miRTarBase - #MIRT003089 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MECP2   
Synonyms AUTSX3, MRX16, MRX79, MRXS13, MRXSL, PPMX, RS, RTS, RTT
Description methyl-CpG binding protein 2
Transcript NM_004992   
Other Transcripts NM_001110792   
Expression
Putative miRNA Targets on MECP2
3'UTR of MECP2
(miRNA target sites are highlighted)
>MECP2|NM_004992|3'UTR
   1 CTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTG
  81 ACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGTGGG
 161 AGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTT
 241 TGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCACCTC
 321 CCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCCGTTTTCGG
 401 TGCCATCAGTGCCCCGTCTACAGCTCCCCCAGCTCCCCCCACCTCCCCCACTCCCAACCACGTTGGGACAGGGAGGTGTG
 481 AGGCAGGAGAGACAGTTGGATTCTTTAGAGAAGATGGATATGACCAGTGGCTATGGCCTGTGCGATCCCACCCGTGGTGG
 561 CTCAAGTCTGGCCCCACACCAGCCCCAATCCAAAACTGGCAAGGACGCTTCACAGGACAGGAAAGTGGCACCTGTCTGCT
 641 CCAGCTCTGGCATGGCTAGGAGGGGGGAGTCCCTTGAACTACTGGGTGTAGACTGGCCTGAACCACAGGAGAGGATGGCC
 721 CAGGGTGAGGTGGCATGGTCCATTCTCAAGGGACGTCCTCCAACGGGTGGCGCTAGAGGCCATGGAGGCAGTAGGACAAG
 801 GTGCAGGCAGGCTGGCCTGGGGTCAGGCCGGGCAGAGCACAGCGGGGTGAGAGGGATTCCTAATCACTCAGAGCAGTCTG
 881 TGACTTAGTGGACAGGGGAGGGGGCAAAGGGGGAGGAGAAGAAAATGTTCTTCCAGTTACTTTCCAATTCTCCTTTAGGG
 961 ACAGCTTAGAATTATTTGCACTATTGAGTCTTCATGTTCCCACTTCAAAACAAACAGATGCTCTGAGAGCAAACTGGCTT
1041 GAATTGGTGACATTTAGTCCCTCAAGCCACCAGATGTGACAGTGTTGAGAACTACCTGGATTTGTATATATACCTGCGCT
1121 TGTTTTAAAGTGGGCTCAGCACATAGGGTTCCCACGAAGCTCCGAAACTCTAAGTGTTTGCTGCAATTTTATAAGGACTT
1201 CCTGATTGGTTTCTCTTCTCCCCTTCCATTTCTGCCTTTTGTTCATTTCATCCTTTCACTTCTTTCCCTTCCTCCGTCCT
1281 CCTCCTTCCTAGTTCATCCCTTCTCTTCCAGGCAGCCGCGGTGCCCAACCACACTTGTCGGCTCCAGTCCCCAGAACTCT
1361 GCCTGCCCTTTGTCCTCCTGCTGCCAGTACCAGCCCCACCCTGTTTTGAGCCCTGAGGAGGCCTTGGGCTCTGCTGAGTC
1441 CGACCTGGCCTGTCTGTGAAGAGCAAGAGAGCAGCAAGGTCTTGCTCTCCTAGGTAGCCCCCTCTTCCCTGGTAAGAAAA
1521 AGCAAAAGGCATTTCCCACCCTGAACAACGAGCCTTTTCACCCTTCTACTCTAGAGAAGTGGACTGGAGGAGCTGGGCCC
1601 GATTTGGTAGTTGAGGAAAGCACAGAGGCCTCCTGTGGCCTGCCAGTCATCGAGTGGCCCAACAGGGGCTCCATGCCAGC
1681 CGACCTTGACCTCACTCAGAAGTCCAGAGTCTAGCGTAGTGCAGCAGGGCAGTAGCGGTACCAATGCAGAACTCCCAAGA
1761 CCCGAGCTGGGACCAGTACCTGGGTCCCCAGCCCTTCCTCTGCTCCCCCTTTTCCCTCGGAGTTCTTCTTGAATGGCAAT
1841 GTTTTGCTTTTGCTCGATGCAGACAGGGGGCCAGAACACCACACATTTCACTGTCTGTCTGGTCCATAGCTGTGGTGTAG
1921 GGGCTTAGAGGCATGGGCTTGCTGTGGGTTTTTAATTGATCAGTTTTCATGTGGGATCCCATCTTTTTAACCTCTGTTCA
2001 GGAAGTCCTTATCTAGCTGCATATCTTCATCATATTGGTATATCCTTTTCTGTGTTTACAGAGATGTCTCTTATATCTAA
2081 ATCTGTCCAACTGAGAAGTACCTTATCAAAGTAGCAAATGAGACAGCAGTCTTATGCTTCCAGAAACACCCACAGGCATG
2161 TCCCATGTGAGCTGCTGCCATGAACTGTCAAGTGTGTGTTGTCTTGTGTATTTCAGTTATTGTCCCTGGCTTCCTTACTA
2241 TGGTGTAATCATGAAGGAGTGAAACATCATAGAAACTGTCTAGCACTTCCTTGCCAGTCTTTAGTGATCAGGAACCATAG
2321 TTGACAGTTCCAATCAGTAGCTTAAGAAAAAACCGTGTTTGTCTCTTCTGGAATGGTTAGAAGTGAGGGAGTTTGCCCCG
2401 TTCTGTTTGTAGAGTCTCATAGTTGGACTTTCTAGCATATATGTGTCCATTTCCTTATGCTGTAAAAGCAAGTCCTGCAA
2481 CCAAACTCCCATCAGCCCAATCCCTGATCCCTGATCCCTTCCACCTGCTCTGCTGATGACCCCCCCAGCTTCACTTCTGA
2561 CTCTTCCCCAGGAAGGGAAGGGGGGTCAGAAGAGAGGGTGAGTCCTCCAGAACTCTTCCTCCAAGGACAGAAGGCTCCTG
2641 CCCCCATAGTGGCCTCGAACTCCTGGCACTACCAAAGGACACTTATCCACGAGAGCGCAGCATCCGACCAGGTTGTCACT
2721 GAGAAGATGTTTATTTTGGTCAGTTGGGTTTTTATGTATTATACTTAGTCAAATGTAATGTGGCTTCTGGAATCATTGTC
2801 CAGAGCTGCTTCCCCGTCACCTGGGCGTCATCTGGTCCTGGTAAGAGGAGTGCGTGGCCCACCAGGCCCCCCTGTCACCC
2881 ATGACAGTTCATTCAGGGCCGATGGGGCAGTCGTGGTTGGGAACACAGCATTTCAAGCGTCACTTTATTTCATTCGGGCC
2961 CCACCTGCAGCTCCCTCAAAGAGGCAGTTGCCCAGCCTCTTTCCCTTCCAGTTTATTCCAGAGCTGCCAGTGGGGCCTGA
3041 GGCTCCTTAGGGTTTTCTCTCTATTTCCCCCTTTCTTCCTCATTCCCTCGTCTTTCCCAAAGGCATCACGAGTCAGTCGC
3121 CTTTCAGCAGGCAGCCTTGGCGGTTTATCGCCCTGGCAGGCAGGGGCCCTGCAGCTCTCATGCTGCCCCTGCCTTGGGGT
3201 CAGGTTGACAGGAGGTTGGAGGGAAAGCCTTAAGCTGCAGGATTCTCACCAGCTGTGTCCGGCCCAGTTTTGGGGTGTGA
3281 CCTCAATTTCAATTTTGTCTGTACTTGAACATTATGAAGATGGGGGCCTCTTTCAGTGAATTTGTGAACAGCAGAATTGA
3361 CCGACAGCTTTCCAGTACCCATGGGGCTAGGTCATTAAGGCCACATCCACAGTCTCCCCCACCCTTGTTCCAGTTGTTAG
3441 TTACTACCTCCTCTCCTGACAATACTGTATGTCGTCGAGCTCCCCCCAGGTCTACCCCTCCCGGCCCTGCCTGCTGGTGG
3521 GCTTGTCATAGCCAGTGGGATTGCCGGTCTTGACAGCTCAGTGAGCTGGAGATACTTGGTCACAGCCAGGCGCTAGCACA
3601 GCTCCCTTCTGTTGATGCTGTATTCCCATATCAAAAGACACAGGGGACACCCAGAAACGCCACATCCCCCAATCCATCAG
3681 TGCCAAACTAGCCAACGGCCCCAGCTTCTCAGCTCGCTGGATGGCGGAAGCTGCTACTCGTGAGCGCCAGTGCGGGTGCA
3761 GACAATCTTCTGTTGGGTGGCATCATTCCAGGCCCGAAGCATGAACAGTGCACCTGGGACAGGGAGCAGCCCCAAATTGT
3841 CACCTGCTTCTCTGCCCAGCTTTTCATTGCTGTGACAGTGATGGCGAAAGAGGGTAATAACCAGACACAAACTGCCAAGT
3921 TGGGTGGAGAAAGGAGTTTCTTTAGCTGACAGAATCTCTGAATTTTAAATCACTTAGTAAGCGGCTCAAGCCCAGGAGGG
4001 AGCAGAGGGATACGAGCGGAGTCCCCTGCGCGGGACCATCTGGAATTGGTTTAGCCCAAGTGGAGCCTGACAGCCAGAAC
4081 TCTGTGTCCCCCGTCTAACCACAGCTCCTTTTCCAGAGCATTCCAGTCAGGCTCTCTGGGCTGACTGGGCCAGGGGAGGT
4161 TACAGGTACCAGTTCTTTAAGAAGATCTTTGGGCATATACATTTTTAGCCTGTGTCATTGCCCCAAATGGATTCCTGTTT
4241 CAAGTTCACACCTGCAGATTCTAGGACCTGTGTCCTAGACTTCAGGGAGTCAGCTGTTTCTAGAGTTCCTACCATGGAGT
4321 GGGTCTGGAGGACCTGCCCGGTGGGGGGGCAGAGCCCTGCTCCCTCCGGGTCTTCCTACTCTTCTCTCTGCTCTGACGGG
4401 ATTTGTTGATTCTCTCCATTTTGGTGTCTTTCTCTTTTAGATATTGTATCAATCTTTAGAAAAGGCATAGTCTACTTGTT
4481 ATAAATCGTTAGGATACTGCCTCCCCCAGGGTCTAAAATTACATATTAGAGGGGAAAAGCTGAACACTGAAGTCAGTTCT
4561 CAACAATTTAGAAGGAAAACCTAGAAAACATTTGGCAGAAAATTACATTTCGATGTTTTTGAATGAATACGAGCAAGCTT
4641 TTACAACAGTGCTGATCTAAAAATACTTAGCACTTGGCCTGAGATGCCTGGTGAGCATTACAGGCAAGGGGAATCTGGAG
4721 GTAGCCGACCTGAGGACATGGCTTCTGAACCTGTCTTTTGGGAGTGGTATGGAAGGTGGAGCGTTCACCAGTGACCTGGA
4801 AGGCCCAGCACCACCCTCCTTCCCACTCTTCTCATCTTGACAGAGCCTGCCCCAGCGCTGACGTGTCAGGAAAACACCCA
4881 GGGAACTAGGAAGGCACTTCTGCCTGAGGGGCAGCCTGCCTTGCCCACTCCTGCTCTGCTCGCCTCGGATCAGCTGAGCC
4961 TTCTGAGCTGGCCTCTCACTGCCTCCCCAAGGCCCCCTGCCTGCCCTGTCAGGAGGCAGAAGGAAGCAGGTGTGAGGGCA
5041 GTGCAAGGAGGGAGCACAACCCCCAGCTCCCGCTCCGGGCTCCGACTTGTGCACAGGCAGAGCCCAGACCCTGGAGGAAA
5121 TCCTACCTTTGAATTCAAGAACATTTGGGGAATTTGGAAATCTCTTTGCCCCCAAACCCCCATTCTGTCCTACCTTTAAT
5201 CAGGTCCTGCTCAGCAGTGAGAGCAGATGAGGTGAAAAGGCCAAGAGGTTTGGCTCCTGCCCACTGATAGCCCCTCTCCC
5281 CGCAGTGTTTGTGTGTCAAGTGGCAAAGCTGTTCTTCCTGGTGACCCTGATTATATCCAGTAACACATAGACTGTGCGCA
5361 TAGGCCTGCTTTGTCTCCTCTATCCTGGGCTTTTGTTTTGCTTTTTAGTTTTGCTTTTAGTTTTTCTGTCCCTTTTATTT
5441 AACGCACCGACTAGACACACAAAGCAGTTGAATTTTTATATATATATCTGTATATTGCACAATTATAAACTCATTTTGCT
5521 TGTGGCTCCACACACACAAAAAAAGACCTGTTAAAATTATACCTGTTGCTTAATTACAATATTTCTGATAACCATAGCAT
5601 AGGACAAGGGAAAATAAAAAAAGAAAAAAAAGAAAAAAAAACGACAAATCTGTCTGCTGGTCACTTCTTCTGTCCAAGCA
5681 GATTCGTGGTCTTTTCCTCGCTTCTTTCAAGGGCTTTCCTGTGCCAGGTGAAGGAGGCTCCAGGCAGCACCCAGGTTTTG
5761 CACTCTTGTTTCTCCCGTGCTTGTGAAAGAGGTCCCAAGGTTCTGGGTGCAGGAGCGCTCCCTTGACCTGCTGAAGTCCG
5841 GAACGTAGTCGGCACAGCCTGGTCGCCTTCCACCTCTGGGAGCTGGAGTCCACTGGGGTGGCCTGACTCCCCCAGTCCCC
5921 TTCCCGTGACCTGGTCAGGGTGAGCCCATGTGGAGTCAGCCTCGCAGGCCTCCCTGCCAGTAGGGTCCGAGTGTGTTTCA
6001 TCCTTCCCACTCTGTCGAGCCTGGGGGCTGGAGCGGAGACGGGAGGCCTGGCCTGTCTCGGAACCTGTGAGCTGCACCAG
6081 GTAGAACGCCAGGGACCCCAGAATCATGTGCGTCAGTCCAAGGGGTCCCCTCCAGGAGTAGTGAAGACTCCAGAAATGTC
6161 CCTTTCTTCTCCCCCATCCTACGAGTAATTGCATTTGCTTTTGTAATTCTTAATGAGCAATATCTGCTAGAGAGTTTAGC
6241 TGTAACAGTTCTTTTTGATCATCTTTTTTTAATAATTAGAAACACCAAAAAAATCCAGAAACTTGTTCTTCCAAAGCAGA
6321 GAGCATTATAATCACCAGGGCCAAAAGCTTCCCTCCCTGCTGTCATTGCTTCTTCTGAGGCCTGAATCCAAAAGAAAAAC
6401 AGCCATAGGCCCTTTCAGTGGCCGGGCTACCCGTGAGCCCTTCGGAGGACCAGGGCTGGGGCAGCCTCTGGGCCCACATC
6481 CGGGGCCAGCTCCGGCGTGTGTTCAGTGTTAGCAGTGGGTCATGATGCTCTTTCCCACCCAGCCTGGGATAGGGGCAGAG
6561 GAGGCGAGGAGGCCGTTGCCGCTGATGTTTGGCCGTGAACAGGTGGGTGTCTGCGTGCGTCCACGTGCGTGTTTTCTGAC
6641 TGACATGAAATCGACGCCCGAGTTAGCCTCACCCGGTGACCTCTAGCCCTGCCCGGATGGAGCGGGGCCCACCCGGTTCA
6721 GTGTTTCTGGGGAGCTGGACAGTGGAGTGCAAAAGGCTTGCAGAACTTGAAGCCTGCTCCTTCCCTTGCTACCACGGCCT
6801 CCTTTCCGTTTGATTTGTCACTGCTTCAATCAATAACAGCCGCTCCAGAGTCAGTAGTCAATGAATATATGACCAAATAT
6881 CACCAGGACTGTTACTCAATGTGTGCCGAGCCCTTGCCCATGCTGGGCTCCCGTGTATCTGGACACTGTAACGTGTGCTG
6961 TGTTTGCTCCCCTTCCCCTTCCTTCTTTGCCCTTTACTTGTCTTTCTGGGGTTTTTCTGTTTGGGTTTGGTTTGGTTTTT
7041 ATTTCTCCTTTTGTGTTCCAAACATGAGGTTCTCTCTACTGGTCCTCTTAACTGTGGTGTTGAGGCTTATATTTGTGTAA
7121 TTTTTGGTGGGTGAAAGGAATTTTGCTAAGTAAATCTCTTCTGTGTTTGAACTGAAGTCTGTATTGTAACTATGTTTAAA
7201 GTAATTGTTCCAGAGACAAATATTTCTAGACACTTTTTCTTTACAAACAAAAGCATTCGGAGGGAGGGGGATGGTGACTG
7281 AGATGAGAGGGGAGAGCTGAACAGATGACCCCTGCCCAGATCAGCCAGAAGCCACCCAAAGCAGTGGAGCCCAGGAGTCC
7361 CACTCCAAGCCAGCAAGCCGAATAGCTGATGTGTTGCCACTTTCCAAGTCACTGCAAAACCAGGTTTTGTTCCGCCCAGT
7441 GGATTCTTGTTTTGCTTCCCCTCCCCCCGAGATTATTACCACCATCCCGTGCTTTTAAGGAAAGGCAAGATTGATGTTTC
7521 CTTGAGGGGAGCCAGGAGGGGATGTGTGTGTGCAGAGCTGAAGAGCTGGGGAGAATGGGGCTGGGCCCACCCAAGCAGGA
7601 GGCTGGGACGCTCTGCTGTGGGCACAGGTCAGGCTAATGTTGGCAGATGCAGCTCTTCCTGGACAGGCCAGGTGGTGGGC
7681 ATTCTCTCTCCAAGGTGTGCCCCGTGGGCATTACTGTTTAAGACACTTCCGTCACATCCCACCCCATCCTCCAGGGCTCA
7761 ACACTGTGACATCTCTATTCCCCACCCTCCCCTTCCCAGGGCAATAAAATGACCATGGAGGGGGCTTGCACTCTCTTGGC
7841 TGTCACCCGATCGCCAGCAAAACTTAGATGTGAGAAAACCCCTTCCCATTCCATGGCGAAAACATCTCCTTAGAAAAGCC
7921 ATTACCCTCATTAGGCATGGTTTTGGGCTCCCAAAACACCTGACAGCCCCTCCCTCCTCTGAGAGGCGGAGAGTGCTGAC
8001 TGTAGTGACCATTGCATGCCGGGTGCAGCATCTGGAAGAGCTAGGCAGGGTGTCTGCCCCCTCCTGAGTTGAAGTCATGC
8081 TCCCCTGTGCCAGCCCAGAGGCCGAGAGCTATGGACAGCATTGCCAGTAACACAGGCCACCCTGTGCAGAAGGGAGCTGG
8161 CTCCAGCCTGGAAACCTGTCTGAGGTTGGGAGAGGTGCACTTGGGGCACAGGGAGAGGCCGGGACACACTTAGCTGGAGA
8241 TGTCTCTAAAAGCCCTGTATCGTATTCACCTTCAGTTTTTGTGTTTTGGGACAATTACTTTAGAAAATAAGTAGGTCGTT
8321 TTAAAAACAAAAATTATTGATTGCTTTTTTGTAGTGTTCAGAAAAAAGGTTCTTTGTGTATAGCCAAATGACTGAAAGCA
8401 CTGATATATTTAAAAACAAAAGGCAATTTATTAAGGAAATTTGTACCATTTCAGTAAACCTGTCTGAATGTACCTGTATA
8481 CGTTTCAAAAACACCCCCCCCCCACTGAATCCCTGTAACCTATTTATTATATAAAGAGTTTGCCTTATAAATTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAAC---AGUGUGAGGu 5'
            |: :| :|||     ||||||| 
Target 5' acAGAGCAGTTGAGAGGACACTCCc 3'
368 - 392 144.00 -12.10
2
miRNA  3' guUUGUGGUAACAG----UGUGAGGu 5'
            ::||::| |||:    |||||:| 
Target 5' tgGGCATTACTGTTTAAGACACTTCc 3'
7705 - 7730 142.00 -13.40
3
miRNA  3' guUUGUGGUA------ACAG--UGUGAGGu 5'
            ||||:|||      ||||  :||||:| 
Target 5' gaAACATCATAGAAACTGTCTAGCACTTCc 3'
2261 - 2290 136.00 -17.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
189707 1 ClinVar
378125 1 ClinVar
143293 8 ClinVar
143298 9 ClinVar
560188 9 ClinVar
143481 13 ClinVar
378126 13 ClinVar
986950 13 ClinVar
189646 14 ClinVar
95182 14 ClinVar
380437 16 ClinVar
496982 25 ClinVar
143479 30 ClinVar
189638 30 ClinVar
189660 30 ClinVar
143266 36 ClinVar
189664 40 ClinVar
143279 55 ClinVar
143294 92 ClinVar
143295 92 ClinVar
143296 93 ClinVar
143297 99 ClinVar
211451 118 ClinVar
143250 123 ClinVar
189722 126 ClinVar
143254 177 ClinVar
143255 204 ClinVar
393488 262 ClinVar
143260 328 ClinVar
143262 359 ClinVar
143263 363 ClinVar
143267 371 ClinVar
143269 393 ClinVar
192292 453 ClinVar
143272 487 ClinVar
143273 489 ClinVar
143274 529 ClinVar
143276 544 ClinVar
143278 554 ClinVar
189656 568 ClinVar
143281 767 ClinVar
143285 806 ClinVar
143284 823 ClinVar
143286 831 ClinVar
143290 861 ClinVar
837591 864 ClinVar
143291 876 ClinVar
143292 878 ClinVar
189661 945 ClinVar
143249 1134 ClinVar
143251 1237 ClinVar
143252 1368 ClinVar
143253 1737 ClinVar
813730 2301 ClinVar
189644 2525 ClinVar
143256 2556 ClinVar
143257 2657 ClinVar
143258 2706 ClinVar
143259 2956 ClinVar
406155 3445 ClinVar
143261 3477 ClinVar
143264 3658 ClinVar
143265 3662 ClinVar
143268 3878 ClinVar
143270 4088 ClinVar
143271 4576 ClinVar
143275 5348 ClinVar
143277 5488 ClinVar
143280 5839 ClinVar
143282 7748 ClinVar
143283 7856 ClinVar
143287 8500 ClinVar
143288 8504 ClinVar
143289 8504 ClinVar
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781782964 1 dbSNP
rs782579028 4 dbSNP
rs782523861 5 dbSNP
rs267608330 8 dbSNP
rs144008995 9 dbSNP
rs370633265 10 dbSNP
rs782707184 12 dbSNP
rs267608637 13 dbSNP
rs782334844 13 dbSNP
rs199963992 14 dbSNP
rs1327583285 15 dbSNP
rs1057520854 16 dbSNP
rs1279616868 19 dbSNP
rs202182246 20 dbSNP
rs182066127 25 dbSNP
rs267608393 30 dbSNP
rs781999655 34 dbSNP
rs781888692 35 dbSNP
rs267608347 36 dbSNP
rs1273375047 38 dbSNP
rs781999161 53 dbSNP
rs267608344 55 dbSNP
rs782225133 61 dbSNP
rs782568700 62 dbSNP
rs782318952 65 dbSNP
rs782272757 66 dbSNP
rs1195227725 69 dbSNP
rs1255493980 70 dbSNP
rs782679063 73 dbSNP
rs782534260 75 dbSNP
rs916910044 82 dbSNP
rs782213317 86 dbSNP
rs782631462 87 dbSNP
rs782591546 91 dbSNP
rs62621672 92 dbSNP
rs267608326 93 dbSNP
rs267608341 99 dbSNP
rs1386135268 112 dbSNP
rs189508671 114 dbSNP
rs1353048056 115 dbSNP
rs267608342 123 dbSNP
rs782225490 123 dbSNP
rs927020742 132 dbSNP
rs1341945048 135 dbSNP
rs1236415335 141 dbSNP
rs1259997877 144 dbSNP
rs185048124 145 dbSNP
rs781907104 154 dbSNP
rs1485402452 155 dbSNP
rs73627291 156 dbSNP
rs1258338544 158 dbSNP
rs782072426 159 dbSNP
rs1364753400 162 dbSNP
rs1471334370 163 dbSNP
rs1172352295 165 dbSNP
rs1375412250 166 dbSNP
rs1435858965 167 dbSNP
rs1313017542 171 dbSNP
rs781925698 174 dbSNP
rs267608345 177 dbSNP
rs782767207 183 dbSNP
rs782087390 193 dbSNP
rs3027926 194 dbSNP
rs782363825 195 dbSNP
rs1347138993 201 dbSNP
rs267608352 204 dbSNP
rs1211505876 206 dbSNP
rs1257841430 209 dbSNP
rs1008863218 210 dbSNP
rs1479666048 219 dbSNP
rs1195467299 225 dbSNP
rs1251465572 226 dbSNP
rs1459236297 231 dbSNP
rs1192205411 244 dbSNP
rs953606019 249 dbSNP
rs1455135767 250 dbSNP
rs187969533 258 dbSNP
rs1378871012 259 dbSNP
rs782763596 260 dbSNP
rs1297280539 263 dbSNP
rs1396812818 265 dbSNP
rs898981266 268 dbSNP
rs1323727985 269 dbSNP
rs1234946818 272 dbSNP
rs1305870597 273 dbSNP
rs1226841052 275 dbSNP
rs1036278040 277 dbSNP
rs183655599 280 dbSNP
rs782323109 283 dbSNP
rs1469136792 285 dbSNP
rs1260205355 288 dbSNP
rs1428406626 292 dbSNP
rs1169209327 295 dbSNP
rs1423719997 297 dbSNP
rs781885271 302 dbSNP
rs1393486431 308 dbSNP
rs782329245 309 dbSNP
rs1441314390 313 dbSNP
rs1295040748 314 dbSNP
rs782182860 318 dbSNP
rs1056726196 320 dbSNP
rs782179906 321 dbSNP
rs936983290 323 dbSNP
rs782608295 327 dbSNP
rs62621673 328 dbSNP
rs782240603 331 dbSNP
rs1335950075 333 dbSNP
rs1224288424 337 dbSNP
rs1259307324 341 dbSNP
rs1485866925 343 dbSNP
rs1042798893 344 dbSNP
rs946896971 347 dbSNP
rs868915833 349 dbSNP
rs781830377 350 dbSNP
rs956946485 352 dbSNP
rs377013900 353 dbSNP
rs1166727006 356 dbSNP
rs1452968364 357 dbSNP
rs62621674 359 dbSNP
rs62621675 363 dbSNP
rs1412969716 366 dbSNP
rs953394549 366 dbSNP
rs62620967 367 dbSNP
rs187851059 371 dbSNP
rs146407932 373 dbSNP
rs1217161752 374 dbSNP
rs372821698 376 dbSNP
rs1014716473 377 dbSNP
rs1208170762 378 dbSNP
rs1472958848 379 dbSNP
rs1183169539 381 dbSNP
rs1405532821 384 dbSNP
rs1004631586 392 dbSNP
rs267608361 393 dbSNP
rs1362422532 397 dbSNP
rs1432759844 398 dbSNP
rs782762345 399 dbSNP
rs1001636653 402 dbSNP
rs1450482293 406 dbSNP
rs1277955146 408 dbSNP
rs1373095443 409 dbSNP
rs1224729722 410 dbSNP
rs1311891671 410 dbSNP
rs1346418388 411 dbSNP
rs1234194466 412 dbSNP
rs1278994794 413 dbSNP
rs369316233 414 dbSNP
rs1442431443 415 dbSNP
rs141497603 416 dbSNP
rs1480088574 420 dbSNP
rs1179073439 423 dbSNP
rs1043236487 424 dbSNP
rs947166208 426 dbSNP
rs1172874781 427 dbSNP
rs376211092 430 dbSNP
rs1425988857 433 dbSNP
rs1416205686 434 dbSNP
rs1354220242 435 dbSNP
rs1447783299 440 dbSNP
rs891513515 440 dbSNP
rs1369146986 442 dbSNP
rs1052622618 443 dbSNP
rs1275907123 444 dbSNP
rs782026075 445 dbSNP
rs935458553 449 dbSNP
rs1306617891 450 dbSNP
rs1198877287 451 dbSNP
rs1239793743 452 dbSNP
rs1466933137 454 dbSNP
rs1192966225 455 dbSNP
rs1247259449 456 dbSNP
rs1478958376 457 dbSNP
rs1166288763 458 dbSNP
rs1418892021 461 dbSNP
rs1466339528 461 dbSNP
rs373248662 462 dbSNP
rs1440572366 463 dbSNP
rs1429220214 466 dbSNP
rs782210677 471 dbSNP
rs1339206829 472 dbSNP
rs782803693 473 dbSNP
rs932016189 475 dbSNP
rs1290317270 476 dbSNP
rs1190857605 479 dbSNP
rs1241607663 480 dbSNP
rs782065047 482 dbSNP
rs973776154 483 dbSNP
rs1196153210 486 dbSNP
rs267608325 487 dbSNP
rs111565519 489 dbSNP
rs782358855 491 dbSNP
rs1393320343 492 dbSNP
rs782214288 493 dbSNP
rs983259696 495 dbSNP
rs1400123134 496 dbSNP
rs782665484 499 dbSNP
rs1279516037 506 dbSNP
rs144267471 508 dbSNP
rs1035594048 513 dbSNP
rs1284576562 515 dbSNP
rs1358128488 516 dbSNP
rs782418531 517 dbSNP
rs1218950696 519 dbSNP
rs267608362 529 dbSNP
rs1188425804 532 dbSNP
rs34192817 532 dbSNP
rs905559929 536 dbSNP
rs1468889506 540 dbSNP
rs782580652 541 dbSNP
rs1011635070 543 dbSNP
rs183349022 544 dbSNP
rs267608353 554 dbSNP
rs935511117 555 dbSNP
rs890626687 556 dbSNP
rs1395108407 557 dbSNP
rs1334344149 559 dbSNP
rs1342072082 565 dbSNP
rs369545314 566 dbSNP
rs932261654 569 dbSNP
rs1242221077 573 dbSNP
rs1278288022 580 dbSNP
rs922136401 586 dbSNP
rs1201277647 589 dbSNP
rs1436269301 603 dbSNP
rs1178475169 604 dbSNP
rs1381314650 606 dbSNP
rs149593619 607 dbSNP
rs1172257072 609 dbSNP
rs1392745217 615 dbSNP
rs1465072001 616 dbSNP
rs1172619490 620 dbSNP
rs781846711 621 dbSNP
rs1403962042 624 dbSNP
rs782684894 625 dbSNP
rs3027925 627 dbSNP
rs1448920011 629 dbSNP
rs1301112130 632 dbSNP
rs983480334 634 dbSNP
rs1257820590 635 dbSNP
rs959904865 637 dbSNP
rs1337774851 638 dbSNP
rs1198176884 649 dbSNP
rs1239189585 650 dbSNP
rs781799039 655 dbSNP
rs1434232871 659 dbSNP
rs980304594 660 dbSNP
rs970019094 664 dbSNP
rs1463739390 665 dbSNP
rs1021934215 667 dbSNP
rs1323621191 668 dbSNP
rs1366895135 669 dbSNP
rs1387275379 672 dbSNP
rs1303511081 684 dbSNP
rs193185725 685 dbSNP
rs1320228774 686 dbSNP
rs1212258706 687 dbSNP
rs955675519 689 dbSNP
rs782697616 691 dbSNP
rs1193362408 696 dbSNP
rs1268854663 699 dbSNP
rs372844004 703 dbSNP
rs1007976279 709 dbSNP
rs890847427 711 dbSNP
rs1051938964 713 dbSNP
rs996723075 723 dbSNP
rs1349024710 724 dbSNP
rs900764935 725 dbSNP
rs1382925981 727 dbSNP
rs1038343591 729 dbSNP
rs942058812 731 dbSNP
rs782098517 733 dbSNP
rs907877351 738 dbSNP
rs1322638227 741 dbSNP
rs781864896 746 dbSNP
rs1224456153 747 dbSNP
rs782378694 750 dbSNP
rs1047835979 751 dbSNP
rs372254721 755 dbSNP
rs1215333473 757 dbSNP
rs1263271030 758 dbSNP
rs1489070442 763 dbSNP
rs187932718 764 dbSNP
rs782780006 765 dbSNP
rs267608354 767 dbSNP
rs1298949522 770 dbSNP
rs183441961 772 dbSNP
rs782016660 776 dbSNP
rs955727414 778 dbSNP
rs782328653 787 dbSNP
rs1305291208 791 dbSNP
rs1353706671 792 dbSNP
rs1031352051 794 dbSNP
rs1286128720 795 dbSNP
rs1488958374 800 dbSNP
rs1207631099 803 dbSNP
rs1007860424 804 dbSNP
rs267608363 806 dbSNP
rs368952862 809 dbSNP
rs190249595 810 dbSNP
rs1382266663 811 dbSNP
rs996385564 813 dbSNP
rs900649098 815 dbSNP
rs1175409187 816 dbSNP
rs1360026182 818 dbSNP
rs1450460239 819 dbSNP
rs185146054 820 dbSNP
rs1312050772 821 dbSNP
rs267608375 823 dbSNP
rs1346310308 826 dbSNP
rs1217021649 827 dbSNP
rs1277276499 828 dbSNP
rs182344920 830 dbSNP
rs190920575 831 dbSNP
rs1047740154 832 dbSNP
rs938656528 834 dbSNP
rs782272965 835 dbSNP
rs928766478 838 dbSNP
rs1476993223 839 dbSNP
rs1044857594 842 dbSNP
rs948621608 843 dbSNP
rs782625188 844 dbSNP
rs989950974 845 dbSNP
rs782416253 846 dbSNP
rs1329913398 847 dbSNP
rs782268570 851 dbSNP
rs1273735770 853 dbSNP
rs986475107 854 dbSNP
rs782572404 855 dbSNP
rs187614438 861 dbSNP
rs1199090729 869 dbSNP
rs975565467 871 dbSNP
rs267608364 876 dbSNP
rs782630920 876 dbSNP
rs3027924 878 dbSNP
rs1247389400 880 dbSNP
rs1016851912 882 dbSNP
rs782726890 887 dbSNP
rs371700099 888 dbSNP
rs1191561833 891 dbSNP
rs1423248929 893 dbSNP
rs782109522 895 dbSNP
rs782601555 896 dbSNP
rs1388937600 898 dbSNP
rs1026511405 900 dbSNP
rs1002853838 901 dbSNP
rs907196636 902 dbSNP
rs1324726896 903 dbSNP
rs181697351 904 dbSNP
rs1406285132 905 dbSNP
rs782403208 909 dbSNP
rs1339517181 912 dbSNP
rs782577146 913 dbSNP
rs1271731202 914 dbSNP
rs781906895 914 dbSNP
rs1227705169 917 dbSNP
rs782798267 917 dbSNP
rs1490815075 918 dbSNP
rs782066371 921 dbSNP
rs924549172 932 dbSNP
rs1214621623 935 dbSNP
rs1488740128 936 dbSNP
rs1196039608 940 dbSNP
rs1367106486 945 dbSNP
rs782195866 947 dbSNP
rs986695781 958 dbSNP
rs1416650288 964 dbSNP
rs1418393942 969 dbSNP
rs1295817388 971 dbSNP
rs1359286638 984 dbSNP
rs933709909 991 dbSNP
rs1400251959 994 dbSNP
rs782777999 996 dbSNP
rs920920672 1001 dbSNP
rs782562907 1006 dbSNP
rs1243860307 1014 dbSNP
rs1284560518 1017 dbSNP
rs975072065 1017 dbSNP
rs1354438688 1020 dbSNP
rs1207149030 1025 dbSNP
rs962779450 1027 dbSNP
rs1442036656 1035 dbSNP
rs781793301 1037 dbSNP
rs1188753330 1040 dbSNP
rs1239510015 1041 dbSNP
rs1438400822 1046 dbSNP
rs1016610140 1047 dbSNP
rs984952992 1054 dbSNP
rs782350038 1055 dbSNP
rs1399694336 1057 dbSNP
rs5987193 1064 dbSNP
rs1334566564 1068 dbSNP
rs1384646546 1073 dbSNP
rs1003074022 1082 dbSNP
rs1377511356 1087 dbSNP
rs782087041 1093 dbSNP
rs1241334541 1096 dbSNP
rs1254317368 1099 dbSNP
rs907419372 1104 dbSNP
rs1201192725 1108 dbSNP
rs190425483 1109 dbSNP
rs1012898048 1111 dbSNP
rs1178380631 1112 dbSNP
rs1239373651 1113 dbSNP
rs1421387675 1116 dbSNP
rs1183444959 1117 dbSNP
rs186774570 1118 dbSNP
rs782634507 1122 dbSNP
rs1172748472 1123 dbSNP
rs1408064191 1126 dbSNP
rs782011262 1133 dbSNP
rs267608390 1134 dbSNP
rs1377629017 1139 dbSNP
rs181130816 1146 dbSNP
rs782569825 1152 dbSNP
rs1330545913 1155 dbSNP
rs368130574 1156 dbSNP
rs934502882 1164 dbSNP
rs1316271629 1171 dbSNP
rs1198481851 1172 dbSNP
rs1259108939 1177 dbSNP
rs782703619 1180 dbSNP
rs1208511714 1188 dbSNP
rs1264675907 1194 dbSNP
rs1432048028 1202 dbSNP
rs782377760 1208 dbSNP
rs1431035586 1209 dbSNP
rs1476627519 1223 dbSNP
rs933908700 1230 dbSNP
rs1400673561 1232 dbSNP
rs375292960 1234 dbSNP
rs267608365 1237 dbSNP
rs1039795758 1241 dbSNP
rs941024264 1244 dbSNP
rs909658760 1254 dbSNP
rs1387477484 1257 dbSNP
rs1305022997 1259 dbSNP
rs1338808019 1271 dbSNP
rs1218180884 1272 dbSNP
rs1279253300 1275 dbSNP
rs2853337 1276 dbSNP
rs1265407996 1279 dbSNP
rs1489079187 1282 dbSNP
rs781841291 1284 dbSNP
rs919435294 1286 dbSNP
rs1487106561 1287 dbSNP
rs981596087 1287 dbSNP
rs972076613 1289 dbSNP
rs782323812 1292 dbSNP
rs1367881931 1312 dbSNP
rs1425222364 1317 dbSNP
rs368325086 1318 dbSNP
rs188615745 1320 dbSNP
rs1399649243 1323 dbSNP
rs1298985323 1334 dbSNP
rs1364306333 1336 dbSNP
rs1394701270 1337 dbSNP
rs1312437465 1339 dbSNP
rs1033132717 1340 dbSNP
rs782514136 1347 dbSNP
rs1248723607 1348 dbSNP
rs267608355 1368 dbSNP
rs1350810915 1372 dbSNP
rs1215221845 1374 dbSNP
rs903234243 1376 dbSNP
rs782258519 1383 dbSNP
rs1050917893 1387 dbSNP
rs1445176381 1393 dbSNP
rs998006113 1396 dbSNP
rs3027923 1400 dbSNP
rs1419222162 1404 dbSNP
rs1159901787 1407 dbSNP
rs1347236302 1410 dbSNP
rs1464730394 1414 dbSNP
rs1302640906 1418 dbSNP
rs140263878 1421 dbSNP
rs1455084097 1423 dbSNP
rs1307766064 1424 dbSNP
rs1376779335 1426 dbSNP
rs1238866076 1427 dbSNP
rs941063306 1438 dbSNP
rs909545630 1441 dbSNP
rs2734645 1442 dbSNP
rs782571150 1448 dbSNP
rs1461575329 1456 dbSNP
rs1185171520 1457 dbSNP
rs1438995184 1458 dbSNP
rs1177925177 1477 dbSNP
rs929731968 1478 dbSNP
rs1410171188 1485 dbSNP
rs1431673638 1497 dbSNP
rs927696653 1499 dbSNP
rs1175568376 1502 dbSNP
rs112674002 1510 dbSNP
rs782145119 1515 dbSNP
rs781964847 1543 dbSNP
rs781826270 1550 dbSNP
rs782011969 1554 dbSNP
rs916170371 1571 dbSNP
rs1374810468 1572 dbSNP
rs782093545 1574 dbSNP
rs991751441 1574 dbSNP
rs782488716 1579 dbSNP
rs1205395768 1582 dbSNP
rs1255915794 1590 dbSNP
rs1457267332 1593 dbSNP
rs1205063698 1600 dbSNP
rs781913123 1601 dbSNP
rs1190661408 1606 dbSNP
rs1430314181 1608 dbSNP
rs1481538065 1609 dbSNP
rs1168986848 1610 dbSNP
rs1423284381 1614 dbSNP
rs1033017272 1618 dbSNP
rs1331408947 1625 dbSNP
rs1348620532 1631 dbSNP
rs1433742074 1634 dbSNP
rs998816355 1635 dbSNP
rs41304986 1643 dbSNP
rs1224899547 1644 dbSNP
rs1029717317 1651 dbSNP
rs998450487 1652 dbSNP
rs1275089478 1659 dbSNP
rs782074273 1661 dbSNP
rs1449780304 1665 dbSNP
rs1221009630 1666 dbSNP
rs1269612715 1677 dbSNP
rs1490905152 1681 dbSNP
rs781925601 1682 dbSNP
rs1262955349 1688 dbSNP
rs1475966571 1709 dbSNP
rs781814572 1715 dbSNP
rs191406252 1716 dbSNP
rs1405289266 1721 dbSNP
rs888325749 1727 dbSNP
rs1365599526 1730 dbSNP
rs3027922 1737 dbSNP
rs929617475 1745 dbSNP
rs782025184 1752 dbSNP
rs1046127485 1758 dbSNP
rs950301062 1762 dbSNP
rs1271709788 1763 dbSNP
rs782380224 1764 dbSNP
rs1292614615 1774 dbSNP
rs1361623655 1782 dbSNP
rs782280515 1783 dbSNP
rs1214498351 1784 dbSNP
rs1261364093 1787 dbSNP
rs936240219 1788 dbSNP
rs926169084 1800 dbSNP
rs1236023369 1801 dbSNP
rs149055102 1805 dbSNP
rs1184703367 1810 dbSNP
rs1385348370 1816 dbSNP
rs782189206 1818 dbSNP
rs782308541 1819 dbSNP
rs1400858697 1827 dbSNP
rs1320059038 1831 dbSNP
rs976855688 1832 dbSNP
rs1338429787 1834 dbSNP
rs1451862468 1838 dbSNP
rs782226653 1839 dbSNP
rs782326901 1845 dbSNP
rs1384875917 1846 dbSNP
rs1260219028 1848 dbSNP
rs1351681702 1850 dbSNP
rs1018111096 1853 dbSNP
rs1207063607 1855 dbSNP
rs372191872 1856 dbSNP
rs1461118699 1862 dbSNP
rs888379417 1863 dbSNP
rs189253298 1865 dbSNP
rs782318516 1867 dbSNP
rs781856386 1870 dbSNP
rs1362653030 1873 dbSNP
rs1470319787 1882 dbSNP
rs1159895195 1891 dbSNP
rs1399567021 1893 dbSNP
rs782666494 1899 dbSNP
rs1337138098 1902 dbSNP
rs1408300240 1902 dbSNP
rs879989421 1906 dbSNP
rs782626353 1915 dbSNP
rs1306406349 1921 dbSNP
rs782554890 1923 dbSNP
rs1241488937 1924 dbSNP
rs1273338190 1928 dbSNP
rs1323063919 1936 dbSNP
rs781815316 1937 dbSNP
rs1456833356 1938 dbSNP
rs782562179 1941 dbSNP
rs1195680745 1944 dbSNP
rs1249243402 1949 dbSNP
rs1437944041 1960 dbSNP
rs1183317416 1962 dbSNP
rs112969322 1971 dbSNP
rs781788681 1981 dbSNP
rs782088098 1989 dbSNP
rs1426834545 1991 dbSNP
rs1479905417 1999 dbSNP
rs1176898830 2013 dbSNP
rs1431085249 2018 dbSNP
rs1464022542 2020 dbSNP
rs1297499886 2021 dbSNP
rs1397089447 2026 dbSNP
rs1393265782 2038 dbSNP
rs1321657052 2047 dbSNP
rs906194646 2051 dbSNP
rs1224294203 2061 dbSNP
rs1285605928 2063 dbSNP
rs1316402219 2064 dbSNP
rs1046603639 2072 dbSNP
rs1227108252 2073 dbSNP
rs1252453387 2101 dbSNP
rs1342064414 2107 dbSNP
rs1197108303 2129 dbSNP
rs1266074432 2135 dbSNP
rs1490089014 2137 dbSNP
rs947836503 2150 dbSNP
rs1199636128 2156 dbSNP
rs782494118 2177 dbSNP
rs1426562905 2184 dbSNP
rs894846714 2185 dbSNP
rs1373633288 2191 dbSNP
rs1463401101 2192 dbSNP
rs1161548685 2196 dbSNP
rs1364983636 2216 dbSNP
rs1055985646 2220 dbSNP
rs1405813445 2222 dbSNP
rs1305227035 2224 dbSNP
rs78543190 2227 dbSNP
rs781842218 2230 dbSNP
rs926221519 2233 dbSNP
rs1296729886 2240 dbSNP
rs1309791042 2249 dbSNP
rs1243185300 2261 dbSNP
rs935488182 2264 dbSNP
rs1358059775 2270 dbSNP
rs782795646 2271 dbSNP
rs1293557036 2277 dbSNP
rs977667537 2290 dbSNP
rs1185784174 2302 dbSNP
rs1262095117 2311 dbSNP
rs946065576 2330 dbSNP
rs922637227 2333 dbSNP
rs977120575 2338 dbSNP
rs964181179 2354 dbSNP
rs1018748007 2355 dbSNP
rs1384499717 2356 dbSNP
rs1425433274 2361 dbSNP
rs1165528812 2369 dbSNP
rs1343719177 2371 dbSNP
rs1453246078 2384 dbSNP
rs983951202 2396 dbSNP
rs781885490 2399 dbSNP
rs782728291 2400 dbSNP
rs3813458 2403 dbSNP
rs782033082 2412 dbSNP
rs782705964 2415 dbSNP
rs1246151760 2420 dbSNP
rs1316531751 2424 dbSNP
rs1314778289 2427 dbSNP
rs782050815 2431 dbSNP
rs1261124947 2433 dbSNP
rs1486747858 2442 dbSNP
rs1201511000 2443 dbSNP
rs3813459 2458 dbSNP
rs1185501141 2462 dbSNP
rs188469187 2468 dbSNP
rs1405812709 2471 dbSNP
rs1418746888 2472 dbSNP
rs1160057465 2474 dbSNP
rs1347155202 2482 dbSNP
rs369628636 2486 dbSNP
rs1336471431 2506 dbSNP
rs1468615273 2506 dbSNP
rs1407559922 2518 dbSNP
rs1454988154 2520 dbSNP
rs782339392 2520 dbSNP
rs1024644736 2522 dbSNP
rs1222676189 2533 dbSNP
rs1307324878 2538 dbSNP
rs185203012 2540 dbSNP
rs782221401 2544 dbSNP
rs201027377 2547 dbSNP
rs1012301274 2553 dbSNP
rs267608356 2556 dbSNP
rs1205434149 2559 dbSNP
rs1231288605 2578 dbSNP
rs1480373966 2582 dbSNP
rs1053519930 2585 dbSNP
rs1177829677 2586 dbSNP
rs1410513085 2586 dbSNP
rs1479577879 2621 dbSNP
rs1176169522 2624 dbSNP
rs1430357040 2626 dbSNP
rs1471259774 2633 dbSNP
rs1327483234 2639 dbSNP
rs1354440887 2641 dbSNP
rs1440907898 2643 dbSNP
rs1298242729 2650 dbSNP
rs1351951771 2651 dbSNP
rs3027921 2657 dbSNP
rs782724588 2663 dbSNP
rs1323944691 2664 dbSNP
rs782129135 2668 dbSNP
rs1225089961 2673 dbSNP
rs1041874910 2681 dbSNP
rs1270861313 2686 dbSNP
rs946323430 2689 dbSNP
rs1306834662 2690 dbSNP
rs781980870 2691 dbSNP
rs1041066242 2694 dbSNP
rs1489925396 2696 dbSNP
rs942684853 2697 dbSNP
rs911336239 2705 dbSNP
rs267608357 2706 dbSNP
rs1166502862 2707 dbSNP
rs1419505958 2710 dbSNP
rs1410950632 2711 dbSNP
rs952583250 2712 dbSNP
rs1371819222 2716 dbSNP
rs918428918 2725 dbSNP
rs782070600 2733 dbSNP
rs1345730464 2742 dbSNP
rs1438417527 2743 dbSNP
rs972503004 2758 dbSNP
rs1268195406 2760 dbSNP
rs782265654 2761 dbSNP
rs1361192529 2765 dbSNP
rs1215030406 2796 dbSNP
rs970689569 2797 dbSNP
rs1025284314 2800 dbSNP
rs1357418242 2802 dbSNP
rs1011943842 2814 dbSNP
rs959280082 2815 dbSNP
rs782600953 2816 dbSNP
rs1292850713 2822 dbSNP
rs1000625371 2826 dbSNP
rs782737377 2827 dbSNP
rs782311841 2847 dbSNP
rs1241829138 2848 dbSNP
rs1476038579 2849 dbSNP
rs902224885 2853 dbSNP
rs781927274 2854 dbSNP
rs1422272325 2862 dbSNP
rs1365883931 2863 dbSNP
rs1010790721 2868 dbSNP
rs782237665 2872 dbSNP
rs1431154671 2873 dbSNP
rs1299795284 2874 dbSNP
rs1041673518 2881 dbSNP
rs1380473080 2882 dbSNP
rs942752846 2885 dbSNP
rs911216139 2890 dbSNP
rs1358750327 2896 dbSNP
rs1048350389 2897 dbSNP
rs782369979 2901 dbSNP
rs918649444 2913 dbSNP
rs972554369 2915 dbSNP
rs1218364235 2920 dbSNP
rs1241900004 2925 dbSNP
rs1444558011 2928 dbSNP
rs868980172 2929 dbSNP
rs917864473 2936 dbSNP
rs782604692 2938 dbSNP
rs959284319 2939 dbSNP
rs1156484946 2943 dbSNP
rs1406760726 2955 dbSNP
rs267608358 2956 dbSNP
rs1322292771 2959 dbSNP
rs1403817591 2963 dbSNP
rs1451752196 2964 dbSNP
rs1337493592 2969 dbSNP
rs782378994 2975 dbSNP
rs781857417 2988 dbSNP
rs1236936895 2994 dbSNP
rs1279244758 2996 dbSNP
rs1351661426 2998 dbSNP
rs1000509245 3033 dbSNP
rs1461275038 3034 dbSNP
rs782299775 3050 dbSNP
rs1204813050 3054 dbSNP
rs1256286943 3063 dbSNP
rs1443689627 3070 dbSNP
rs1179028082 3071 dbSNP
rs868971145 3089 dbSNP
rs1020701037 3090 dbSNP
rs1161114685 3109 dbSNP
rs782672469 3110 dbSNP
rs1469254540 3112 dbSNP
rs1010426181 3118 dbSNP
rs28403628 3119 dbSNP
rs1389810838 3125 dbSNP
rs901332667 3141 dbSNP
rs1019901766 3142 dbSNP
rs1411839133 3149 dbSNP
rs1007564043 3150 dbSNP
rs1323229182 3151 dbSNP
rs1224483134 3154 dbSNP
rs1258346480 3157 dbSNP
rs1338013456 3158 dbSNP
rs889999600 3159 dbSNP
rs1249135459 3173 dbSNP
rs1483189637 3180 dbSNP
rs1048402318 3182 dbSNP
rs931286827 3189 dbSNP
rs201835353 3199 dbSNP
rs1183840688 3207 dbSNP
rs1266285543 3209 dbSNP
rs1480016993 3211 dbSNP
rs1199291746 3214 dbSNP
rs782675609 3241 dbSNP
rs1379370639 3249 dbSNP
rs1460346233 3251 dbSNP
rs1037506925 3260 dbSNP
rs949286350 3261 dbSNP
rs917750590 3273 dbSNP
rs1431896301 3275 dbSNP
rs2734644 3277 dbSNP
rs990629161 3280 dbSNP
rs1301570752 3286 dbSNP
rs937929295 3290 dbSNP
rs1345103828 3292 dbSNP
rs1406004972 3316 dbSNP
rs1303775339 3326 dbSNP
rs782168578 3327 dbSNP
rs925160667 3338 dbSNP
rs1227271879 3341 dbSNP
rs782465616 3362 dbSNP
rs782318112 3363 dbSNP
rs1342301897 3379 dbSNP
rs1206650340 3394 dbSNP
rs979120157 3410 dbSNP
rs966346168 3411 dbSNP
rs1020753370 3412 dbSNP
rs1191567194 3415 dbSNP
rs1269129514 3416 dbSNP
rs976227670 3416 dbSNP
rs1426684483 3420 dbSNP
rs781789547 3424 dbSNP
rs782758908 3429 dbSNP
rs1390679689 3432 dbSNP
rs1020207057 3433 dbSNP
rs201029961 3439 dbSNP
rs782081431 3439 dbSNP
rs1451468950 3473 dbSNP
rs1007037024 3474 dbSNP
rs56036177 3477 dbSNP
rs1425473295 3479 dbSNP
rs1027181239 3480 dbSNP
rs191660801 3486 dbSNP
rs1383202726 3487 dbSNP
rs782160189 3488 dbSNP
rs1296977131 3494 dbSNP
rs1367963293 3502 dbSNP
rs897160978 3503 dbSNP
rs782608289 3511 dbSNP
rs1358307696 3516 dbSNP
rs1221784604 3517 dbSNP
rs1267027427 3531 dbSNP
rs1484794909 3535 dbSNP
rs782009117 3538 dbSNP
rs376099523 3545 dbSNP
rs1466145929 3546 dbSNP
rs1181839446 3563 dbSNP
rs1384634977 3572 dbSNP
rs1424643023 3575 dbSNP
rs1167219471 3583 dbSNP
rs896544514 3589 dbSNP
rs1362253684 3592 dbSNP
rs1453568342 3600 dbSNP
rs868988599 3605 dbSNP
rs1055379276 3620 dbSNP
rs1391476335 3624 dbSNP
rs2734647 3638 dbSNP
rs1334152213 3645 dbSNP
rs1381356175 3654 dbSNP
rs267608359 3658 dbSNP
rs925212801 3659 dbSNP
rs267608366 3662 dbSNP
rs1238065611 3667 dbSNP
rs1268459198 3669 dbSNP
rs1331162273 3672 dbSNP
rs1201646107 3674 dbSNP
rs782349759 3694 dbSNP
rs782269056 3695 dbSNP
rs782636587 3696 dbSNP
rs1248769973 3697 dbSNP
rs1418657770 3700 dbSNP
rs1414583727 3701 dbSNP
rs1468735038 3703 dbSNP
rs1176390748 3711 dbSNP
rs187250057 3716 dbSNP
rs1304007666 3725 dbSNP
rs782546946 3726 dbSNP
rs781812487 3727 dbSNP
rs1408782939 3734 dbSNP
rs139849709 3737 dbSNP
rs1330998250 3739 dbSNP
rs782711082 3740 dbSNP
rs782103232 3746 dbSNP
rs1017327307 3753 dbSNP
rs1212345220 3754 dbSNP
rs1249632419 3756 dbSNP
rs1480442842 3760 dbSNP
rs1183121505 3762 dbSNP
rs1254212472 3765 dbSNP
rs1479691014 3766 dbSNP
rs1199135369 3772 dbSNP
rs986062482 3772 dbSNP
rs954193466 3781 dbSNP
rs782578381 3782 dbSNP
rs781801460 3784 dbSNP
rs1416596741 3795 dbSNP
rs782478392 3796 dbSNP
rs1352216742 3801 dbSNP
rs182188616 3807 dbSNP
rs1428504396 3826 dbSNP
rs1308309568 3842 dbSNP
rs782779206 3860 dbSNP
rs1402942078 3871 dbSNP
rs1273961536 3877 dbSNP
rs148230889 3878 dbSNP
rs868911073 3886 dbSNP
rs1293562206 3893 dbSNP
rs1307037269 3903 dbSNP
rs1205935246 3906 dbSNP
rs782040053 3914 dbSNP
rs1277112044 3916 dbSNP
rs782499861 3923 dbSNP
rs1222231683 3935 dbSNP
rs1247603541 3940 dbSNP
rs782406050 3948 dbSNP
rs896591034 3952 dbSNP
rs1055195614 3959 dbSNP
rs1168666651 3960 dbSNP
rs1448411401 3960 dbSNP
rs188764327 3963 dbSNP
rs903678643 3965 dbSNP
rs781918653 3969 dbSNP
rs782790163 3970 dbSNP
rs1322678993 3976 dbSNP
rs1350213090 3983 dbSNP
rs945280880 3985 dbSNP
rs1438310980 4005 dbSNP
rs1268397785 4011 dbSNP
rs913797736 4014 dbSNP
rs782356769 4017 dbSNP
rs1229320235 4018 dbSNP
rs1299838371 4020 dbSNP
rs782061000 4029 dbSNP
rs1227914213 4030 dbSNP
rs944376847 4031 dbSNP
rs781798478 4032 dbSNP
rs782765402 4034 dbSNP
rs1453736028 4041 dbSNP
rs985841142 4043 dbSNP
rs1242110936 4056 dbSNP
rs782084136 4058 dbSNP
rs35261581 4062 dbSNP
rs954246145 4073 dbSNP
rs920101316 4084 dbSNP
rs267608367 4088 dbSNP
rs1391429545 4092 dbSNP
rs1442430071 4093 dbSNP
rs1162326186 4101 dbSNP
rs1414048074 4102 dbSNP
rs1406938832 4114 dbSNP
rs1315960038 4123 dbSNP
rs1387826466 4126 dbSNP
rs1435660634 4130 dbSNP
rs974188410 4134 dbSNP
rs1322676273 4137 dbSNP
rs782651415 4152 dbSNP
rs1447353234 4154 dbSNP
rs1285065770 4164 dbSNP
rs782004927 4174 dbSNP
rs1222426747 4175 dbSNP
rs1267832326 4183 dbSNP
rs1330453180 4186 dbSNP
rs782369890 4187 dbSNP
rs1211083396 4197 dbSNP
rs1015832547 4198 dbSNP
rs1459628612 4201 dbSNP
rs1186211692 4208 dbSNP
rs782378604 4209 dbSNP
rs1473539047 4226 dbSNP
rs1156614565 4234 dbSNP
rs1410898620 4240 dbSNP
rs782168367 4256 dbSNP
rs960735140 4270 dbSNP
rs782803390 4276 dbSNP
rs1161341661 4281 dbSNP
rs1403797894 4283 dbSNP
rs1395592699 4293 dbSNP
rs1334837378 4294 dbSNP
rs1342498263 4309 dbSNP
rs183869736 4320 dbSNP
rs1288156549 4322 dbSNP
rs1351530605 4323 dbSNP
rs1230599860 4339 dbSNP
rs1002294784 4340 dbSNP
rs782311138 4343 dbSNP
rs150660702 4344 dbSNP
rs1472826853 4345 dbSNP
rs781948631 4347 dbSNP
rs1427116732 4348 dbSNP
rs1009376684 4349 dbSNP
rs1173256047 4350 dbSNP
rs1404394333 4355 dbSNP
rs1408247856 4359 dbSNP
rs1307713176 4367 dbSNP
rs892408844 4368 dbSNP
rs1412143270 4375 dbSNP
rs782390297 4379 dbSNP
rs1281705639 4390 dbSNP
rs944410250 4390 dbSNP
rs191997825 4397 dbSNP
rs1277084850 4412 dbSNP
rs1346564774 4419 dbSNP
rs1202387906 4432 dbSNP
rs782398479 4434 dbSNP
rs1050016129 4444 dbSNP
rs1483140498 4445 dbSNP
rs1207050849 4449 dbSNP
rs1264938849 4455 dbSNP
rs1432555193 4460 dbSNP
rs782679083 4462 dbSNP
rs930413915 4474 dbSNP
rs920315633 4482 dbSNP
rs974239413 4488 dbSNP
rs781854916 4493 dbSNP
rs908824363 4494 dbSNP
rs1431801494 4508 dbSNP
rs1301708476 4511 dbSNP
rs1390513851 4513 dbSNP
rs1387683821 4527 dbSNP
rs1326177295 4529 dbSNP
rs992414239 4531 dbSNP
rs1225550342 4535 dbSNP
rs782221315 4550 dbSNP
rs782528807 4552 dbSNP
rs782816809 4556 dbSNP
rs3027920 4576 dbSNP
rs1263285888 4595 dbSNP
rs1488064536 4603 dbSNP
rs782576903 4614 dbSNP
rs1269458837 4621 dbSNP
rs1463440831 4623 dbSNP
rs1188025850 4625 dbSNP
rs782486545 4630 dbSNP
rs2734643 4631 dbSNP
rs782696996 4659 dbSNP
rs1163005920 4667 dbSNP
rs1368098632 4672 dbSNP
rs1022376299 4687 dbSNP
rs1165296150 4701 dbSNP
rs1383453570 4706 dbSNP
rs782095167 4712 dbSNP
rs1434947262 4715 dbSNP
rs782774551 4716 dbSNP
rs1009840556 4738 dbSNP
rs782517124 4741 dbSNP
rs892297991 4766 dbSNP
rs1436619732 4767 dbSNP
rs1310212105 4769 dbSNP
rs1320740160 4804 dbSNP
rs1245255306 4807 dbSNP
rs1266934237 4811 dbSNP
rs781953384 4816 dbSNP
rs1019314744 4828 dbSNP
rs1207991329 4832 dbSNP
rs186841969 4837 dbSNP
rs888992955 4857 dbSNP
rs782379180 4862 dbSNP
rs181614505 4863 dbSNP
rs1180183474 4882 dbSNP
rs1255738643 4885 dbSNP
rs1424556189 4888 dbSNP
rs1167376055 4898 dbSNP
rs782068377 4907 dbSNP
rs781971821 4910 dbSNP
rs375836496 4915 dbSNP
rs1457015940 4922 dbSNP
rs1036066085 4928 dbSNP
rs1391455352 4931 dbSNP
rs940216446 4942 dbSNP
rs908715176 4943 dbSNP
rs1378012345 4949 dbSNP
rs782125697 4973 dbSNP
rs781982384 4974 dbSNP
rs1396205098 4979 dbSNP
rs1314654128 4985 dbSNP
rs1348448331 4989 dbSNP
rs1227536526 4990 dbSNP
rs992693938 4993 dbSNP
rs1331042203 4996 dbSNP
rs1208126798 4998 dbSNP
rs939640221 5023 dbSNP
rs1483719405 5034 dbSNP
rs1183857004 5042 dbSNP
rs782410926 5051 dbSNP
rs782107290 5059 dbSNP
rs980799031 5062 dbSNP
rs1183348795 5063 dbSNP
rs1414846667 5067 dbSNP
rs1431888963 5071 dbSNP
rs1173376282 5072 dbSNP
rs1358036744 5076 dbSNP
rs1466080317 5080 dbSNP
rs782031209 5084 dbSNP
rs1368308844 5092 dbSNP
rs1022428070 5102 dbSNP
rs1288681368 5103 dbSNP
rs1352279382 5110 dbSNP
rs1217364411 5131 dbSNP
rs1300465791 5145 dbSNP
rs1212320983 5150 dbSNP
rs988236262 5165 dbSNP
rs782401259 5166 dbSNP
rs1206332061 5168 dbSNP
rs200602554 5168 dbSNP
rs781929357 5179 dbSNP
rs956971836 5182 dbSNP
rs1487811397 5183 dbSNP
rs1191170487 5195 dbSNP
rs190031183 5201 dbSNP
rs1433331015 5204 dbSNP
rs1174900928 5206 dbSNP
rs782237207 5208 dbSNP
rs1387948078 5219 dbSNP
rs1428650073 5225 dbSNP
rs1308441028 5231 dbSNP
rs1356103472 5237 dbSNP
rs1433998665 5239 dbSNP
rs1018782993 5240 dbSNP
rs1368210125 5246 dbSNP
rs1236595400 5247 dbSNP
rs185617517 5248 dbSNP
rs1341752780 5255 dbSNP
rs1009117914 5264 dbSNP
rs1229364390 5273 dbSNP
rs889060591 5276 dbSNP
rs1450296374 5281 dbSNP
rs1028847019 5282 dbSNP
rs1247802727 5291 dbSNP
rs1489719473 5303 dbSNP
rs1194976154 5331 dbSNP
rs1245623958 5347 dbSNP
rs267608346 5348 dbSNP
rs1168891425 5350 dbSNP
rs1421187457 5357 dbSNP
rs1403463803 5358 dbSNP
rs1163727988 5360 dbSNP
rs898826033 5364 dbSNP
rs1442952597 5373 dbSNP
rs147495408 5391 dbSNP
rs940452823 5399 dbSNP
rs1364600749 5409 dbSNP
rs1435883802 5419 dbSNP
rs1272209224 5430 dbSNP
rs1354423158 5436 dbSNP
rs782694506 5438 dbSNP
rs1228118232 5440 dbSNP
rs895530097 5442 dbSNP
rs782188234 5443 dbSNP
rs1337621770 5444 dbSNP
rs1056649859 5448 dbSNP
rs781970286 5449 dbSNP
rs1464094257 5451 dbSNP
rs1188635891 5458 dbSNP
rs782529527 5459 dbSNP
rs1243493300 5464 dbSNP
rs1471573810 5475 dbSNP
rs180798692 5476 dbSNP
rs202139104 5488 dbSNP
rs782562533 5488 dbSNP
rs981019031 5492 dbSNP
rs1156922156 5502 dbSNP
rs1387805666 5507 dbSNP
rs1457837236 5528 dbSNP
rs1320299727 5539 dbSNP
rs1338945283 5545 dbSNP
rs1447519542 5548 dbSNP
rs946734777 5578 dbSNP
rs1284969304 5592 dbSNP
rs1357810118 5605 dbSNP
rs782744320 5615 dbSNP
rs1268122423 5623 dbSNP
rs1330345573 5623 dbSNP
rs200861195 5623 dbSNP
rs1285689410 5627 dbSNP
rs1209038297 5632 dbSNP
rs1440368431 5632 dbSNP
rs781867993 5632 dbSNP
rs782474160 5632 dbSNP
rs1476100346 5633 dbSNP
rs1179748029 5641 dbSNP
rs61495057 5641 dbSNP
rs1160397587 5642 dbSNP
rs1400208417 5642 dbSNP
rs1472847271 5642 dbSNP
rs988508761 5642 dbSNP
rs782351439 5647 dbSNP
rs911950606 5648 dbSNP
rs1377498665 5683 dbSNP
rs987345281 5685 dbSNP
rs782265259 5686 dbSNP
rs782644078 5689 dbSNP
rs1241757281 5693 dbSNP
rs994718915 5695 dbSNP
rs963223024 5699 dbSNP
rs1273554035 5700 dbSNP
rs1014608330 5707 dbSNP
rs1342329184 5713 dbSNP
rs1218119609 5719 dbSNP
rs1280689167 5728 dbSNP
rs1486413188 5736 dbSNP
rs1004928303 5741 dbSNP
rs895597954 5754 dbSNP
rs1438151844 5760 dbSNP
rs1183962423 5768 dbSNP
rs1375844489 5771 dbSNP
rs1057267380 5776 dbSNP
rs1173165976 5777 dbSNP
rs1397133041 5783 dbSNP
rs1428011048 5796 dbSNP
rs1307844681 5800 dbSNP
rs1371604695 5803 dbSNP
rs1393483262 5816 dbSNP
rs1003754738 5817 dbSNP
rs267608368 5839 dbSNP
rs184353399 5850 dbSNP
rs1331033093 5865 dbSNP
rs370642953 5870 dbSNP
rs1303432454 5873 dbSNP
rs1349635408 5883 dbSNP
rs1225772413 5884 dbSNP
rs79615013 5901 dbSNP
rs1273435169 5907 dbSNP
rs1339898064 5914 dbSNP
rs1197330894 5926 dbSNP
rs1265188584 5942 dbSNP
rs1450905500 5948 dbSNP
rs182221808 5963 dbSNP
rs905354165 5964 dbSNP
rs782720301 5965 dbSNP
rs1168253493 5974 dbSNP
rs1391006631 5979 dbSNP
rs1463914337 5982 dbSNP
rs781796024 5984 dbSNP
rs1161760534 5988 dbSNP
rs1390668961 5990 dbSNP
rs1387813054 6004 dbSNP
rs782593211 6012 dbSNP
rs1328474098 6013 dbSNP
rs1432244423 6016 dbSNP
rs1296501104 6017 dbSNP
rs1326582883 6017 dbSNP
rs1229358171 6018 dbSNP
rs1263406064 6027 dbSNP
rs1355594920 6035 dbSNP
rs946954514 6040 dbSNP
rs377393681 6041 dbSNP
rs1052474453 6043 dbSNP
rs935310357 6044 dbSNP
rs1430468822 6051 dbSNP
rs190444336 6053 dbSNP
rs987951481 6059 dbSNP
rs781972317 6060 dbSNP
rs782588174 6083 dbSNP
rs1368291182 6087 dbSNP
rs1462270569 6088 dbSNP
rs1167806114 6094 dbSNP
rs953427664 6096 dbSNP
rs1387084396 6102 dbSNP
rs1455190719 6111 dbSNP
rs921770108 6112 dbSNP
rs1362252590 6121 dbSNP
rs1383518449 6122 dbSNP
rs782351436 6125 dbSNP
rs963275412 6138 dbSNP
rs1339709006 6148 dbSNP
rs1015245441 6150 dbSNP
rs1004578493 6161 dbSNP
rs1233665302 6169 dbSNP
rs1295127949 6175 dbSNP
rs1326909733 6182 dbSNP
rs1208206169 6188 dbSNP
rs782139649 6194 dbSNP
rs1261340570 6203 dbSNP
rs1486869108 6235 dbSNP
rs959973382 6237 dbSNP
rs1255665322 6240 dbSNP
rs1475743269 6244 dbSNP
rs1190508233 6251 dbSNP
rs781989800 6271 dbSNP
rs1472538456 6279 dbSNP
rs1157782957 6292 dbSNP
rs1345302340 6294 dbSNP
rs1454846739 6305 dbSNP
rs1300726932 6328 dbSNP
rs1035481595 6344 dbSNP
rs1314469937 6347 dbSNP
rs142948743 6347 dbSNP
rs1348606296 6351 dbSNP
rs1227745134 6352 dbSNP
rs905573405 6366 dbSNP
rs1318830749 6371 dbSNP
rs1231078109 6378 dbSNP
rs782277958 6389 dbSNP
rs1255698371 6405 dbSNP
rs1486114360 6407 dbSNP
rs782576656 6417 dbSNP
rs1250026633 6422 dbSNP
rs1482910418 6423 dbSNP
rs1011051545 6424 dbSNP
rs1410721837 6428 dbSNP
rs1173334620 6432 dbSNP
rs894080379 6433 dbSNP
rs1434922053 6434 dbSNP
rs1175088593 6440 dbSNP
rs1368501224 6443 dbSNP
rs1441141345 6444 dbSNP
rs1298686721 6448 dbSNP
rs1053113685 6456 dbSNP
rs1375441102 6462 dbSNP
rs1385221456 6472 dbSNP
rs1300653436 6477 dbSNP
rs139053716 6480 dbSNP
rs1236808291 6482 dbSNP
rs1272691473 6492 dbSNP
rs911886899 6493 dbSNP
rs1205580331 6494 dbSNP
rs782436388 6496 dbSNP
rs932085251 6497 dbSNP
rs921989927 6522 dbSNP
rs1188997565 6528 dbSNP
rs1251795001 6529 dbSNP
rs1454298079 6532 dbSNP
rs1175145389 6535 dbSNP
rs1387868554 6540 dbSNP
rs1409227042 6542 dbSNP
rs1170866538 6546 dbSNP
rs973241219 6548 dbSNP
rs1456301377 6557 dbSNP
rs1325093606 6565 dbSNP
rs781838982 6566 dbSNP
rs1295681716 6567 dbSNP
rs1361520504 6574 dbSNP
rs907827638 6574 dbSNP
rs1275523085 6575 dbSNP
rs1320478881 6578 dbSNP
rs1221512363 6580 dbSNP
rs1274294938 6581 dbSNP
rs983768397 6584 dbSNP
rs1468545190 6594 dbSNP
rs1194954434 6607 dbSNP
rs1245877332 6609 dbSNP
rs782214040 6613 dbSNP
rs1421429367 6615 dbSNP
rs1421781401 6618 dbSNP
rs1164144215 6619 dbSNP
rs782649542 6625 dbSNP
rs185164750 6629 dbSNP
rs111782334 6636 dbSNP
rs979742102 6637 dbSNP
rs1431710772 6645 dbSNP
rs781900743 6645 dbSNP
rs1377456541 6655 dbSNP
rs1232989712 6656 dbSNP
rs1294514122 6660 dbSNP
rs1337570924 6661 dbSNP
rs781845041 6665 dbSNP
rs1011117319 6672 dbSNP
rs1445879019 6674 dbSNP
rs1216094548 6675 dbSNP
rs782816610 6676 dbSNP
rs782669196 6681 dbSNP
rs1471689930 6689 dbSNP
rs1186950215 6690 dbSNP
rs1418556460 6691 dbSNP
rs893958360 6710 dbSNP
rs1031135124 6711 dbSNP
rs1000186351 6712 dbSNP
rs1407386666 6714 dbSNP
rs890687835 6716 dbSNP
rs1320544236 6720 dbSNP
rs1357644245 6721 dbSNP
rs1414617378 6733 dbSNP
rs1313848450 6761 dbSNP
rs1357961233 6773 dbSNP
rs1227125268 6776 dbSNP
rs1279437886 6786 dbSNP
rs1349345789 6795 dbSNP
rs1223789768 6796 dbSNP
rs782442366 6806 dbSNP
rs192271039 6807 dbSNP
rs931969128 6808 dbSNP
rs900620225 6831 dbSNP
rs1486504758 6837 dbSNP
rs782731493 6841 dbSNP
rs1232169649 6844 dbSNP
rs1470594165 6878 dbSNP
rs1160360869 6905 dbSNP
rs782138168 6907 dbSNP
rs782092044 6908 dbSNP
rs781882696 6920 dbSNP
rs3027919 6922 dbSNP
rs1423388248 6930 dbSNP
rs1174457276 6933 dbSNP
rs1377676508 6937 dbSNP
rs1408328201 6942 dbSNP
rs1328775207 6950 dbSNP
rs941909661 6952 dbSNP
rs907710953 6953 dbSNP
rs1442376231 6967 dbSNP
rs983266562 7005 dbSNP
rs938616840 7010 dbSNP
rs1280760660 7017 dbSNP
rs1345344745 7019 dbSNP
rs1233144112 7020 dbSNP
rs1280534251 7027 dbSNP
rs1349794504 7030 dbSNP
rs1193856321 7051 dbSNP
rs1249806020 7070 dbSNP
rs1438303755 7084 dbSNP
rs1184129606 7092 dbSNP
rs1251252940 7097 dbSNP
rs1453820195 7099 dbSNP
rs1194520732 7102 dbSNP
rs1397048119 7120 dbSNP
rs1428297782 7153 dbSNP
rs1167685457 7163 dbSNP
rs1397893599 7163 dbSNP
rs1412098194 7170 dbSNP
rs1322097819 7180 dbSNP
rs1368172789 7183 dbSNP
rs1439441637 7186 dbSNP
rs781857976 7194 dbSNP
rs781837763 7205 dbSNP
rs1225034349 7212 dbSNP
rs1250522429 7213 dbSNP
rs781927673 7218 dbSNP
rs782751466 7220 dbSNP
rs1197509198 7234 dbSNP
rs782752939 7258 dbSNP
rs1255193123 7259 dbSNP
rs979794290 7269 dbSNP
rs969708422 7283 dbSNP
rs1021417768 7290 dbSNP
rs1192965388 7294 dbSNP
rs1374021423 7295 dbSNP
rs782092305 7297 dbSNP
rs1161988019 7310 dbSNP
rs1394393963 7332 dbSNP
rs955776868 7336 dbSNP
rs1325973252 7339 dbSNP
rs1396280191 7342 dbSNP
rs1380201464 7350 dbSNP
rs1294350151 7358 dbSNP
rs1326818447 7359 dbSNP
rs782769524 7366 dbSNP
rs1334054456 7370 dbSNP
rs999669517 7378 dbSNP
rs41314155 7380 dbSNP
rs1484909448 7381 dbSNP
rs1204795127 7382 dbSNP
rs1262617524 7387 dbSNP
rs1449097619 7388 dbSNP
rs890729675 7392 dbSNP
rs1417840293 7403 dbSNP
rs1475804286 7411 dbSNP
rs782626168 7433 dbSNP
rs187125270 7434 dbSNP
rs1369721712 7456 dbSNP
rs12556178 7458 dbSNP
rs996174337 7461 dbSNP
rs782370951 7466 dbSNP
rs1385219397 7467 dbSNP
rs1037634937 7468 dbSNP
rs1354785061 7479 dbSNP
rs1233852492 7488 dbSNP
rs782567209 7504 dbSNP
rs1294995511 7516 dbSNP
rs3027918 7517 dbSNP
rs886502898 7526 dbSNP
rs1261596793 7530 dbSNP
rs1048036428 7532 dbSNP
rs1209234848 7544 dbSNP
rs1257301161 7548 dbSNP
rs938516684 7553 dbSNP
rs782289994 7556 dbSNP
rs782326642 7579 dbSNP
rs1486175750 7586 dbSNP
rs1190714518 7592 dbSNP
rs1248954348 7602 dbSNP
rs1416863357 7604 dbSNP
rs928574946 7607 dbSNP
rs1364064671 7608 dbSNP
rs1421107248 7609 dbSNP
rs1171317409 7610 dbSNP
rs1374646266 7612 dbSNP
rs1415104178 7629 dbSNP
rs1304514978 7636 dbSNP
rs144586717 7642 dbSNP
rs948584730 7647 dbSNP
rs914243690 7662 dbSNP
rs1307760443 7671 dbSNP
rs1232403887 7679 dbSNP
rs1318773490 7679 dbSNP
rs781953327 7681 dbSNP
rs782385266 7690 dbSNP
rs1279811809 7691 dbSNP
rs782245817 7703 dbSNP
rs1213463797 7704 dbSNP
rs955993927 7705 dbSNP
rs1176163000 7708 dbSNP
rs1250652911 7715 dbSNP
rs373373478 7729 dbSNP
rs924370043 7730 dbSNP
rs782700849 7731 dbSNP
rs978687248 7731 dbSNP
rs782328575 7739 dbSNP
rs1352733063 7745 dbSNP
rs3027917 7748 dbSNP
rs1298634181 7759 dbSNP
rs1379228071 7777 dbSNP
rs1438721471 7779 dbSNP
rs996395486 7790 dbSNP
rs1371986708 7795 dbSNP
rs1237019993 7813 dbSNP
rs782173076 7814 dbSNP
rs1293841985 7826 dbSNP
rs1307239802 7828 dbSNP
rs1253534406 7832 dbSNP
rs1016238155 7833 dbSNP
rs1006193597 7837 dbSNP
rs1458714748 7840 dbSNP
rs3027916 7848 dbSNP
rs1252051347 7855 dbSNP
rs3027915 7856 dbSNP
rs1192532574 7857 dbSNP
rs1417161184 7861 dbSNP
rs1003153044 7866 dbSNP
rs1171067184 7873 dbSNP
rs1402366774 7881 dbSNP
rs907042211 7897 dbSNP
rs1325278438 7898 dbSNP
rs1395542298 7904 dbSNP
rs782472553 7906 dbSNP
rs1287282661 7918 dbSNP
rs782552262 7926 dbSNP
rs1215452017 7930 dbSNP
rs1280720663 7937 dbSNP
rs41299118 7950 dbSNP
rs1054557686 7970 dbSNP
rs1272026346 7978 dbSNP
rs1468502833 7979 dbSNP
rs1223338895 7986 dbSNP
rs934324773 7987 dbSNP
rs924397288 7988 dbSNP
rs986561117 7993 dbSNP
rs1474166297 7994 dbSNP
rs1164077747 7995 dbSNP
rs782627592 7998 dbSNP
rs923445747 8003 dbSNP
rs1407096774 8007 dbSNP
rs1316498445 8008 dbSNP
rs1344822390 8009 dbSNP
rs974858558 8019 dbSNP
rs1300409441 8020 dbSNP
rs1353913388 8021 dbSNP
rs370233900 8023 dbSNP
rs782537571 8028 dbSNP
rs1294388644 8032 dbSNP
rs374914351 8034 dbSNP
rs1356447502 8035 dbSNP
rs1229534451 8048 dbSNP
rs1281777413 8051 dbSNP
rs1315943435 8058 dbSNP
rs964944713 8061 dbSNP
rs1216287201 8062 dbSNP
rs782487988 8063 dbSNP
rs781820906 8103 dbSNP
rs1187153071 8104 dbSNP
rs1258057458 8106 dbSNP
rs1473852618 8111 dbSNP
rs1156876303 8113 dbSNP
rs781862960 8120 dbSNP
rs782666803 8124 dbSNP
rs3027914 8135 dbSNP
rs3027913 8143 dbSNP
rs950738232 8148 dbSNP
rs3027912 8160 dbSNP
rs372966365 8179 dbSNP
rs1434422865 8197 dbSNP
rs782701609 8210 dbSNP
rs1342770346 8215 dbSNP
rs7066787 8217 dbSNP
rs782800197 8218 dbSNP
rs1371931158 8219 dbSNP
rs1044261070 8220 dbSNP