miRTarBase - #MIRT003086 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB6B   
Synonyms -
Description RAB6B, member RAS oncogene family
Transcript NM_016577   
Expression
Putative miRNA Targets on RAB6B
3'UTR of RAB6B
(miRNA target sites are highlighted)
>RAB6B|NM_016577|3'UTR
   1 TGCAGAGCCGACCTGTGGCTTCCCATGACACTCCTTGCTTGTTGTGTTGCTTCCTATTGGCTAGCTTCCTAAGGGGGGAG
  81 GGAACCGAGTTATCAAGATGGGAGGATTTTTCTTTTCTCTCTGTCTTTAGGAGTAGGGTGGGATGGGGAGGGAGGCTGGG
 161 CATCAGGGATCACATCACTCTTAACGGCTGTTACTTAAACAACTATTTTTTGGTTTGGTTGTAATATATTGTACTTTATT
 241 AAGATTGCCAAAAACTGTTAAAATTTAAAAAAAATTTAAATCATGTGTATACAATTTTTTGCCAGATAAAAATGTAGTCA
 321 TTTTTATTTGAAAGATGTGCTTTTTGTTTTTGTATATTTGTAAACTTATAGAGAACCTTTTCCACACACCTCCTCCTTCC
 401 TGTTCTCTTTGAACCATTCATCACCTCTGCCTTCCTCCTATCCCCAGCCCAATAAATTAAAACAATTAACTGAGCAAATT
 481 AATTAGGCTTCAGTCTGGGGCCATCTGGCCCCACTCTCTAGGCCCTACTCCAGTTAAATCAAACATTGGTTGAACACATC
 561 AGCCTCTGAAAAGGTAGCTCTGACTCTTGTCTTTCCATGGCCAGAGTGGGTCGTCAACCTCGTGTGGAGCTGAGACCAAG
 641 GTCTGTGGGCTCTAGGCAGCCCGGCAGCAGCCCCCAGAGGAACTGCTCCCACCTCTCCTTCTCTTTCCCTGAAAAGCCTT
 721 GAAGGGGGTTGAGGGTACAGGCAACCTTGTGTTCTCTGTGCCCTCAGGGACTGGCAGAGCAAGAGGCCATCAGAAGGACG
 801 AGGTGCTGTTGGCAATTGCAGCTGCGTGGTGCGTGGTTTATAGACTGGGGTGCCATGTGTACTTCTGAAAATATTTTAAC
 881 CAGCCCACCCAGCAGTCAGTACACATGCCTGGGCCAAGTCTAAGAAACTCAGTGTGTGATGTTGGGCAGTGTGCCATCCT
 961 GAAGCCTTCCTCCTGGATGTCAGGGAAGCTGGACCACCTGGAGTTGATCCTCTGTGATGGGGAGGCGGGGGGGGGGGGGG
1041 GTGTTGTCTGCAGAACCACCACCTTGAAAGATCCATGTTCTTAGAGCCTCAGCTGCTAATATTGTTGAGTGCTTTCTGGA
1121 AAAGCTGATTTGTTGCTATGTTTTCACCCCAGTGGCATGGCGCAGTTGAAGTCTTTGTGGACATATCTTTGTGGCTACTG
1201 TGGCTGCGCTGTGGTCACCTGAGGATGTGGTTCAGGTGGGGTCTCCAGAAGGCTGCTTGCCCCCAGAGAGCCATCTCTTC
1281 CATTTTTGATTCATTCCTGAGAATGGCTTAGTCCTGAGAATCTGCAAAGTCTCTGAAGAGAACTCTCTCTTCCCACTAAG
1361 TGATATAACCTACTTGGCCAGCATTCCAAATAGACTCAGACTCACTGCCCTGAGCCTGCACAGAGCCAGGTGCAATGGGC
1441 AGTGAGTCTGGCCAAAATGTAAACCCCACCCTCCCTGCTGTCATTGGCTCTCCCTCCAGGCTGCTGCTGGGCATGTCATA
1521 GATGGGATGAATGACCATCTGGGGTATGGTGGGCTGAACTCCACAAGGTCGTTGGAATGAATTTTGAAACTTCTCAGAAA
1601 TTAATCTGAAATGGCAGGCAGTAAGTGCAGCAGAATCTGGCAGGACTGATATTTGTGCAGTGGGCCTGCCACACACCCTC
1681 TGCCTAGGAGGCTGTATGCCAGAGCTCATCTCTAGCAAGGAATTTATCTTCAGGTGAAGAAGAGAGGAAGCAGGATCCCA
1761 CTGAGCACCTCTTGCAGAAGGCAAGGACCAATGTTTGAACGTGTTTCAGATGTCATGTGTTTAGTTTTTATATGTGTGTA
1841 CATAATTATATATAGAGATAGACTTGTGTATACACCTTCCACAAACACATCCTCACGGAGATACATGTGCTCAATGTATA
1921 TTCTTGTTTCTCCTGCTCTCAAGTTGGAACTTGCATTGTGATAAGTTTTGGAAATTCAAAAGTACTGCAACGTGTTGAAA
2001 TAAGAAATACTTAATATTGTCAAATAACTTGTGATTGTCTTGCCATCAATAAAATAATGCATAGTTGTGTTAAACTACAG
2081 GCAAACATAGCCCACGGGAATATCTCCACCATTTCTCTATGTACTTTATATGCACGGGTGTGCATGCCTGTGTGGGCCAG
2161 TGTCCCCCCACCATGGGCACACCCCCAAGTGGTGCTTGTTGGAAGAGTGCTTACTTACCTCGAGAGAATTTACAGGAGTC
2241 CACATGACAGTGTCCTGCCTGGTTGGCAGCGGGGGCCATCACCTGTGGCCTCTGAGACCGCCCCATTTACAGGAATCTGC
2321 ACTGGGTCTCAGTGAATGAACGTATGGTAGATTTTTATTTTCTTGGCACTAAAGATTAGCTTTTTTAAAAAAACATCCCA
2401 TAAAACAGTAGAAACTCAGTTCCCTTCTCAGGGGCACACACATCCAAGGCACCGTGGACTGTGTTTCCATCCTGGCCTAG
2481 AGGAGCAGTAAAAGATAGCATTTGGTTTGACATGGCCTTAGTGAGTCCTGCCTTTCCTAGCATGCACACAACATCCTCTC
2561 TTTGAGTTTGGGTTCTCCCCAGCCCCTTGGCCTCTGAGGCTGAGGGTGGCTTCCTCCCATCCTCCCATCTCAGTGGTTCC
2641 ATGGCGCTCCCTTCGGCACGTGCGGTTTCCGCCCCTCCCTTCCTGGGGTGTGGAAAGGCAGCCAGACCTCTTTTTCAGAA
2721 GTTGTTGGTTCCCTGATTTTTGTCTTGAGCAGGCACCATCCCTGTCCCCTTGCTTGCAGGTAGAATTGGCACAGAGTTAA
2801 GGTTCCATAATAAACTGTTAGGTGCTCTTGAAGAAGATGTCATGGCATTGCCTCAGCACCCCAGCAAGAGCATTGCATCT
2881 TTGCTGAATCCAGATGGGTTAGCAGAGGGCAAATTGGAGGATTCCTTTGAGGAAATGTTCTCAATTGAGCAATTCAGTCC
2961 CTCTCCCCAAAGACTAGACGTGACCTGGCAGATTAGCAGGATCCTCTTGGCCTTCTTTTTTGGGGATGGTGGGAGTGAAG
3041 GGGGTGAATCTTAAAAGCTTATCAACAAAGCTCCTGTTCTGCAGGCATCAGGAAAGTTGAGTGTAAGATGGAAAAAGCAA
3121 ACAGCCTATTTACAAGTGGAAACACATTGGTTCTGATCACTCCTAACTTGCTGGGTGATCATACATACATCAACATGAAG
3201 GTGTGACATCAGAATCATGAGCACCATGGCTGCAGTTGTGTGATCCAAGGCTAGTTGGCTTGGTAGCTGTTGGCAGCAGT
3281 TTCCCTTGGTCAGAGGCCTCCTTGCTATCTATCGCTGCTCTCTTCTTGTCATCCTTAAACATTCAGTCATGTTCCCAGGT
3361 CTGAGGGGAGCAATGGCCAGACCAGTTTCAGTATCTCTGGCAACAGAAACAAGGATTGAAATGGTGGTAGTTAAGAGTGC
3441 AGACACATCTGGGGTGCAACGTCTGCATCATCCTGGTGGCTAGCCAGTGCGGGGAGGCCCTGCCCTGGGATACCAGTTGT
3521 GACAATAAAGGGATGGCCCTCCTGGCTTCAGCATCCTGCAGGTAGAGCAGCCTCATTCCTTCACAAGATGGAAGGCAGGT
3601 GAGGATGTCAGGATGAGATGGGACCAGGTAGCCGAGGACAGTGAGGCATGTCTGAGCCACTTGAGGGGCAGCTGAACAGA
3681 AGGATGTCTGTGTGCATCAACCGAGCAGATTGTGCGCACACTCGTTTCCGAACTGCCTCTCCCCAAAGAATGTGAGGCAT
3761 TGTCACCTTGTTACAGCTATGTGAAGCAGAGCTGTCACAACTTTTCCTGTCTACAGGCAGGAAAACCAGGATGGAGAAGG
3841 GCAACTTGCTTATTAAGATCACCCAGCAAGTTAGGAGTGATCAGAACCAGTGAAGTTTCCATTTTTCATCCATTGCTGCC
3921 CTGTGTGTGAACAAATGTGACTCCATATTTATTACACAGCAAGGACTGCTGTGTGTGGGTGTGTTCCTCAGACCATCTCT
4001 ACTCTTTTTGGTTAGGACACTAGGTTCTTCCCAGCATATGAGTGAGAATATTGGTGGTATTTTGGGCTCCTCTACTGCAC
4081 AAGGGCCAGTCCCCAAGTCTACTCTGATTGATTGTCATGGGCACCCACACAGATCAGGACACCCTTTGAATTTTTGTTTG
4161 ACATGAACTATTTAGGTGTTCCAAAACCTTGGGATCTCAATGTGCAAACTCCTTGGACTCCAGACCCCTGTCTGGTTGGC
4241 ACTCCCAGCAGTGTGTGGTTTCATCAGGAAATCCTTGCAGCAGGGGTTTAGATGGTTCCTTCAGGAGGTGGGAAGCCTCC
4321 ATAGCATTGAAGGCCAGCCTGCATCTCGCGGTGTGTGTCCACTTCTCCCCTCACTTTCCCCTCACCCATCCCTTTAAAGT
4401 GATTGGCTGTGAGGAGCACAGAGGGTGGCAATTCCATCTGTTATGGGCTCAGAAGACATAGCCGCCATGTTGATTTCACA
4481 TTAAACTGTGTAAAATGTGGAAAAGACTCAGCATGTTGGTCAAACAATAAACTGTCCTAATTCTCAAAACAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuguGGUAACAGUGUGAGGu 5'
                ||| ||  ||||||| 
Target 5' ggcttcCCA-TG--ACACTCCt 3'
17 - 35 147.00 -13.30
2
miRNA  3' guUUGUGGUAACA---GUGUGAGgu 5'
            |:||  |||||   |||||||  
Target 5' cgAGCA-GATTGTGCGCACACTCgt 3'
3702 - 3725 143.00 -15.00
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              |||||| | ||||| || 
Target 5' ccccCACCATGGGCACACCCCc 3'
2165 - 2186 142.00 -18.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31493719 3 COSMIC
COSN30102422 54 COSMIC
COSN30154022 54 COSMIC
COSN28197979 73 COSMIC
COSN28190141 100 COSMIC
COSN30498156 205 COSMIC
COSN31569651 272 COSMIC
COSN7818552 275 COSMIC
COSN31484156 305 COSMIC
COSN23354623 405 COSMIC
COSN1267915 696 COSMIC
COSN32073859 799 COSMIC
COSN30158086 800 COSMIC
COSN4894718 806 COSMIC
COSN26639281 853 COSMIC
COSN4811262 977 COSMIC
COSN19666574 980 COSMIC
COSN6425593 1023 COSMIC
COSN20050357 1026 COSMIC
COSN27555092 1027 COSMIC
COSN28845669 1027 COSMIC
COSN20074903 1038 COSMIC
COSN21326413 1088 COSMIC
COSN9001586 1261 COSMIC
COSN26176654 1421 COSMIC
COSN15661187 1731 COSMIC
COSN31562624 1890 COSMIC
COSN31565399 1920 COSMIC
COSN31552510 1992 COSMIC
COSN29043913 2130 COSMIC
COSN505839 2181 COSMIC
COSN26553071 2243 COSMIC
COSN7818550 2270 COSMIC
COSN26634751 2300 COSMIC
COSN6750718 2642 COSMIC
COSN20090898 3634 COSMIC
COSN32177115 4116 COSMIC
COSN15750413 4444 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768100530 1 dbSNP
rs759980284 9 dbSNP
rs774717347 10 dbSNP
rs771112288 13 dbSNP
rs773203969 17 dbSNP
rs1162325387 18 dbSNP
rs769842460 21 dbSNP
rs1297358923 23 dbSNP
rs1422853325 24 dbSNP
rs748174713 25 dbSNP
rs1037002397 29 dbSNP
rs1451612193 30 dbSNP
rs1398698546 31 dbSNP
rs200553268 34 dbSNP
rs754852978 38 dbSNP
rs762372552 41 dbSNP
rs369228908 44 dbSNP
rs758028508 45 dbSNP
rs750071125 51 dbSNP
rs749716053 56 dbSNP
rs1313961554 59 dbSNP
rs550352284 68 dbSNP
rs949419368 70 dbSNP
rs1285971710 73 dbSNP
rs1052690305 74 dbSNP
rs774666750 75 dbSNP
rs536858692 78 dbSNP
rs1440117579 86 dbSNP
rs1417085157 87 dbSNP
rs1157785619 89 dbSNP
rs1043359374 106 dbSNP
rs925081971 117 dbSNP
rs948693933 119 dbSNP
rs1357489858 120 dbSNP
rs979270880 123 dbSNP
rs1303652892 138 dbSNP
rs73861225 142 dbSNP
rs1471061676 145 dbSNP
rs1308966261 178 dbSNP
rs992679899 179 dbSNP
rs938721761 185 dbSNP
rs919350979 186 dbSNP
rs1160268863 191 dbSNP
rs375850508 191 dbSNP
rs767559130 203 dbSNP
rs1176143657 204 dbSNP
rs913643311 205 dbSNP
rs1311115898 212 dbSNP
rs972022718 217 dbSNP
rs1210124186 225 dbSNP
rs975770864 231 dbSNP
rs1479425443 233 dbSNP
rs1177830796 237 dbSNP
rs1238558053 242 dbSNP
rs191698478 243 dbSNP
rs1441532830 245 dbSNP
rs966135020 246 dbSNP
rs1019851126 248 dbSNP
rs1414011404 259 dbSNP
rs1176822717 266 dbSNP
rs963708664 267 dbSNP
rs909246364 270 dbSNP
rs986772657 271 dbSNP
rs528054508 272 dbSNP
rs1027081812 275 dbSNP
rs867553368 275 dbSNP
rs769213051 277 dbSNP
rs1219327160 281 dbSNP
rs1028710797 282 dbSNP
rs559070624 283 dbSNP
rs1280097879 285 dbSNP
rs995641061 285 dbSNP
rs144549191 294 dbSNP
rs997651800 305 dbSNP
rs1197611060 307 dbSNP
rs1258240945 315 dbSNP
rs1016134843 326 dbSNP
rs1013582295 327 dbSNP
rs1478305077 336 dbSNP
rs1237531906 338 dbSNP
rs896510342 346 dbSNP
rs1427344002 352 dbSNP
rs533662549 354 dbSNP
rs965063744 357 dbSNP
rs1170250528 363 dbSNP
rs1031385631 367 dbSNP
rs937880362 369 dbSNP
rs1349859205 377 dbSNP
rs2293374 387 dbSNP
rs1276168108 392 dbSNP
rs1262333401 402 dbSNP
rs1217416694 408 dbSNP
rs2293375 416 dbSNP
rs575909702 425 dbSNP
rs945229915 427 dbSNP
rs1207896624 440 dbSNP
rs1288847275 442 dbSNP
rs1042753294 450 dbSNP
rs1013227216 457 dbSNP
rs894405849 458 dbSNP
rs1056954525 466 dbSNP
rs1487350355 467 dbSNP
rs1304826162 469 dbSNP
rs910186349 472 dbSNP
rs187310541 479 dbSNP
rs919133264 495 dbSNP
rs1036442165 500 dbSNP
rs942154333 518 dbSNP
rs1413511652 522 dbSNP
rs909185223 529 dbSNP
rs1406261487 530 dbSNP
rs1326115459 533 dbSNP
rs541944734 538 dbSNP
rs986165465 542 dbSNP
rs1359144631 545 dbSNP
rs953727120 549 dbSNP
rs1298254930 559 dbSNP
rs1342036833 564 dbSNP
rs1027197466 566 dbSNP
rs1242160935 572 dbSNP
rs1454834545 574 dbSNP
rs1229748559 589 dbSNP
rs1356798573 589 dbSNP
rs573317973 590 dbSNP
rs1283833756 597 dbSNP
rs1352831020 607 dbSNP
rs923532179 612 dbSNP
rs976181143 613 dbSNP
rs1489432090 615 dbSNP
rs1185705777 618 dbSNP
rs1015668800 621 dbSNP
rs139762506 622 dbSNP
rs1157623811 629 dbSNP
rs896580348 630 dbSNP
rs1031158895 634 dbSNP
rs769982938 636 dbSNP
rs746130322 641 dbSNP
rs181977452 642 dbSNP
rs1333098817 644 dbSNP
rs1413969954 657 dbSNP
rs1002206292 662 dbSNP
rs1449978285 663 dbSNP
rs1306777755 670 dbSNP
rs1352948333 675 dbSNP
rs903768559 677 dbSNP
rs1043703187 679 dbSNP
rs576687348 680 dbSNP
rs1012593718 682 dbSNP
rs1443191131 683 dbSNP
rs776519267 698 dbSNP
rs1185851082 700 dbSNP
rs575572282 715 dbSNP
rs892323388 717 dbSNP
rs757225817 720 dbSNP
rs1464135036 721 dbSNP
rs189273720 725 dbSNP
rs1057071238 728 dbSNP
rs1329131459 729 dbSNP
rs910303321 731 dbSNP
rs1002826926 738 dbSNP
rs1215065212 740 dbSNP
rs536822006 744 dbSNP
rs1311409893 749 dbSNP
rs1293784124 751 dbSNP
rs1036220250 762 dbSNP
rs942084627 764 dbSNP
rs1274298031 765 dbSNP
rs1457312723 769 dbSNP
rs567929379 779 dbSNP
rs1236953187 781 dbSNP
rs1415853545 788 dbSNP
rs756861592 791 dbSNP
rs1306158127 792 dbSNP
rs1441435370 793 dbSNP
rs1372946161 797 dbSNP
rs1323600567 799 dbSNP
rs909310561 800 dbSNP
rs1253316895 803 dbSNP
rs1388845092 806 dbSNP
rs1050822432 815 dbSNP
rs930343835 816 dbSNP
rs1363767980 819 dbSNP
rs1481246946 820 dbSNP
rs1200228212 821 dbSNP
rs1455933751 823 dbSNP
rs1251524748 825 dbSNP
rs868685878 826 dbSNP
rs1399042151 829 dbSNP
rs1465557639 830 dbSNP
rs1286601652 831 dbSNP
rs548399884 832 dbSNP
rs974317800 833 dbSNP
rs1350013464 837 dbSNP
rs1256618334 838 dbSNP
rs753334867 840 dbSNP
rs1349884848 843 dbSNP
rs1301001261 844 dbSNP
rs1453737641 850 dbSNP
rs534397183 855 dbSNP
rs565813130 856 dbSNP
rs1326729974 857 dbSNP
rs1319847747 858 dbSNP
rs1209838226 859 dbSNP
rs1219688327 872 dbSNP
rs1380077717 879 dbSNP
rs1383657155 882 dbSNP
rs1333321968 883 dbSNP
rs1253417074 888 dbSNP
rs935609994 891 dbSNP
rs879069953 898 dbSNP
rs777529933 904 dbSNP
rs1209754522 916 dbSNP
rs1437138707 918 dbSNP
rs1268598961 928 dbSNP
rs1393792225 929 dbSNP
rs1173473840 933 dbSNP
rs992343962 942 dbSNP
rs1450440221 953 dbSNP
rs1477924828 954 dbSNP
rs961042670 958 dbSNP
rs555649442 961 dbSNP
rs968839833 965 dbSNP
rs1191337152 966 dbSNP
rs751580131 967 dbSNP
rs1002203095 975 dbSNP
rs1392747841 975 dbSNP
rs751036251 980 dbSNP
rs1185728814 989 dbSNP
rs1021379025 991 dbSNP
rs1406873096 993 dbSNP
rs1296401730 994 dbSNP
rs1488647988 1004 dbSNP
rs1340176754 1009 dbSNP
rs1271002898 1010 dbSNP
rs1298265035 1012 dbSNP
rs1320307079 1014 dbSNP
rs1220101220 1015 dbSNP
rs551874738 1016 dbSNP
rs1177274305 1017 dbSNP
rs1357441002 1018 dbSNP
rs1456075624 1019 dbSNP
rs1291097890 1020 dbSNP
rs1228510887 1022 dbSNP
rs1019777594 1023 dbSNP
rs1293625596 1024 dbSNP
rs1200521567 1025 dbSNP
rs1004416371 1026 dbSNP
rs1187913329 1027 dbSNP
rs1253554673 1028 dbSNP
rs1417756641 1029 dbSNP
rs1423063575 1029 dbSNP
rs991688175 1029 dbSNP
rs1290860707 1030 dbSNP
rs958354607 1030 dbSNP
rs1035387434 1031 dbSNP
rs1238591493 1031 dbSNP
rs1002770662 1032 dbSNP
rs892401218 1032 dbSNP
rs147159300 1033 dbSNP
rs765765213 1033 dbSNP
rs1015141018 1034 dbSNP
rs1444407545 1034 dbSNP
rs1309207218 1035 dbSNP
rs888856344 1035 dbSNP
rs1305509565 1036 dbSNP
rs1050171201 1037 dbSNP
rs1210373656 1037 dbSNP
rs1238768120 1038 dbSNP
rs1403613464 1038 dbSNP
rs1423134775 1039 dbSNP
rs1364454842 1040 dbSNP
rs1431662699 1041 dbSNP
rs1291347181 1042 dbSNP
rs1331076539 1042 dbSNP
rs1464409035 1042 dbSNP
rs1491078109 1042 dbSNP
rs55951806 1042 dbSNP
rs767736733 1042 dbSNP
rs773116173 1042 dbSNP
rs869035840 1042 dbSNP
rs887330360 1042 dbSNP
rs1308097398 1043 dbSNP
rs1217828712 1044 dbSNP
rs1258459008 1044 dbSNP
rs1284839542 1044 dbSNP
rs1315631211 1044 dbSNP
rs1491168141 1044 dbSNP
rs1006059608 1045 dbSNP
rs1245985531 1045 dbSNP
rs141016768 1045 dbSNP
rs1491372144 1045 dbSNP
rs1431788664 1046 dbSNP
rs1476948758 1048 dbSNP
rs1170498614 1049 dbSNP
rs1420656848 1050 dbSNP
rs1411947418 1051 dbSNP
rs1163301821 1055 dbSNP
rs1405053731 1057 dbSNP
rs1463020159 1061 dbSNP
rs568212959 1066 dbSNP
rs564719935 1073 dbSNP
rs1433582866 1091 dbSNP
rs930291502 1098 dbSNP
rs551316144 1103 dbSNP
rs1226358569 1105 dbSNP
rs760571488 1122 dbSNP
rs1289084272 1124 dbSNP
rs1036050054 1136 dbSNP
rs1223378935 1136 dbSNP
rs1271141131 1140 dbSNP
rs35586040 1151 dbSNP
rs940229773 1161 dbSNP
rs531268431 1162 dbSNP
rs1242851883 1164 dbSNP
rs1268340627 1165 dbSNP
rs1484644308 1171 dbSNP
rs376113060 1173 dbSNP
rs1413765649 1175 dbSNP
rs542457746 1176 dbSNP
rs1196466639 1177 dbSNP
rs992730242 1177 dbSNP
rs1358087161 1182 dbSNP
rs1481618801 1183 dbSNP
rs1318598315 1189 dbSNP
rs183770585 1197 dbSNP
rs1267082595 1198 dbSNP
rs1226908590 1202 dbSNP
rs924203898 1207 dbSNP
rs980881407 1208 dbSNP
rs1351607783 1213 dbSNP
rs180672691 1220 dbSNP
rs946904446 1221 dbSNP
rs1022281351 1222 dbSNP
rs1185952029 1236 dbSNP
rs1237250382 1237 dbSNP
rs188571379 1238 dbSNP
rs1345451418 1242 dbSNP
rs1009572734 1244 dbSNP
rs1308254770 1246 dbSNP
rs956797182 1246 dbSNP
rs1392659504 1247 dbSNP
rs753606684 1248 dbSNP
rs1393634285 1249 dbSNP
rs1297305415 1250 dbSNP
rs1469969789 1256 dbSNP
rs1408116414 1258 dbSNP
rs916770772 1258 dbSNP
rs1018896036 1260 dbSNP
rs991242749 1261 dbSNP
rs766072299 1275 dbSNP
rs1412400328 1280 dbSNP
rs760039959 1287 dbSNP
rs958465677 1288 dbSNP
rs1035329377 1290 dbSNP
rs981115507 1292 dbSNP
rs1375998064 1310 dbSNP
rs961920199 1312 dbSNP
rs72976328 1316 dbSNP
rs1280180474 1318 dbSNP
rs1006589632 1327 dbSNP
rs746338832 1329 dbSNP
rs1262673519 1330 dbSNP
rs12637730 1335 dbSNP
rs1205913406 1340 dbSNP
rs1236933417 1347 dbSNP
rs1248478230 1351 dbSNP
rs757536011 1351 dbSNP
rs1181993544 1353 dbSNP
rs1365018958 1354 dbSNP
rs1029271343 1357 dbSNP
rs1171649353 1364 dbSNP
rs996194017 1366 dbSNP
rs1470846932 1370 dbSNP
rs1329021290 1380 dbSNP
rs1399514768 1387 dbSNP
rs1391882593 1389 dbSNP
rs1461937790 1390 dbSNP
rs1056742244 1403 dbSNP
rs543297110 1404 dbSNP
rs574420500 1405 dbSNP
rs1282904820 1409 dbSNP
rs377517379 1420 dbSNP
rs939488413 1421 dbSNP
rs1225774979 1433 dbSNP
rs1202176103 1435 dbSNP
rs1480626485 1440 dbSNP
rs1196901677 1461 dbSNP
rs1323229127 1469 dbSNP
rs1253208849 1472 dbSNP
rs1449412585 1479 dbSNP
rs926749214 1480 dbSNP
rs368002574 1484 dbSNP
rs1481196804 1485 dbSNP
rs1241781576 1486 dbSNP
rs554463499 1490 dbSNP
rs935337030 1492 dbSNP
rs1462242607 1497 dbSNP
rs534857685 1502 dbSNP
rs1333523016 1510 dbSNP
rs745329308 1511 dbSNP
rs1388422926 1512 dbSNP
rs781534214 1519 dbSNP
rs1302592156 1522 dbSNP
rs1346459094 1537 dbSNP
rs1406983984 1551 dbSNP
rs915336173 1553 dbSNP
rs565595448 1562 dbSNP
rs1228567643 1565 dbSNP
rs1253619529 1567 dbSNP
rs1354835199 1570 dbSNP
rs988538265 1571 dbSNP
rs1490680260 1583 dbSNP
rs558621119 1587 dbSNP
rs946990063 1589 dbSNP
rs1191067948 1595 dbSNP
rs916739014 1604 dbSNP
rs1384556503 1617 dbSNP
rs1428920371 1619 dbSNP
rs1334203885 1621 dbSNP
rs1195031227 1623 dbSNP
rs146832363 1633 dbSNP
rs1163071022 1637 dbSNP
rs1385336868 1647 dbSNP
rs569682570 1652 dbSNP
rs987432129 1665 dbSNP
rs1296622238 1669 dbSNP
rs937042841 1684 dbSNP
rs1451499233 1687 dbSNP
rs1383177963 1695 dbSNP
rs953307087 1696 dbSNP
rs1339297996 1703 dbSNP
rs1028746994 1713 dbSNP
rs1245869129 1713 dbSNP
rs1362201360 1722 dbSNP
rs1213761948 1731 dbSNP
rs1181157104 1734 dbSNP
rs1485970615 1738 dbSNP
rs1206742363 1739 dbSNP
rs1253798090 1744 dbSNP
rs775802551 1744 dbSNP
rs928375298 1746 dbSNP
rs548317693 1747 dbSNP
rs1386974272 1752 dbSNP
rs373057917 1754 dbSNP
rs770210546 1756 dbSNP
rs1446548994 1761 dbSNP
rs1156987058 1769 dbSNP
rs1245235344 1782 dbSNP
rs1454501258 1797 dbSNP
rs1291060569 1800 dbSNP
rs1330776893 1801 dbSNP
rs1404366954 1803 dbSNP
rs184736767 1805 dbSNP
rs1461186089 1807 dbSNP
rs566878366 1808 dbSNP
rs898913004 1814 dbSNP
rs1237370818 1816 dbSNP
rs1305663500 1824 dbSNP
rs1281096785 1828 dbSNP
rs1317202598 1830 dbSNP
rs548456072 1831 dbSNP
rs984711653 1833 dbSNP
rs952078137 1836 dbSNP
rs770517257 1849 dbSNP
rs1349149819 1850 dbSNP
rs1460732342 1853 dbSNP
rs1260587185 1858 dbSNP
rs540396560 1859 dbSNP
rs200009914 1863 dbSNP
rs895512852 1863 dbSNP
rs1057214507 1870 dbSNP
rs112030809 1872 dbSNP
rs1360922223 1875 dbSNP
rs1419692388 1876 dbSNP
rs1161591434 1888 dbSNP
rs746243177 1889 dbSNP
rs1312489337 1893 dbSNP
rs776766805 1896 dbSNP
rs192943001 1897 dbSNP
rs1337767188 1903 dbSNP
rs1326846190 1904 dbSNP
rs559567209 1905 dbSNP
rs188765335 1906 dbSNP
rs369863143 1914 dbSNP
rs1224930787 1921 dbSNP
rs995974515 1925 dbSNP
rs1298774089 1931 dbSNP
rs139075695 1933 dbSNP
rs563319953 1938 dbSNP
rs1223934398 1940 dbSNP
rs1264767025 1942 dbSNP
rs946901933 1944 dbSNP
rs915308109 1950 dbSNP
rs1164089166 1953 dbSNP
rs1233344042 1955 dbSNP
rs1481012685 1961 dbSNP
rs935314961 1979 dbSNP
rs1267087056 1988 dbSNP
rs1480227853 1989 dbSNP
rs1018984839 1990 dbSNP
rs375499222 1991 dbSNP
rs1161949261 1992 dbSNP
rs902501878 1997 dbSNP
rs987449132 2000 dbSNP
rs953264722 2004 dbSNP
rs1300714918 2010 dbSNP
rs1044142406 2012 dbSNP
rs1243119415 2014 dbSNP
rs1195803524 2022 dbSNP
rs1011131269 2025 dbSNP
rs895398364 2028 dbSNP
rs1055263134 2030 dbSNP
rs771214822 2031 dbSNP
rs1288917720 2046 dbSNP
rs1309152745 2047 dbSNP
rs747009816 2048 dbSNP
rs1244873582 2051 dbSNP
rs1004607943 2059 dbSNP
rs960078122 2062 dbSNP
rs1271269693 2065 dbSNP
rs1035322398 2072 dbSNP
rs1001208660 2088 dbSNP
rs1420903980 2091 dbSNP
rs150755153 2095 dbSNP
rs114059350 2096 dbSNP
rs1011059755 2100 dbSNP
rs1424670996 2111 dbSNP
rs894001521 2120 dbSNP
rs1270547778 2127 dbSNP
rs1429817918 2127 dbSNP
rs1364057283 2130 dbSNP
rs940463681 2130 dbSNP
rs1314204820 2132 dbSNP
rs1358853316 2135 dbSNP
rs907517285 2136 dbSNP
rs1053044295 2137 dbSNP
rs1445468482 2138 dbSNP
rs1447040046 2143 dbSNP
rs984876675 2147 dbSNP
rs1406666545 2157 dbSNP
rs553154557 2164 dbSNP
rs911974672 2169 dbSNP
rs1051710622 2170 dbSNP
rs141174794 2173 dbSNP
rs185102483 2178 dbSNP
rs1404784262 2180 dbSNP
rs1385116127 2182 dbSNP
rs921847386 2183 dbSNP
rs1164900734 2185 dbSNP
rs974672251 2189 dbSNP
rs965844459 2197 dbSNP
rs1018764316 2199 dbSNP
rs558332672 2205 dbSNP
rs1420505778 2211 dbSNP
rs1169827933 2219 dbSNP
rs538717705 2221 dbSNP
rs967217809 2222 dbSNP
rs1450132485 2236 dbSNP
rs921835297 2239 dbSNP
rs1022263997 2244 dbSNP
rs1246859354 2246 dbSNP
rs973323281 2250 dbSNP
rs1348880350 2252 dbSNP
rs1423326203 2253 dbSNP
rs1223443186 2255 dbSNP
rs1011330887 2268 dbSNP
rs895359530 2270 dbSNP
rs1055380487 2271 dbSNP
rs1220202654 2276 dbSNP
rs1437865541 2295 dbSNP
rs1003830131 2298 dbSNP
rs906685291 2299 dbSNP
rs1037226738 2300 dbSNP
rs1158816679 2300 dbSNP
rs1409641110 2303 dbSNP
rs1468084361 2310 dbSNP
rs940428497 2317 dbSNP
rs886196309 2327 dbSNP
rs1048685419 2330 dbSNP
rs1326708491 2331 dbSNP
rs1334066225 2335 dbSNP
rs1338552227 2337 dbSNP
rs569817116 2340 dbSNP
rs1280386160 2341 dbSNP
rs1225339973 2342 dbSNP
rs1001197357 2353 dbSNP
rs1262890507 2370 dbSNP
rs1343585185 2371 dbSNP
rs1324639645 2379 dbSNP
rs969734458 2383 dbSNP
rs1282488880 2386 dbSNP
rs1436744032 2387 dbSNP
rs573139363 2387 dbSNP
rs879342316 2394 dbSNP
rs1011132069 2395 dbSNP
rs894065688 2396 dbSNP
rs921638960 2398 dbSNP
rs974620113 2399 dbSNP
rs1429759825 2402 dbSNP
rs1052574143 2408 dbSNP
rs554624195 2415 dbSNP
rs1395629352 2424 dbSNP
rs1218256158 2429 dbSNP
rs890545179 2434 dbSNP
rs1329615563 2435 dbSNP
rs748912668 2439 dbSNP
rs944652424 2444 dbSNP
rs556188074 2453 dbSNP
rs536264477 2454 dbSNP
rs1235819232 2460 dbSNP
rs758233310 2463 dbSNP
rs754284445 2465 dbSNP
rs1195944514 2467 dbSNP
rs1276140446 2469 dbSNP
rs141140189 2471 dbSNP
rs966782555 2488 dbSNP
rs1198249884 2491 dbSNP
rs1022802090 2497 dbSNP
rs1037685773 2499 dbSNP
rs375916605 2500 dbSNP
rs989618045 2512 dbSNP
rs539954260 2513 dbSNP
rs941919200 2522 dbSNP
rs571447377 2525 dbSNP
rs907790765 2534 dbSNP
rs115477157 2538 dbSNP
rs1033707935 2543 dbSNP
rs1372485994 2544 dbSNP
rs1003779211 2547 dbSNP
rs1302800793 2552 dbSNP
rs756290005 2564 dbSNP
rs906801799 2571 dbSNP
rs1326418255 2581 dbSNP
rs1015736730 2582 dbSNP
rs1228811217 2586 dbSNP
rs371094399 2592 dbSNP
rs1263319379 2598 dbSNP
rs1221029955 2602 dbSNP
rs778842198 2605 dbSNP
rs1489254050 2619 dbSNP
rs1203219712 2624 dbSNP
rs528643342 2630 dbSNP
rs1043147 2634 dbSNP
rs1190467914 2641 dbSNP
rs368930826 2642 dbSNP
rs532466289 2645 dbSNP
rs546089367 2646 dbSNP
rs543370780 2647 dbSNP
rs1358428860 2650 dbSNP
rs530107220 2651 dbSNP
rs1459630496 2655 dbSNP
rs1281344895 2658 dbSNP
rs944600183 2658 dbSNP
rs911815580 2659 dbSNP
rs1384707351 2660 dbSNP
rs958309489 2662 dbSNP
rs977911149 2663 dbSNP
rs560994837 2664 dbSNP
rs1376454874 2668 dbSNP
rs781681203 2670 dbSNP
rs945199106 2671 dbSNP
rs1322936514 2674 dbSNP
rs148624690 2675 dbSNP
rs1259736860 2688 dbSNP
rs1486085128 2693 dbSNP
rs1210336358 2706 dbSNP
rs890649450 2710 dbSNP
rs1460811996 2714 dbSNP
rs1183131067 2716 dbSNP
rs1030471306 2722 dbSNP
rs1404336511 2724 dbSNP
rs989956507 2727 dbSNP
rs572282940 2728 dbSNP
rs565072694 2731 dbSNP
rs1401793812 2738 dbSNP
rs1033655628 2745 dbSNP
rs982122312 2748 dbSNP
rs1452560549 2759 dbSNP
rs970929402 2768 dbSNP
rs1244184250 2769 dbSNP
rs755814744 2783 dbSNP
rs1016258563 2786 dbSNP
rs1174990531 2792 dbSNP
rs1305911155 2815 dbSNP
rs192654713 2816 dbSNP
rs111406654 2818 dbSNP
rs1184995367 2820 dbSNP
rs1322497916 2821 dbSNP
rs556299863 2822 dbSNP
rs994973673 2830 dbSNP
rs900276503 2833 dbSNP
rs528855982 2835 dbSNP
rs560110102 2837 dbSNP
rs1175537862 2838 dbSNP
rs1216490446 2839 dbSNP
rs147216787 2843 dbSNP
rs1281993814 2846 dbSNP
rs775917387 2856 dbSNP
rs890158094 2857 dbSNP
rs1238063093 2858 dbSNP
rs1184539292 2864 dbSNP
rs143692143 2872 dbSNP
rs945340652 2875 dbSNP
rs1469571895 2878 dbSNP
rs915039840 2883 dbSNP
rs1316054975 2889 dbSNP
rs553522893 2893 dbSNP
rs1361383017 2894 dbSNP
rs1053644808 2898 dbSNP
rs1381127067 2900 dbSNP
rs138206416 2903 dbSNP
rs1280900795 2905 dbSNP
rs1223849972 2914 dbSNP
rs978723071 2914 dbSNP
rs954977768 2931 dbSNP
rs1030419111 2934 dbSNP
rs996308909 2940 dbSNP
rs566290177 2953 dbSNP
rs3811660 2956 dbSNP
rs1483383717 2960 dbSNP
rs538856528 2961 dbSNP
rs1266975459 2967 dbSNP
rs1480341834 2974 dbSNP
rs569764681 2979 dbSNP
rs982232107 2980 dbSNP
rs1385293266 2985 dbSNP
rs1006203283 2987 dbSNP
rs1165131020 2994 dbSNP
rs1300928462 2997 dbSNP
rs1364550724 3000 dbSNP
rs1436985487 3005 dbSNP
rs1442392120 3007 dbSNP
rs1412875968 3020 dbSNP
rs886467773 3028 dbSNP
rs970710153 3031 dbSNP
rs113723783 3040 dbSNP
rs983422445 3041 dbSNP
rs1207348207 3045 dbSNP
rs1240317628 3048 dbSNP
rs1490246535 3049 dbSNP
rs953011471 3052 dbSNP
rs1044215525 3057 dbSNP
rs1222843678 3060 dbSNP
rs1415219001 3066 dbSNP
rs1027539937 3069 dbSNP
rs530007472 3070 dbSNP
rs1485059987 3071 dbSNP
rs764049703 3073 dbSNP
rs990336980 3078 dbSNP
rs1248515298 3079 dbSNP
rs1450847149 3082 dbSNP
rs777075448 3082 dbSNP
rs76831595 3084 dbSNP
rs986487484 3086 dbSNP
rs1312192965 3088 dbSNP
rs1325035362 3090 dbSNP
rs954924364 3095 dbSNP
rs890109069 3102 dbSNP
rs1042079393 3105 dbSNP
rs1215552600 3107 dbSNP
rs923559907 3109 dbSNP
rs1364458823 3111 dbSNP
rs747293405 3113 dbSNP
rs77116296 3116 dbSNP
rs547523589 3125 dbSNP
rs974879620 3128 dbSNP
rs1312992440 3133 dbSNP
rs1399903602 3136 dbSNP
rs527576610 3138 dbSNP
rs893737664 3143 dbSNP
rs1016336362 3147 dbSNP
rs1315530334 3150 dbSNP
rs79588499 3176 dbSNP
rs775306879 3181 dbSNP
rs937824689 3185 dbSNP
rs545179742 3188 dbSNP
rs1170660152 3190 dbSNP
rs116608154 3193 dbSNP
rs949470374 3217 dbSNP
rs907109309 3219 dbSNP
rs1472815828 3226 dbSNP
rs1417088371 3235 dbSNP
rs1405313236 3236 dbSNP
rs1192939699 3240 dbSNP
rs1044360230 3244 dbSNP
rs1480714250 3250 dbSNP
rs1450371657 3251 dbSNP
rs1335926386 3253 dbSNP
rs908514424 3254 dbSNP
rs1448792371 3255 dbSNP
rs1012744619 3258 dbSNP
rs1371418211 3262 dbSNP
rs748255549 3272 dbSNP
rs1228241960 3279 dbSNP
rs892947751 3288 dbSNP
rs146976395 3294 dbSNP
rs920194966 3297 dbSNP
rs1265104382 3298 dbSNP
rs1202358430 3301 dbSNP
rs1205455469 3305 dbSNP
rs16841014 3307 dbSNP
rs1442539729 3313 dbSNP
rs752979566 3314 dbSNP
rs924394332 3314 dbSNP
rs1469295129 3318 dbSNP
rs1182379199 3326 dbSNP
rs1051195003 3328 dbSNP
rs1468001990 3336 dbSNP
rs1175644842 3340 dbSNP
rs1402797646 3341 dbSNP
rs1415152367 3349 dbSNP
rs964175663 3350 dbSNP
rs1019771536 3352 dbSNP
rs1334265195 3356 dbSNP
rs1276699023 3363 dbSNP
rs555610676 3368 dbSNP
rs373073400 3371 dbSNP
rs1008584331 3376 dbSNP
rs1289152406 3384 dbSNP
rs954505268 3391 dbSNP
rs923506255 3395 dbSNP
rs1384600979 3398 dbSNP
rs553725159 3405 dbSNP
rs1389326194 3412 dbSNP
rs1298431047 3414 dbSNP
rs1346318852 3418 dbSNP
rs1021011934 3419 dbSNP
rs1463194410 3421 dbSNP
rs974994129 3425 dbSNP
rs1352604139 3429 dbSNP
rs755000069 3430 dbSNP
rs1270287549 3435 dbSNP
rs964943241 3435 dbSNP
rs1009243464 3436 dbSNP
rs893501890 3438 dbSNP
rs1169710449 3439 dbSNP
rs533590922 3441 dbSNP
rs1032253295 3442 dbSNP
rs1479362071 3447 dbSNP
rs1002150464 3453 dbSNP
rs749046108 3461 dbSNP
rs1378201811 3472 dbSNP
rs1478962483 3476 dbSNP
rs905007185 3477 dbSNP
rs909345863 3478 dbSNP
rs1429128432 3479 dbSNP
rs984978269 3484 dbSNP
rs1046280470 3486 dbSNP
rs1372607895 3488 dbSNP
rs1470062507 3490 dbSNP
rs949418219 3491 dbSNP
rs1002858009 3496 dbSNP
rs1340873490 3510 dbSNP
rs887204946 3511 dbSNP
rs1276386828 3515 dbSNP
rs1489718574 3523 dbSNP
rs1209083798 3524 dbSNP
rs1267810390 3525 dbSNP
rs1431556376 3529 dbSNP
rs1453053083 3536 dbSNP
rs1047464896 3537 dbSNP
rs60835748 3539 dbSNP
rs919957939 3553 dbSNP
rs187881086 3561 dbSNP
rs1448977542 3562 dbSNP
rs1414945844 3567 dbSNP
rs1178066044 3571 dbSNP
rs1169293397 3572 dbSNP
rs1392318153 3574 dbSNP
rs1422989361 3575 dbSNP
rs1293092166 3578 dbSNP
rs1481734646 3582 dbSNP
rs1256334327 3584 dbSNP
rs1391941567 3585 dbSNP
rs755692600 3587 dbSNP
rs538818083 3589 dbSNP
rs569928369 3594 dbSNP
rs942979884 3596 dbSNP
rs893056108 3600 dbSNP
rs912708302 3601 dbSNP
rs986943268 3622 dbSNP
rs3811659 3624 dbSNP
rs1231681672 3626 dbSNP
rs1020705041 3627 dbSNP
rs998734371 3631 dbSNP
rs759003291 3633 dbSNP
rs371930268 3634 dbSNP
rs1307069109 3637 dbSNP
rs1358258945 3639 dbSNP
rs933643960 3640 dbSNP
rs1247412651 3646 dbSNP
rs73861223 3648 dbSNP
rs1002096601 3656 dbSNP
rs905123016 3674 dbSNP
rs1039362342 3677 dbSNP
rs1249983945 3678 dbSNP
rs1374203011 3680 dbSNP
rs546117723 3683 dbSNP
rs943582031 3687 dbSNP
rs1369249140 3688 dbSNP
rs765681957 3694 dbSNP
rs1157394512 3696 dbSNP
rs1330218523 3702 dbSNP
rs182308237 3703 dbSNP
rs1214237371 3708 dbSNP
rs1407996078 3710 dbSNP
rs1170784378 3712 dbSNP
rs760083177 3713 dbSNP
rs7626433 3715 dbSNP
rs571540706 3716 dbSNP
rs981497367 3720 dbSNP
rs1236616282 3723 dbSNP
rs931419043 3729 dbSNP
rs898479339 3730 dbSNP
rs1039698636 3732 dbSNP
rs957508984 3733 dbSNP
rs1199300964 3737 dbSNP
rs942928077 3739 dbSNP
rs1032970459 3742 dbSNP
rs189690332 3745 dbSNP
rs149306628 3748 dbSNP
rs903044331 3748 dbSNP
rs1180216677 3751 dbSNP
rs1344938567 3752 dbSNP
rs1458061613 3752 dbSNP
rs138782778 3762 dbSNP
rs1162035391 3774 dbSNP
rs1357909412 3777 dbSNP
rs75876017 3780 dbSNP
rs1240595642 3782 dbSNP
rs577456462 3794 dbSNP
rs1407616638 3800 dbSNP
rs1308138053 3801 dbSNP
rs528972080 3802 dbSNP
rs536007146 3802 dbSNP
rs796119918 3804 dbSNP
rs369614510 3807 dbSNP
rs1331940111 3808 dbSNP
rs1281345390 3810 dbSNP
rs772055890 3813 dbSNP
rs941068725 3815 dbSNP
rs958044155 3822 dbSNP
rs1290518113 3835 dbSNP
rs924910316 3838 dbSNP
rs980439322 3842 dbSNP
rs969252827 3844 dbSNP
rs760790980 3853 dbSNP
rs1473153887 3856 dbSNP
rs1049350377 3857 dbSNP
rs1378527873 3857 dbSNP
rs1158316726 3861 dbSNP
rs773429833 3862 dbSNP
rs1445451507 3866 dbSNP
rs540178990 3871 dbSNP
rs1378890282 3873 dbSNP
rs772835923 3876 dbSNP
rs577215707 3879 dbSNP
rs1307077691 3881 dbSNP
rs1370755200 3882 dbSNP
rs919404584 3884 dbSNP
rs1291559950 3892 dbSNP
rs1263071109 3894 dbSNP
rs981611939 3901 dbSNP
rs1207383782 3912 dbSNP
rs577237915 3913 dbSNP
rs1303270211 3920 dbSNP
rs558789042 3921 dbSNP
rs1226251825 3931 dbSNP
rs916031709 3935 dbSNP
rs1483494906 3937 dbSNP
rs1207485578 3938 dbSNP
rs1245347472 3940 dbSNP
rs374904144 3940 dbSNP
rs995582487 3945 dbSNP
rs1192306900 3954 dbSNP
rs1246338141 3956 dbSNP
rs898599380 3959 dbSNP
rs1039646230 3960 dbSNP
rs957418297 3963 dbSNP
rs1006848637 3968 dbSNP
rs558680368 3969 dbSNP
rs891165660 3971 dbSNP
rs545279338 3978 dbSNP
rs1282000314 3979 dbSNP
rs1431270517 3981 dbSNP
rs1162183645 3985 dbSNP
rs576353975 3989 dbSNP
rs967718405 3992 dbSNP
rs1295275220 3993 dbSNP
rs946314475 3996 dbSNP
rs1326757838 3997 dbSNP
rs556709644 3998 dbSNP
rs1297698829 4000 dbSNP
rs878951788 4005 dbSNP
rs1342872542 4006 dbSNP
rs1216578932 4007 dbSNP
rs1398037535 4008 dbSNP
rs913375591 4008 dbSNP
rs1358764687 4010 dbSNP
rs1297673041 4015 dbSNP
rs536456655 4016 dbSNP
rs1249034822 4023 dbSNP
rs936399281 4029 dbSNP
rs1393183655 4030 dbSNP
rs1463925077 4036 dbSNP
rs925024840 4039 dbSNP
rs1248113514 4053 dbSNP
rs1450751578 4056 dbSNP
rs899581394 4066 dbSNP
rs1161627252 4069 dbSNP
rs1412595145 4074 dbSNP
rs1018016861 4075 dbSNP
rs1166650025 4077 dbSNP
rs557502012 4080 dbSNP
rs980553734 4086 dbSNP
rs1373960991 4093 dbSNP
rs1456641471 4096 dbSNP
rs879635092 4097 dbSNP
rs969037854 4097 dbSNP
rs567708575 4101 dbSNP
rs770065945 4103 dbSNP
rs1005610104 4108 dbSNP
rs1378713208 4109 dbSNP
rs1229308766 4113 dbSNP
rs572581356 4115 dbSNP
rs879541001 4115 dbSNP
rs1047189297 4119 dbSNP
rs929537712 4124 dbSNP
rs1465904019 4142 dbSNP
rs1207380507 4150 dbSNP
rs1236609887 4161 dbSNP
rs898089358 4161 dbSNP
rs992072823 4165 dbSNP
rs1409523720 4166 dbSNP
rs951394709 4171 dbSNP
rs1025448793 4174 dbSNP
rs575165400 4175 dbSNP
rs1287330299 4182 dbSNP
rs188045253 4194 dbSNP
rs1358590258 4195 dbSNP
rs1449037024 4197 dbSNP
rs534150145 4199 dbSNP
rs962729316 4202 dbSNP
rs1349043662 4206 dbSNP
rs1228145571 4207 dbSNP
rs1289573286 4209 dbSNP
rs1018311566 4210 dbSNP
rs1006958030 4223 dbSNP
rs1277296727 4224 dbSNP
rs1442449086 4230 dbSNP
rs891108208 4231 dbSNP
rs771027334 4235 dbSNP
rs1249125672 4236 dbSNP
rs1482635647 4239 dbSNP
rs571653470 4242 dbSNP
rs1055913670 4251 dbSNP
rs1010457597 4257 dbSNP
rs115525603 4258 dbSNP
rs1054589168 4263 dbSNP
rs76485805 4264 dbSNP
rs1405650234 4274 dbSNP
rs936149154 4275 dbSNP
rs977827408 4278 dbSNP
rs761947140 4282 dbSNP
rs1044826746 4286 dbSNP
rs967284365 4295 dbSNP
rs1309009316 4321 dbSNP
rs1397726766 4322 dbSNP
rs1337849097 4323 dbSNP
rs1231740480 4324 dbSNP
rs1274739688 4326 dbSNP
rs922553316 4335 dbSNP
rs1173296758 4336 dbSNP
rs1235823441 4338 dbSNP
rs1272111146 4346 dbSNP
rs1464334744 4347 dbSNP
rs372219760 4348 dbSNP
rs537993788 4349 dbSNP
rs531635539 4350 dbSNP
rs1200723435 4359 dbSNP
rs963867160 4362 dbSNP
rs1247180880 4367 dbSNP
rs1454800181 4377 dbSNP
rs992249815 4378 dbSNP
rs929876756 4380 dbSNP
rs1244444226 4386 dbSNP
rs373331036 4387 dbSNP
rs60912492 4390 dbSNP
rs1399124701 4392 dbSNP
rs1274594564 4396 dbSNP
rs1385427137 4397 dbSNP
rs974056924 4403 dbSNP
rs1332167045 4404 dbSNP
rs759719961 4404 dbSNP
rs1340769493 4406 dbSNP
rs1228710714 4409 dbSNP
rs1252659562 4410 dbSNP
rs962510837 4414 dbSNP
rs1290574850 4416 dbSNP
rs1469759481 4417 dbSNP
rs1186519007 4421 dbSNP
rs1263728747 4424 dbSNP
rs1225233237 4431 dbSNP
rs1347295065 4432 dbSNP
rs1194220202 4439 dbSNP
rs1273136252 4440 dbSNP
rs1374983833 4443 dbSNP
rs1456765755 4447 dbSNP
rs1018086284 4448 dbSNP
rs1336588937 4459 dbSNP
rs183164063 4459 dbSNP
rs955467925 4463 dbSNP
rs1333571947 4464 dbSNP
rs1029628986 4471 dbSNP
rs1010653521 4472 dbSNP
rs1445059944 4473 dbSNP
rs1399998660 4477 dbSNP
rs1435150258 4486 dbSNP
rs1297333794 4498 dbSNP
rs1338320470 4499 dbSNP
rs1243874721 4500 dbSNP
rs1177840578 4507 dbSNP
rs1284570894 4519 dbSNP
rs1336599455 4520 dbSNP
rs1206783114 4525 dbSNP
rs891832407 4527 dbSNP
rs1267397179 4528 dbSNP
rs1464542077 4534 dbSNP
rs898077633 4541 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.674 1.5e-4 0.687 1.0e-4 24 Click to see details
GSE38226 Liver fibrosis -0.708 1.6e-4 -0.765 2.7e-5 21 Click to see details
GSE28260 Renal cortex and medulla 0.557 2.4e-2 0.440 6.6e-2 13 Click to see details
GSE27834 Pluripotent stem cells -0.459 3.7e-2 -0.441 4.4e-2 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.298 1.0e-1 -0.176 2.3e-1 20 Click to see details
GSE19350 CNS germ cell tumors -0.355 1.3e-1 -0.357 1.3e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.095 1.9e-1 0.110 1.5e-1 90 Click to see details
GSE21687 Ependynoma primary tumors 0.111 1.9e-1 0.065 3.0e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.123 2.5e-1 0.205 1.3e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.342 2.5e-1 -0.143 3.9e-1 6 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.103 3.1e-1 0.183 1.9e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.082 3.5e-1 0.091 3.4e-1 23 Click to see details
GSE17306 Multiple myeloma 0.049 3.7e-1 0.092 2.6e-1 49 Click to see details
GSE17498 Multiple myeloma -0.027 4.3e-1 0.011 4.7e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.033 4.4e-1 -0.088 3.4e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.03 4.4e-1 0.118 2.9e-1 24 Click to see details
GSE21849 B cell lymphoma -0.009 4.8e-1 0.358 2.8e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.503 0 -0.455 0 49 Click to see details
THCA 0.931 0.01 1.000 0.5 5 Click to see details
KIRP -0.485 0.09 -0.500 0.09 9 Click to see details
STAD -0.436 0.14 -0.167 0.35 8 Click to see details
CHOL 0.392 0.15 0.400 0.14 9 Click to see details
KICH 0.385 0.17 0.357 0.19 8 Click to see details
KIRC -0.18 0.18 -0.080 0.34 29 Click to see details
HNSC 0.835 0.19 0.500 0.33 3 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
ESCA -0.379 0.26 -0.600 0.14 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1