1936 dbSNP
rs1296855586 1947 dbSNP
rs569519804 1951 dbSNP
rs1036488191 1955 dbSNP
rs538261257 1960 dbSNP
rs759789833 1961 dbSNP
rs1453643682 1981 dbSNP
rs897576471 1995 dbSNP
rs889296975 2004 dbSNP
rs886059023 2011 dbSNP
rs1334973960 2020 dbSNP
rs1468490475 2021 dbSNP
rs1374608874 2027 dbSNP
rs994888238 2027 dbSNP
rs1006363355 2034 dbSNP
rs561375466 2041 dbSNP
rs1173989061 2044 dbSNP
rs1398420368 2045 dbSNP
rs1410411907 2050 dbSNP
rs1016374043 2051 dbSNP
rs1416755142 2058 dbSNP
rs1184840159 2060 dbSNP
rs368378346 2062 dbSNP
rs538349754 2076 dbSNP
rs1242094570 2085 dbSNP
rs1444716703 2085 dbSNP
rs1333407099 2087 dbSNP
rs1201409120 2088 dbSNP
rs962142520 2090 dbSNP
rs34393624 2097 dbSNP
rs190513908 2109 dbSNP
rs1204438988 2122 dbSNP
rs1306331968 2129 dbSNP
rs765443750 2135 dbSNP
rs1246720138 2139 dbSNP
rs1382166939 2141 dbSNP
rs1313128843 2146 dbSNP
rs1449343107 2157 dbSNP
rs1398358331 2159 dbSNP
rs1221348964 2164 dbSNP
rs1260370850 2172 dbSNP
rs1461305905 2180 dbSNP
rs547285502 2180 dbSNP
rs1165424237 2186 dbSNP
rs1279 2190 dbSNP
rs1424685932 2200 dbSNP
rs1384119654 2206 dbSNP
rs971132895 2213 dbSNP
rs1195690650 2217 dbSNP
rs1420579816 2220 dbSNP
rs1018726018 2227 dbSNP
rs1176931131 2231 dbSNP
rs981382966 2233 dbSNP
rs537466524 2247 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*