miRTarBase - #MIRT003082 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NFATC2IP   
Synonyms ESC2, NIP45, RAD60
Description nuclear factor of activated T-cells 2 interacting protein
Transcript NM_032815   
Expression
Putative miRNA Targets on NFATC2IP
3'UTR of NFATC2IP
(miRNA target sites are highlighted)
>NFATC2IP|NM_032815|3'UTR
   1 CACCCCACTCCCTGTTTGACGGCCCAGCCTGGACTTGGGGAGAATGACTTTCCCTTTTTTGCCCCATAAGGGCTAGCATA
  81 AGCTGAGGTAGAACTTATCTTTAAGCTGCAGCAAAATCAAGGAGTGACTTTTGTCCCCTCTCCTGTTGACCCTGGTTTAG
 161 AGCCGTTAACCACTTGGTGAGTTATGTGGGTGTTGTTGCCCTGGGTGGCCTGTGGCTCCGTCCACAAGTCATGCTGAGTT
 241 TTGCAGCCTCTGTGACTTGGAGATGTCCCTTCACCCCTCCCCTTTCACCACCATCCTCTTTTCCTCATGGAAATGTCTGC
 321 TTTATGAAACTATGCACATATTGAAAGTGAGTTGAAACAAATGAGGGTTGGGTAGGAGCTTCCAGGCCTGGGATTTACAC
 401 CACGCCTAGCCCAGCAGAGGCCTTAGTCCCATTTGGGGCTTGGGAGTGACATTTGCTTGAGGCTTATACACTGGTGTGGT
 481 TGCCTGGCTTGCAGGAAATGACCAAGCTCACACATGCTGGCTGAAGCGTAAGCAGACAACTGAGGTACTCTTTTGAAGGA
 561 TGAAGGTGGTGGATTCTCAGCCCTGGGGGTCTTCCTCACCTGAGGACCCTTCAGAGCCACCCTTTCTAGTTTGCATTTCC
 641 TGGTGCACACATTTAAGGCATAACAGCACATTCATCCCTTTGGTTTGGGATCTCAGGAATACAGTCCCATGCAAAGATTC
 721 TCTGGTTTTATGGCTTTTTTCCCTTTCTTTACACCATCCTCTCCCATAAGCACCCATGTCTTTGAATATGAATGTATTTG
 801 TAAAATACCACGTTTCATGTGTGAATATGTGCTTTTACTGTACATAGTGCTATTGTGCAATAGGTCTTATGCTGTTTTCA
 881 CTCAATGTGTGCTAAGATCTAGCCCCATTGACTCTTCTAGAAATGCAGTATTGCTTTGACCTGCCATGTGGCACTCCACA
 961 ATGTCAATTGCAGTTTACACACATTGCCTAAAGTGGGGGACACCTGGGTGCCCCTGACCCCTTGGCACCGGATACAGGCC
1041 ACGATAAACATCCTTTCGTGTGTTCCCTTCTGTGCTTGTGTGGCATGTGTACCCAGGATGGGCCTATAGGTCACAGAGGT
1121 CAGTTTCTCTTTGGTTTTCCAGATTTTCTTTAGAACGGTGACTGACCCTCCTACTTGAGGCCGCCCTTTTCTCCTTATCC
1201 TTGCCAGCACTTGTATTGCCAGACTACCTAATTTTTGCCAGTCTCATGGGTAGATAGTGGTGCAGTGCTTTAACATACAT
1281 TCATCTGATCAGCATTAATTTGGGGAATTTTTTCACTTAGCCTTTCTGGTTTCCCTTCCTGTGCATTGCCCATTTTCTCA
1361 TGGAGTTTCTTATCTTTTTTGGTTTATTCTCAGGAGTTGCTTGTACATTCTTGGGCAATTGCAGATAATTCCAAGAATGC
1441 ATATTTGGGCTGGGTATGGAGGTTCACTGGTAATCCCAGCACTTTGGGAGGCCCAGGCAGAAGGATCGCTGCAGCCCAGG
1521 AGTTCGAGACTAGCCTGGGCAACATAGCGAGACCTCGTCTCTACAAAAAAAAATTAAAAAGGGGGCTTTGGGAGGCCAAG
1601 GCGGGCAGATCATGAGGGCAGGAGATTGAGACCCTCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAATACAAAAAA
1681 TTAGCTGGGCATGGTGGCGCACACCTGTAGTCCCAGCTACTCTGGAGGCTGAGGCAGGGGAATCGCTTAAACCCAGGAGG
1761 CGGAGATTGCAGTGAGCCAAGGTTCCACCACTGCACTCCAGCCTGGCGACAGAGCAAGGCTCCACTCAAAAAAAAGATTT
1841 AAAGGGGAAAAAATTGAAATTTTCTTTGTATCTAGGGGTATCCGTCACTGAACAGAAATTCTTAATTTTGGCTAGGCGTG
1921 ATGGCTCAGGTCTGTAATCCCAGCACTTTCGGTGGCCGGGGTGGGTGGATCACTTGAGGCCAGGAGTTCAAGACCACCCT
2001 GACCAACTTGGTGAAATCCCATCTCTACTAAAAATACAAAAATTAGCTGGGTGCAGTGGCGCATGCTTGTAATCCCAGCT
2081 ACTCAGGAGGCAGAGGCAGGAGAATCACTTGAACCCGGGAGGTGGAGGCTGCAGTGAACAGAGACAGTGCCACTGCACAT
2161 CAGCCTGAGTGACAGAGAGACTTTGTCTCAAAAAAAAAAGAAAATTTTAATTTTAATGTAGACAGTATGAATTATCTTGT
2241 TCTGCAGTTGGTTGCTTTTTGATTGCTTATTTAATAGAGTTGTTAAGATATTTTACATCTTCTCCTGTTAGCTGTTCAGC
2321 TTTTCCTTTCATATTGAGAACACTACACAGTGCTGAAGTCCAGCTGGTACACACCGGGGTGACACCTTGGCTGCATCTGT
2401 TCTCAACAGTCAGACACTTCTTCTAATTGGTTGATGCTGGGCTGTACTGGTTGCTAAATATTGCACATCATTTTAAAACT
2481 ATTTGAGATGCACTTTTGTACTCAGGAGGCCAAGGCAGGAGGATTGCTTGAGCCCAGGAGTTTGAGACCAGCCTGGGCAA
2561 CACAGCGAGACCTTGTCTCTTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ::||| ||| :|||||| 
Target 5' gaccTGCCA-TGTGGCACTCCa 3'
938 - 958 145.00 -19.90
2
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||||| |   :|||||| 
Target 5' gttcCACCACT---GCACTCCa 3'
1782 - 1800 139.00 -17.00
3
miRNA  3' guuuGUGGUAACAG--UGUGAGGu 5'
              || ||  |||  |||||:| 
Target 5' ttctCAACA--GTCAGACACTTCt 3'
2400 - 2421 136.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30162031 21 COSMIC
COSN28845608 23 COSMIC
COSN30518353 86 COSMIC
COSN9645357 109 COSMIC
COSN6083431 128 COSMIC
COSN25244132 1197 COSMIC
COSN22831720 1836 COSMIC
COSN20169760 1873 COSMIC
COSN7303869 2245 COSMIC
COSN24331685 2898 COSMIC
COSN26366314 3133 COSMIC
rs7500321 1837 GWAS
rs1137843 2530 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763727813 5 dbSNP
rs370474345 6 dbSNP
rs377208661 8 dbSNP
rs34270830 10 dbSNP
rs766675472 14 dbSNP
rs752064567 15 dbSNP
rs1232995765 16 dbSNP
rs1301810342 17 dbSNP
rs765181361 21 dbSNP
rs768198449 22 dbSNP
rs1274788926 23 dbSNP
rs539205571 25 dbSNP
rs752948369 33 dbSNP
rs778120474 39 dbSNP
rs1451907097 43 dbSNP
rs749498424 53 dbSNP
rs557911918 55 dbSNP
rs1206824638 60 dbSNP
rs1485600229 66 dbSNP
rs1261481858 67 dbSNP
rs930839301 71 dbSNP
rs1483557185 74 dbSNP
rs1310183294 79 dbSNP
rs752472156 91 dbSNP
rs1234916590 94 dbSNP
rs999492231 95 dbSNP
rs1373021187 99 dbSNP
rs1267345995 103 dbSNP
rs1491003797 109 dbSNP
rs1199497391 115 dbSNP
rs1049124584 121 dbSNP
rs1385084175 126 dbSNP
rs915969837 134 dbSNP
rs1371942983 136 dbSNP
rs1035019544 138 dbSNP
rs186123506 146 dbSNP
rs1173338823 148 dbSNP
rs1435731628 164 dbSNP
rs1012939133 165 dbSNP
rs536911384 166 dbSNP
rs1423743401 180 dbSNP
rs952325958 182 dbSNP
rs555261934 185 dbSNP
rs1367353801 186 dbSNP
rs1188501349 191 dbSNP
rs1484847723 192 dbSNP
rs75797916 193 dbSNP
rs541423235 194 dbSNP
rs543660910 205 dbSNP
rs1272329765 208 dbSNP
rs189258410 213 dbSNP
rs578044564 220 dbSNP
rs1011443259 221 dbSNP
rs1393802034 238 dbSNP
rs1354351459 239 dbSNP
rs1313142895 251 dbSNP
rs112492568 260 dbSNP
rs1377699340 263 dbSNP
rs1428745536 276 dbSNP
rs71387634 278 dbSNP
rs922970799 290 dbSNP
rs1007985199 293 dbSNP
rs551669513 294 dbSNP
rs986480167 296 dbSNP
rs961111184 298 dbSNP
rs972272005 299 dbSNP
rs531152661 303 dbSNP
rs566497518 305 dbSNP
rs750645089 308 dbSNP
rs1486518820 309 dbSNP
rs1248203299 314 dbSNP
rs1026554232 315 dbSNP
rs1340059416 325 dbSNP
rs181968292 341 dbSNP
rs984903757 342 dbSNP
rs751420512 352 dbSNP
rs3206851 359 dbSNP
rs1333549257 360 dbSNP
rs59675198 377 dbSNP
rs185069694 388 dbSNP
rs935458058 402 dbSNP
rs569340242 404 dbSNP
rs528835047 405 dbSNP
rs1459898050 413 dbSNP
rs1417311245 422 dbSNP
rs928622816 423 dbSNP
rs781200367 434 dbSNP
rs934671143 438 dbSNP
rs1361840405 443 dbSNP
rs1053011083 444 dbSNP
rs1056374372 457 dbSNP
rs1252515443 458 dbSNP
rs893029617 465 dbSNP
rs896522266 469 dbSNP
rs1443692442 471 dbSNP
rs1467612418 471 dbSNP
rs1181382646 474 dbSNP
rs11547490 479 dbSNP
rs769374189 493 dbSNP
rs1157874807 504 dbSNP
rs11547489 507 dbSNP
rs1278596931 510 dbSNP
rs1238732999 514 dbSNP
rs1336749985 515 dbSNP
rs889661477 522 dbSNP
rs9922735 529 dbSNP
rs1393828231 544 dbSNP
rs190946406 546 dbSNP
rs1019385402 551 dbSNP
rs1398989181 560 dbSNP
rs1320449937 562 dbSNP
rs1015134679 573 dbSNP
rs926826853 579 dbSNP
rs551202349 580 dbSNP
rs1191663758 585 dbSNP
rs896803612 589 dbSNP
rs961786868 603 dbSNP
rs748788795 617 dbSNP
rs1253560914 621 dbSNP
rs183109867 622 dbSNP
rs1029989100 623 dbSNP
rs1246015016 628 dbSNP
rs1307277188 630 dbSNP
rs953173470 633 dbSNP
rs1260628542 641 dbSNP
rs868569363 644 dbSNP
rs986039341 646 dbSNP
rs1206366280 656 dbSNP
rs952256684 667 dbSNP
rs914475624 674 dbSNP
rs541202289 675 dbSNP
rs1268141211 679 dbSNP
rs768484888 690 dbSNP
rs1438637776 692 dbSNP
rs977223509 693 dbSNP
rs774145488 698 dbSNP
rs1424150176 702 dbSNP
rs536850197 704 dbSNP
rs928763508 705 dbSNP
rs935407213 709 dbSNP
rs1180868544 721 dbSNP
rs1433872973 724 dbSNP
rs1361992526 732 dbSNP
rs1195447159 735 dbSNP
rs1474129636 747 dbSNP
rs1241058426 748 dbSNP
rs1471153998 751 dbSNP
rs1159091231 776 dbSNP
rs879184236 782 dbSNP
rs1056487843 789 dbSNP
rs1448433549 790 dbSNP
rs1209093506 795 dbSNP
rs1277770306 795 dbSNP
rs1347634658 808 dbSNP
rs896462629 810 dbSNP
rs948053661 812 dbSNP
rs934744690 813 dbSNP
rs1337523883 816 dbSNP
rs1269733086 817 dbSNP
rs761108195 819 dbSNP
rs1342534929 821 dbSNP
rs1311327083 824 dbSNP
rs141475470 830 dbSNP
rs888018292 833 dbSNP
rs567211870 837 dbSNP
rs947279862 841 dbSNP
rs1408206298 842 dbSNP
rs1418153400 843 dbSNP
rs1167935409 849 dbSNP
rs534654320 861 dbSNP
rs1408639005 869 dbSNP
rs549139017 871 dbSNP
rs553318889 872 dbSNP
rs186362879 874 dbSNP
rs1041290822 884 dbSNP
rs896881751 886 dbSNP
rs1241720014 887 dbSNP
rs1320124275 888 dbSNP
rs200906440 892 dbSNP
rs993882802 894 dbSNP
rs1232943156 904 dbSNP
rs1030102062 909 dbSNP
rs1439775121 914 dbSNP
rs1353792287 918 dbSNP
rs1329499406 920 dbSNP
rs1322146076 926 dbSNP
rs1415070532 927 dbSNP
rs953034111 933 dbSNP
rs1163749862 934 dbSNP
rs986206706 938 dbSNP
rs545459095 942 dbSNP
rs1021331677 945 dbSNP
rs1023239162 948 dbSNP
rs1483409734 964 dbSNP
rs1195001343 967 dbSNP
rs1479880386 974 dbSNP
rs969023618 985 dbSNP
rs977340567 991 dbSNP
rs1459123304 1004 dbSNP
rs1248085889 1013 dbSNP
rs1247842107 1015 dbSNP
rs924421057 1020 dbSNP
rs1335655427 1021 dbSNP
rs959883965 1030 dbSNP
rs992164293 1031 dbSNP
rs918004135 1036 dbSNP
rs1003014438 1043 dbSNP
rs948198056 1044 dbSNP
rs1448988761 1050 dbSNP
rs752581752 1054 dbSNP
rs1428544850 1056 dbSNP
rs777218986 1058 dbSNP
rs909237930 1059 dbSNP
rs1174422505 1064 dbSNP
rs1379586648 1068 dbSNP
rs1351218177 1076 dbSNP
rs1156522874 1079 dbSNP
rs942245841 1088 dbSNP
rs1417681943 1094 dbSNP
rs191734017 1107 dbSNP
rs1407768333 1108 dbSNP
rs1292252838 1111 dbSNP
rs1442150831 1114 dbSNP
rs988929255 1130 dbSNP
rs759921381 1140 dbSNP
rs1213079301 1143 dbSNP
rs183096748 1149 dbSNP
rs1468991550 1150 dbSNP
rs1267409778 1156 dbSNP
rs1036628486 1157 dbSNP
rs145150742 1158 dbSNP
rs1242064623 1180 dbSNP
rs1368607160 1182 dbSNP
rs1394733047 1183 dbSNP
rs1440940036 1188 dbSNP
rs1393524084 1205 dbSNP
rs765702588 1206 dbSNP
rs1309142767 1214 dbSNP
rs1345476701 1216 dbSNP
rs1051476374 1224 dbSNP
rs1344963053 1225 dbSNP
rs888862175 1227 dbSNP
rs1421912585 1235 dbSNP
rs1393768162 1238 dbSNP
rs1193588676 1240 dbSNP
rs1433808666 1242 dbSNP
rs1269638832 1244 dbSNP
rs1184982192 1247 dbSNP
rs1485631080 1255 dbSNP
rs1242916998 1276 dbSNP
rs1218467691 1279 dbSNP
rs1284712187 1284 dbSNP
rs758231240 1294 dbSNP
rs1226161412 1297 dbSNP
rs1234980666 1303 dbSNP
rs1313437869 1308 dbSNP
rs1292896775 1318 dbSNP
rs1249295744 1319 dbSNP
rs752831814 1320 dbSNP
rs1205669682 1321 dbSNP
rs1402188552 1321 dbSNP
rs1173552886 1322 dbSNP
rs1268059182 1325 dbSNP
rs1021698854 1337 dbSNP
rs1489858882 1341 dbSNP
rs1379891955 1342 dbSNP
rs561513788 1352 dbSNP
rs763016514 1360 dbSNP
rs1269466441 1363 dbSNP
rs918425384 1373 dbSNP
rs929717273 1376 dbSNP
rs998705973 1380 dbSNP
rs1484555055 1389 dbSNP
rs1031552509 1405 dbSNP
rs1243451222 1407 dbSNP
rs1048169530 1408 dbSNP
rs1256613965 1415 dbSNP
rs528760837 1422 dbSNP
rs959833054 1425 dbSNP
rs1200958432 1434 dbSNP
rs888093007 1436 dbSNP
rs992613811 1450 dbSNP
rs1249557362 1451 dbSNP
rs540604253 1455 dbSNP
rs1011942234 1459 dbSNP
rs1045142538 1460 dbSNP
rs1279659854 1463 dbSNP
rs1231140624 1466 dbSNP
rs1169949778 1476 dbSNP
rs1353953677 1486 dbSNP
rs1371601650 1487 dbSNP
rs1312585418 1489 dbSNP
rs1396989694 1501 dbSNP
rs764302878 1509 dbSNP
rs1404921802 1512 dbSNP
rs1431978459 1518 dbSNP
rs1461519454 1519 dbSNP
rs969858496 1526 dbSNP
rs868809146 1527 dbSNP
rs909175741 1534 dbSNP
rs138980034 1538 dbSNP
rs1035855495 1539 dbSNP
rs1425355712 1545 dbSNP
rs1248274003 1549 dbSNP
rs1036574917 1550 dbSNP
rs1457800795 1554 dbSNP
rs751721508 1557 dbSNP
rs1021748606 1558 dbSNP
rs968804825 1563 dbSNP
rs1342678865 1565 dbSNP
rs1480708303 1565 dbSNP
rs919516256 1565 dbSNP
rs1305464580 1569 dbSNP
rs1391381656 1571 dbSNP
rs140645606 1574 dbSNP
rs1333370821 1576 dbSNP
rs911218214 1577 dbSNP
rs965292508 1580 dbSNP
rs1164078526 1588 dbSNP
rs977105939 1593 dbSNP
rs1361894195 1601 dbSNP
rs918415503 1603 dbSNP
rs144679356 1604 dbSNP
rs1228866429 1614 dbSNP
rs1191156361 1619 dbSNP
rs889320011 1623 dbSNP
rs1290839935 1626 dbSNP
rs1007696107 1632 dbSNP
rs1042833439 1634 dbSNP
rs1211319097 1638 dbSNP
rs569420070 1642 dbSNP
rs904158436 1656 dbSNP
rs1488833025 1657 dbSNP
rs1186044705 1659 dbSNP
rs998485212 1660 dbSNP
rs1239881914 1661 dbSNP
rs1451623095 1669 dbSNP
rs1189468930 1675 dbSNP
rs947814067 1682 dbSNP
rs1384930387 1683 dbSNP
rs1031334745 1685 dbSNP
rs1370390427 1690 dbSNP
rs746448064 1691 dbSNP
rs906225186 1691 dbSNP
rs757094679 1697 dbSNP
rs1351028888 1699 dbSNP
rs530557971 1700 dbSNP
rs1286683859 1705 dbSNP
rs891954762 1710 dbSNP
rs1171733831 1712 dbSNP
rs1435278299 1712 dbSNP
rs1010379294 1714 dbSNP
rs548761020 1715 dbSNP
rs1200543978 1717 dbSNP
rs567149281 1722 dbSNP
rs1380236817 1724 dbSNP
rs904565047 1729 dbSNP
rs1216282031 1736 dbSNP
rs578106447 1741 dbSNP
rs1007392204 1743 dbSNP
rs1023206044 1745 dbSNP
rs1344377707 1753 dbSNP
rs553015593 1755 dbSNP
rs780805121 1756 dbSNP
rs1215139952 1758 dbSNP
rs756833149 1762 dbSNP
rs187637539 1763 dbSNP
rs1016349212 1771 dbSNP
rs1310980982 1772 dbSNP
rs1242788473 1773 dbSNP
rs963337408 1783 dbSNP
rs1173759731 1796 dbSNP
rs538666404 1800 dbSNP
rs972049127 1804 dbSNP
rs965801150 1808 dbSNP
rs1193981512 1809 dbSNP
rs1488807303 1810 dbSNP
rs141199395 1814 dbSNP
rs1415157373 1817 dbSNP
rs878900317 1828 dbSNP
rs7500321 1837 dbSNP
rs987756621 1844 dbSNP
rs1277783785 1848 dbSNP
rs1390147708 1848 dbSNP
rs983897234 1849 dbSNP
rs1342136432 1854 dbSNP
rs1310778942 1855 dbSNP
rs910689818 1858 dbSNP
rs909722328 1859 dbSNP
rs1446115668 1860 dbSNP
rs1457329269 1862 dbSNP
rs1170928732 1865 dbSNP
rs1478635246 1865 dbSNP
rs575805600 1871 dbSNP
rs868186182 1876 dbSNP
rs1043166349 1879 dbSNP
rs764825305 1884 dbSNP
rs904274491 1885 dbSNP
rs1238528958 1886 dbSNP
rs934451734 1889 dbSNP
rs1052699913 1891 dbSNP
rs192459527 1895 dbSNP
rs1436142424 1901 dbSNP
rs1014558790 1903 dbSNP
rs1385058753 1904 dbSNP
rs1404091985 1906 dbSNP
rs927632631 1918 dbSNP
rs1284625864 1919 dbSNP
rs1022900267 1931 dbSNP
rs1372360694 1932 dbSNP
rs1320196683 1935 dbSNP
rs1291689959 1948 dbSNP
rs905651516 1951 dbSNP
rs1005390042 1952 dbSNP
rs545412817 1953 dbSNP
rs939042795 1955 dbSNP
rs1290173711 1958 dbSNP
rs376438423 1959 dbSNP
rs963452659 1961 dbSNP
rs892028042 1962 dbSNP
rs1391788244 1963 dbSNP
rs972173324 1977 dbSNP
rs1163688527 1983 dbSNP
rs1405120977 1987 dbSNP
rs573371747 1990 dbSNP
rs1415051248 1993 dbSNP
rs946281547 1995 dbSNP
rs540892366 2004 dbSNP
rs1238116691 2007 dbSNP
rs1179279995 2009 dbSNP
rs756058734 2016 dbSNP
rs954714342 2022 dbSNP
rs1173236179 2028 dbSNP
rs1262719889 2045 dbSNP
rs780130084 2047 dbSNP
rs910813152 2049 dbSNP
rs1212673000 2050 dbSNP
rs1322083970 2052 dbSNP
rs1291841287 2057 dbSNP
rs200213537 2061 dbSNP
rs943652975 2062 dbSNP
rs1480527597 2063 dbSNP
rs565441057 2064 dbSNP
rs201295379 2068 dbSNP
rs1414894833 2075 dbSNP
rs1472613139 2083 dbSNP
rs926147951 2100 dbSNP
rs150731329 2101 dbSNP
rs1175170342 2112 dbSNP
rs934396306 2117 dbSNP
rs901162088 2118 dbSNP
rs1415762420 2129 dbSNP
rs1418277581 2133 dbSNP
rs998114219 2147 dbSNP
rs1159824183 2150 dbSNP
rs370558373 2154 dbSNP
rs895461887 2166 dbSNP
rs1353668430 2170 dbSNP
rs1439784587 2173 dbSNP
rs1190822705 2174 dbSNP
rs1265425033 2174 dbSNP
rs1441594528 2174 dbSNP
rs1025619849 2180 dbSNP
rs1309751299 2181 dbSNP
rs1213341366 2182 dbSNP
rs1248681713 2182 dbSNP
rs544592322 2185 dbSNP
rs1016721509 2190 dbSNP
rs1219319555 2190 dbSNP
rs61680990 2190 dbSNP
rs984011750 2190 dbSNP
rs562988638 2191 dbSNP
rs1369225836 2196 dbSNP
rs969650676 2199 dbSNP
rs1044669284 2205 dbSNP
rs745502874 2210 dbSNP
rs1299330570 2211 dbSNP
rs1422131706 2219 dbSNP
rs537995768 2223 dbSNP
rs1342983180 2235 dbSNP
rs1221091817 2245 dbSNP
rs1279626800 2248 dbSNP
rs1433878162 2251 dbSNP
rs927674056 2252 dbSNP
rs1191840187 2262 dbSNP
rs183534247 2266 dbSNP
rs1263719924 2267 dbSNP
rs939131591 2267 dbSNP
rs1005919333 2278 dbSNP
rs1254582062 2285 dbSNP
rs1038190510 2290 dbSNP
rs74014829 2292 dbSNP
rs993559977 2296 dbSNP
rs1255363378 2297 dbSNP
rs913575738 2301 dbSNP
rs1199344867 2303 dbSNP
rs1026405725 2310 dbSNP
rs557117097 2313 dbSNP
rs796173463 2320 dbSNP
rs1043370131 2326 dbSNP
rs926126262 2335 dbSNP
rs1418413650 2342 dbSNP
rs942894135 2344 dbSNP
rs1170333231 2362 dbSNP
rs187705945 2376 dbSNP
rs1404201394 2377 dbSNP
rs375320956 2380 dbSNP
rs536671024 2387 dbSNP
rs1329364727 2400 dbSNP
rs1361031319 2403 dbSNP
rs571442232 2409 dbSNP
rs998228390 2416 dbSNP
rs1438758461 2417 dbSNP
rs964973686 2419 dbSNP
rs377615052 2424 dbSNP
rs1424622912 2426 dbSNP
rs1195517489 2433 dbSNP
rs1047017440 2434 dbSNP
rs1255345409 2435 dbSNP
rs1361603416 2436 dbSNP
rs778721859 2442 dbSNP
rs868393821 2443 dbSNP
rs143767664 2446 dbSNP
rs775685301 2453 dbSNP
rs1226633630 2462 dbSNP
rs367611984 2466 dbSNP
rs1318096631 2477 dbSNP
rs1259613987 2482 dbSNP
rs1220803665 2492 dbSNP
rs1343324234 2502 dbSNP
rs926093841 2503 dbSNP
rs1017294094 2504 dbSNP
rs1222345808 2505 dbSNP
rs1397194272 2510 dbSNP
rs1381977002 2511 dbSNP
rs1288377278 2513 dbSNP
rs956225348 2523 dbSNP
rs988480362 2527 dbSNP
rs1137843 2530 dbSNP
rs1002421851 2532 dbSNP
rs1199003878 2534 dbSNP
rs1173143100 2536 dbSNP
rs1456176847 2540 dbSNP
rs1188158861 2541 dbSNP
rs1241153660 2541 dbSNP
rs1425412306 2544 dbSNP
rs1236297568 2560 dbSNP
rs1177415015 2565 dbSNP
rs1457845116 2567 dbSNP
rs35988035 2567 dbSNP
rs200429878 2568 dbSNP
rs1190131644 2572 dbSNP
rs1207762374 2580 dbSNP
rs1158011729 2582 dbSNP
rs1265163597 2582 dbSNP
rs1329428145 2582 dbSNP
rs1354687861 2582 dbSNP
rs1378358660 2582 dbSNP
rs1439762076 2582 dbSNP
rs1459265933 2582 dbSNP
rs1390488192 2583 dbSNP
rs1423806755 2584 dbSNP
rs1161569645 2600 dbSNP
rs1392840835 2601 dbSNP
rs1407146231 2602 dbSNP
rs1450628100 2602 dbSNP
rs1284475296 2603 dbSNP
rs1490954797 2603 dbSNP
rs949871349 2603 dbSNP
rs1324344301 2604 dbSNP
rs1044063600 2605 dbSNP
rs1231173824 2606 dbSNP
rs1433085046 2607 dbSNP
rs1300133163 2609 dbSNP
rs1034861306 2614 dbSNP
rs536708567 2615 dbSNP
rs1388261163 2617 dbSNP
rs768994542 2620 dbSNP
rs1358456160 2621 dbSNP
rs960409291 2630 dbSNP
rs1420164152 2634 dbSNP
rs926973930 2636 dbSNP
rs555122367 2638 dbSNP
rs1359157878 2639 dbSNP
rs1038314591 2646 dbSNP
rs1282876339 2647 dbSNP
rs913565678 2651 dbSNP
rs539703466 2652 dbSNP
rs1261561671 2653 dbSNP
rs1216350854 2654 dbSNP
rs1210164910 2672 dbSNP
rs967732116 2673 dbSNP
rs896953827 2677 dbSNP
rs1198758499 2679 dbSNP
rs994012344 2680 dbSNP
rs1050949185 2681 dbSNP
rs1275637185 2702 dbSNP
rs926171140 2709 dbSNP
rs1443747869 2713 dbSNP
rs867316378 2716 dbSNP
rs1370101316 2717 dbSNP
rs1400408823 2718 dbSNP
rs1332161570 2723 dbSNP
rs914111758 2723 dbSNP
rs1413388411 2724 dbSNP
rs1175745735 2725 dbSNP
rs1186107551 2725 dbSNP
rs1205667047 2725 dbSNP
rs1244301480 2725 dbSNP
rs1257701607 2725 dbSNP
rs1279344769 2725 dbSNP
rs1316247196 2725 dbSNP
rs1441915507 2725 dbSNP
rs1459197809 2725 dbSNP
rs1478368722 2725 dbSNP
rs59070168 2725 dbSNP
rs79400818 2725 dbSNP
rs1473052008 2740 dbSNP
rs1189924998 2747 dbSNP
rs1384293618 2748 dbSNP
rs1282346429 2750 dbSNP
rs1455731059 2756 dbSNP
rs890543517 2760 dbSNP
rs534138827 2763 dbSNP
rs1340997932 2768 dbSNP
rs1338059567 2771 dbSNP
rs1463626484 2781 dbSNP
rs922803531 2782 dbSNP
rs1017592826 2789 dbSNP
rs1466446058 2790 dbSNP
rs965085707 2793 dbSNP
rs140531733 2805 dbSNP
rs4788108 2807 dbSNP
rs1033227126 2811 dbSNP
rs1472725618 2814 dbSNP
rs1238583140 2825 dbSNP
rs1185451746 2828 dbSNP
rs4788109 2830 dbSNP
rs1237779085 2831 dbSNP
rs761812459 2832 dbSNP
rs1279522080 2834 dbSNP
rs1287387023 2841 dbSNP
rs577463088 2845 dbSNP
rs4788110 2848 dbSNP
rs1038389762 2850 dbSNP
rs988928236 2851 dbSNP
rs767576376 2852 dbSNP
rs58601202 2853 dbSNP
rs1331591365 2854 dbSNP
rs1443842811 2857 dbSNP
rs1035255905 2858 dbSNP
rs1043818808 2864 dbSNP
rs1460638243 2868 dbSNP
rs960566153 2874 dbSNP
rs1009304721 2875 dbSNP
rs562927084 2876 dbSNP
rs967805616 2878 dbSNP
rs572848148 2881 dbSNP
rs1180935156 2889 dbSNP
rs540211551 2892 dbSNP
rs1409725591 2894 dbSNP
rs1245223239 2897 dbSNP
rs1481706585 2897 dbSNP
rs200185241 2898 dbSNP
rs397691249 2898 dbSNP
rs55964416 2898 dbSNP
rs903959520 2898 dbSNP
rs1309288437 2905 dbSNP
rs1224993820 2910 dbSNP
rs1365007957 2917 dbSNP
rs561560444 2918 dbSNP
rs1436180767 2920 dbSNP
rs1161550695 2922 dbSNP
rs1366644535 2926 dbSNP
rs1412958908 2932 dbSNP
rs1469432020 2937 dbSNP
rs926957188 2946 dbSNP
rs1171045737 2950 dbSNP
rs71389573 2956 dbSNP
rs964611370 2960 dbSNP
rs574917509 2968 dbSNP
rs941028760 2970 dbSNP
rs71389574 2971 dbSNP
rs867373070 2977 dbSNP
rs71389575 2978 dbSNP
rs1038262376 2980 dbSNP
rs918500197 2983 dbSNP
rs1190876922 2998 dbSNP
rs1420988991 2998 dbSNP
rs1423284521 2998 dbSNP
rs71389576 2998 dbSNP
rs1480631025 3015 dbSNP
rs542271149 3018 dbSNP
rs929917896 3025 dbSNP
rs1214198967 3032 dbSNP
rs1328731915 3033 dbSNP
rs144736336 3035 dbSNP
rs773334187 3040 dbSNP
rs528232289 3048 dbSNP
rs71389577 3052 dbSNP
rs1411109155 3057 dbSNP
rs1309982124 3067 dbSNP
rs1300152449 3070 dbSNP
rs1219516437 3080 dbSNP
rs776901154 3084 dbSNP
rs944777886 3085 dbSNP
rs1398563808 3101 dbSNP
rs1230563366 3103 dbSNP
rs1290009347 3105 dbSNP
rs941451204 3114 dbSNP
rs1357554849 3120 dbSNP
rs192320207 3121 dbSNP
rs796776067 3122 dbSNP
rs1470386086 3128 dbSNP
rs1431753318 3132 dbSNP
rs905225277 3136 dbSNP
rs937920657 3140 dbSNP
rs1195051729 3147 dbSNP
rs1056405629 3159 dbSNP
rs78686960 3172 dbSNP
rs1484028571 3175 dbSNP
rs532432550 3181 dbSNP
rs892041917 3182 dbSNP
rs1252550276 3184 dbSNP
rs550909063 3190 dbSNP
rs1432709768 3194 dbSNP
rs1255793362 3215 dbSNP
rs1217149172 3216 dbSNP
rs1340347617 3217 dbSNP
rs775909007 3219 dbSNP
rs1020820261 3220 dbSNP
rs1377627472 3221 dbSNP
rs1302290665 3223 dbSNP
rs763033035 3226 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.822 4.2e-7 0.825 3.5e-7 24 Click to see details
GSE38226 Liver fibrosis 0.468 1.6e-2 0.514 8.6e-3 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.328 6.3e-2 -0.034 4.4e-1 23 Click to see details
GSE19350 CNS germ cell tumors -0.318 1.6e-1 -0.049 4.4e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.292 1.7e-1 0.280 1.8e-1 13 Click to see details
GSE17498 Multiple myeloma -0.127 2.2e-1 -0.231 7.6e-2 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.159 2.2e-1 0.129 2.7e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.151 2.4e-1 -0.090 3.3e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.333 2.6e-1 -0.200 3.5e-1 6 Click to see details
GSE14794 Lymphoblastoid cells -0.057 3.0e-1 -0.059 2.9e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.097 3.0e-1 -0.083 3.3e-1 32 Click to see details
GSE17306 Multiple myeloma 0.074 3.1e-1 0.169 1.2e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.04 3.8e-1 -0.031 4.0e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.049 4.1e-1 -0.026 4.5e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.027 4.6e-1 0.171 2.4e-1 20 Click to see details
GSE21849 B cell lymphoma 0.011 4.8e-1 -0.014 4.7e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.612 0.14 0.500 0.2 5 Click to see details
ESCA -0.397 0.25 -0.200 0.37 5 Click to see details
HNSC -0.683 0.26 -0.500 0.33 3 Click to see details
LIHC -0.076 0.3 -0.046 0.38 49 Click to see details
CHOL 0.188 0.31 0.250 0.26 9 Click to see details
KICH 0.137 0.37 -0.214 0.31 8 Click to see details
STAD 0.103 0.4 -0.190 0.33 8 Click to see details
KIRC 0.042 0.41 0.085 0.33 29 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
KIRP 0.04 0.46 -0.217 0.29 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*