miRTarBase - #MIRT003098 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FUNDC2   
Synonyms DC44, HCBP6, HCC3, PD03104
Description FUN14 domain containing 2
Transcript NM_023934   
Expression
Putative miRNA Targets on FUNDC2
3'UTR of FUNDC2
(miRNA target sites are highlighted)
>FUNDC2|NM_023934|3'UTR
   1 GGAAGATGACCTCATGTTCATTGTTCCTGGTTTTTTCCAGCCAGCAGCCTCTACACTCCATCATAGGACATCGAGTCCCT
  81 CCTCCTCTTCTCCCATGCCTTCTTCCCTGCCATGGCAAATCTGAGTGGCTTCTCTAAGCATCTGCTGGTACAAGTCAATG
 161 TGGCACCATGAGCTTCATGGTGGCAGAAGAGACAATAGTCCTTAGCTCTCCTCCCAGTACACCCCCTACTTGGCCAGTCT
 241 GTAGGCCAACAAGAAGGTTCCTTTACCCCCATGCAAGACACTTATGAGAACACATTACAAGATGGCTGACCGTGGAGGAT
 321 GAGTGGATCCTGAAAGGTTGTCCCAAACTGTTGATTTGGAAAAGAAATAAGCACATAGATAACCTTATTGTGTGCTGCAT
 401 GGAAAGGAACTGAATACATTTGCCTTTAAGCATGAAAGATTTTGGTATCTTGGTGTCTACTTTCTTTTTTAGTTGGTTTT
 481 ACATTACAGAAAGCTATTTAAATGTGTTATAATTATGCCGACAAAATTGGCAGCATAATTACTGTAATTGAAAAATCTGA
 561 TATTGTCCAGGAATGCTTTCTACCGTACAGGATAATGTATCTCATGGCTGTTTCCAAAGGGTTTATTTATTGTAAAACAA
 641 GTGATTTAGGTGGGAAAGGGAAGATTTTGGATTTTTATTTTGTAGAAAAGGTTTTAAGCTTTGAAATGTGAATGAAATAT
 721 CCTTATCAAAACATTAGGGGTGGCCATAACTCCTCTGTGCCACTTCTACTATTTTTTTTTTTAATCTAGTTAGTATGAAA
 801 TACAACATTTAAACCGGAATTTTAAAGAAGTAGCTTTCCAGGGATTCAGAATTAAGAAAGATAGTGATAGGACATGAGAA
 881 ATAAATTTCCATCAAGTGTAATCTACCGTCTCATGATGACCACAACCCTGAGAATTATTCTTTAAAAGCTTACACACACA
 961 CACACACACGGGCACACACGCACACACAGAATCTTACCACATTTTGCTGTAGTGGCATGTTACCATGTCTACAGTCCCTA
1041 CTAGAATATCAGTCAGCTTTCAGAGGGCAAGACTTCTGTCTTCACCATTATACTCACAGGGCCTAGCACTTAATAGGTGC
1121 TGAGTATTTGAATAATGACTTTATAGAAAGAAAACTCACTATTAAAGGTTAGTTTTACTCAGAATTGTTAATCTTGGAGA
1201 TGATCTCTTGTGAAATATGAGTGTGTTTCTAAGGCCATACATTTAAAAATGTTTGCATTTTAACCCGTCTTGAGAATGAT
1281 GTATTGAATTTGAAAATCAAAACTACCAGTGGATGTGTGGAACTTTACAGAAACCACCTATTTGCGTTTTTCTCCTTACA
1361 TTTAAGGAAACATAAGCCATTTTGCTTGCAATATGTATGAATCATCTCAAAACCATAATGGTATGAGCCTCTTTGCTGCA
1441 TATTTTGCTATAAGAACTTATTTTTTTTCACTTTTTATTATGGACGCTTTCAGGAATATATAAAAGTAGAGAATATAGTA
1521 CAATAATCCCCCTGTGTATCTATCACTCACTCACAACAATCATCAAATTATAGCTCTGCTGGTTTTTACCAGTTATTGTG
1601 AAACAAATATCAAAATGTCATTTTATCATATTTCAGTATGTATCTCTAAAAGGTAAGAATTATTTCTAAAAATCATAAAT
1681 ACCTCATCATATCAGACATTAACAGTAATTACATAATATCCAAAATCTGATCAGTGTTCAAAATTTCCTCAAGTGTTTTA
1761 TATTTAGTTTGTTTGAATCAAAATTCATGCAAGGTTCACATCGTATTTGCATGATTTGGATAAGTCTCTTAACCTTATAG
1841 ATCCTCCTCTATTTTTTTTTTTTTGCTTGCTATATATTTATATCTCTATATATATTGATATAGACATATGTAGTGACACT
1921 GAGTCATCTGTTTCCTGCTTCCCCACACTCTGCCTCTCCTGACATCTGGGTCTCTGGGTTATGCCATATATGGTGATAGT
2001 GGCTGCAGCCACTTTACCTGTGTGACTTACCCACAGCAATGGGATGGTAACAGCAAAGCTAACCAAAGTGCTCTGTGCCC
2081 CTTTGGGTTGCATGTGGGGAGACTGGCCACCCAATGCCTCTCCAGTGGGGTAGGGGTTGTCTTTTGGTGCATCTGTTTTT
2161 CCTGTGATTATTGGTGAGGGCAGCAAAGATTAGCAGGTGGTTGTAAACTACCTTGAGTAGGTTGTAATAAATAGTCTGGC
2241 CTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAG-UGUGAGGu 5'
              || ||   || ||||||| 
Target 5' cagcCAGCAGCCTCTACACTCCa 3'
38 - 60 150.00 -17.20
2
miRNA  3' guuuGUGGUAACAG-UGUGAGGu 5'
              :|||| |||| ||| ||| 
Target 5' atgtTACCA-TGTCTACAGTCCc 3'
1017 - 1038 133.00 -15.80
3
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       |||||||: 
Target 5' tttcctgcttcccCACACTCTg 3'
1931 - 1952 129.00 -9.60
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782604903 12 dbSNP
rs782178883 17 dbSNP
rs782008229 18 dbSNP
rs782289804 22 dbSNP
rs782367141 25 dbSNP
rs781997509 31 dbSNP
rs782081396 37 dbSNP
rs782732907 37 dbSNP
rs782363256 39 dbSNP
rs957272518 40 dbSNP
rs781924256 42 dbSNP
rs782064500 45 dbSNP
rs782808925 48 dbSNP
rs1449760370 56 dbSNP
rs991834918 63 dbSNP
rs915553865 73 dbSNP
rs949731125 85 dbSNP
rs1045502291 86 dbSNP
rs919041332 91 dbSNP
rs1290433668 96 dbSNP
rs1211568977 104 dbSNP
rs192658327 114 dbSNP
rs1313078207 135 dbSNP
rs1366255200 152 dbSNP
rs782120934 153 dbSNP
rs929054424 159 dbSNP
rs782814591 161 dbSNP
rs1326226234 192 dbSNP
rs1324710178 198 dbSNP
rs1407642029 222 dbSNP
rs1387936529 223 dbSNP
rs1049188247 224 dbSNP
rs782137184 225 dbSNP
rs1429865834 227 dbSNP
rs1048795 235 dbSNP
rs1007780602 236 dbSNP
rs1039290129 247 dbSNP
rs1186293089 251 dbSNP
rs782024044 257 dbSNP
rs901833431 264 dbSNP
rs1474920612 269 dbSNP
rs1247134066 274 dbSNP
rs782798751 281 dbSNP
rs997512909 286 dbSNP
rs1020988316 294 dbSNP
rs782071520 295 dbSNP
rs902563813 298 dbSNP
rs1001361875 299 dbSNP
rs185529445 312 dbSNP
rs1339136672 333 dbSNP
rs782090496 348 dbSNP
rs1329900459 368 dbSNP
rs1303104228 383 dbSNP
rs991411197 384 dbSNP
rs1409841041 392 dbSNP
rs1371873612 398 dbSNP
rs1166324017 418 dbSNP
rs1022925747 421 dbSNP
rs1409066016 424 dbSNP
rs1425574823 431 dbSNP
rs1174143041 432 dbSNP
rs782720062 439 dbSNP
rs189192040 445 dbSNP
rs1268040849 450 dbSNP
rs1182832437 454 dbSNP
rs981069423 456 dbSNP
rs781816032 460 dbSNP
rs1202679490 462 dbSNP
rs1437513742 471 dbSNP
rs782523293 478 dbSNP
rs1221244984 480 dbSNP
rs1321871417 488 dbSNP
rs782756518 496 dbSNP
rs929046735 505 dbSNP
rs1351783035 519 dbSNP
rs781900427 520 dbSNP
rs1440982669 521 dbSNP
rs1359334400 527 dbSNP
rs1335809190 534 dbSNP
rs1412489238 550 dbSNP
rs1428347009 558 dbSNP
rs909369292 566 dbSNP
rs1473566583 568 dbSNP
rs781801337 574 dbSNP
rs943556594 581 dbSNP
rs1175597305 583 dbSNP
rs1480367286 584 dbSNP
rs1238209527 585 dbSNP
rs143802254 586 dbSNP
rs180769030 598 dbSNP
rs1331887537 599 dbSNP
rs1305528146 602 dbSNP
rs933583357 638 dbSNP
rs1379286393 652 dbSNP
rs1042331900 655 dbSNP
rs1450097178 659 dbSNP
rs1405067908 660 dbSNP
rs782468037 676 dbSNP
rs1458721854 691 dbSNP
rs1000930558 693 dbSNP
rs1158307900 698 dbSNP
rs186406829 706 dbSNP
rs1418510835 709 dbSNP
rs782643465 714 dbSNP
rs782212051 716 dbSNP
rs1443059519 719 dbSNP
rs782480314 723 dbSNP
rs1022809820 732 dbSNP
rs1259432588 737 dbSNP
rs1466544443 737 dbSNP
rs1215715620 740 dbSNP
rs1321790979 747 dbSNP
rs1291478922 748 dbSNP
rs971262282 753 dbSNP
rs981372840 758 dbSNP
rs1297921051 762 dbSNP
rs1359610080 772 dbSNP
rs1436948438 772 dbSNP
rs368875957 772 dbSNP
rs1288212583 783 dbSNP
rs782357164 787 dbSNP
rs1350518078 788 dbSNP
rs1165591154 795 dbSNP
rs1422852770 800 dbSNP
rs782567142 800 dbSNP
rs782196009 808 dbSNP
rs370293773 810 dbSNP
rs188820523 816 dbSNP
rs782028948 817 dbSNP
rs984538247 838 dbSNP
rs1489122492 844 dbSNP
rs111452556 850 dbSNP
rs1219572368 860 dbSNP
rs1358136117 861 dbSNP
rs943542894 869 dbSNP
rs782611227 875 dbSNP
rs1230247397 876 dbSNP
rs1305537109 879 dbSNP
rs1294644911 892 dbSNP
rs1387244569 894 dbSNP
rs1369588467 901 dbSNP
rs923445511 901 dbSNP
rs933552722 908 dbSNP
rs1042634223 909 dbSNP
rs1365045212 911 dbSNP
rs1169466052 916 dbSNP
rs902501843 924 dbSNP
rs1463776097 944 dbSNP
rs936693810 950 dbSNP
rs1432020279 952 dbSNP
rs372003545 952 dbSNP
rs781879747 952 dbSNP
rs782105089 952 dbSNP
rs782188025 952 dbSNP
rs1197908206 954 dbSNP
rs1251980331 957 dbSNP
rs1490042266 957 dbSNP
rs1206825133 960 dbSNP
rs1479476418 961 dbSNP
rs1250442357 962 dbSNP
rs1053864787 963 dbSNP
rs895185214 970 dbSNP
rs1281232685 972 dbSNP
rs1222905609 973 dbSNP
rs782259454 978 dbSNP
rs1344953380 979 dbSNP
rs1012338466 980 dbSNP
rs1394556007 981 dbSNP
rs782346884 981 dbSNP
rs1297843233 983 dbSNP
rs1466820227 991 dbSNP
rs1431987371 996 dbSNP
rs1044226799 1010 dbSNP
rs1480423546 1020 dbSNP
rs1412020272 1023 dbSNP
rs1183293873 1026 dbSNP
rs181191437 1030 dbSNP
rs1249307811 1037 dbSNP
rs907047130 1038 dbSNP
rs1484112099 1039 dbSNP
rs1202936313 1042 dbSNP
rs1261090229 1042 dbSNP
rs1329823459 1063 dbSNP
rs1290173570 1082 dbSNP
rs1241215456 1087 dbSNP
rs1334072030 1094 dbSNP
rs1306478900 1099 dbSNP
rs1002777475 1104 dbSNP
rs1408730647 1109 dbSNP
rs1335188313 1110 dbSNP
rs186284821 1116 dbSNP
rs782377855 1122 dbSNP
rs1160810527 1123 dbSNP
rs1450910483 1125 dbSNP
rs1362784712 1132 dbSNP
rs1006333261 1133 dbSNP
rs1187803897 1155 dbSNP
rs1446136168 1158 dbSNP
rs782689356 1160 dbSNP
rs964391343 1161 dbSNP
rs1182709210 1167 dbSNP
rs1465202492 1174 dbSNP
rs1286193157 1184 dbSNP
rs1203320880 1185 dbSNP
rs1348612565 1194 dbSNP
rs974484553 1200 dbSNP
rs923414472 1206 dbSNP
rs1245755726 1218 dbSNP
rs1385211010 1221 dbSNP
rs1313212153 1223 dbSNP
rs1452294289 1226 dbSNP
rs1366381303 1230 dbSNP
rs954906503 1233 dbSNP
rs978297429 1238 dbSNP
rs1399529719 1241 dbSNP
rs1383592145 1250 dbSNP
rs1163380242 1251 dbSNP
rs1426045567 1257 dbSNP
rs1382954714 1258 dbSNP
rs1162552482 1265 dbSNP
rs924229725 1267 dbSNP
rs1243701383 1268 dbSNP
rs5945283 1272 dbSNP
rs1190907536 1279 dbSNP
rs1268007796 1282 dbSNP
rs1223252084 1289 dbSNP
rs1361692951 1294 dbSNP
rs1289772880 1299 dbSNP
rs1245602017 1305 dbSNP
rs936945226 1307 dbSNP
rs1272341459 1313 dbSNP
rs1429205590 1320 dbSNP
rs190608955 1323 dbSNP
rs1324808955 1329 dbSNP
rs1406185573 1332 dbSNP
rs1363176068 1333 dbSNP
rs1054155716 1336 dbSNP
rs146616394 1339 dbSNP
rs1421347789 1340 dbSNP
rs5945284 1344 dbSNP
rs183877451 1346 dbSNP
rs1378072005 1347 dbSNP
rs1474972939 1347 dbSNP
rs5945285 1352 dbSNP
rs187254019 1355 dbSNP
rs190834311 1356 dbSNP
rs1490859091 1359 dbSNP
rs1266933659 1361 dbSNP
rs1221999110 1365 dbSNP
rs782462938 1370 dbSNP
rs1275424418 1371 dbSNP
rs1002746181 1374 dbSNP
rs1213131001 1375 dbSNP
rs1047632230 1376 dbSNP
rs35276408 1377 dbSNP
rs1339155461 1378 dbSNP
rs1284413477 1385 dbSNP
rs886322094 1391 dbSNP
rs782074619 1400 dbSNP
rs1225964030 1401 dbSNP
rs1343083616 1407 dbSNP
rs1302031366 1409 dbSNP
rs1016321017 1410 dbSNP
rs964361134 1411 dbSNP
rs1409936078 1418 dbSNP
rs1355871488 1424 dbSNP
rs782623463 1427 dbSNP
rs1409084528 1428 dbSNP
rs182977014 1429 dbSNP
rs1427256252 1432 dbSNP
rs186578352 1432 dbSNP
rs1198742701 1438 dbSNP
rs782660633 1453 dbSNP
rs139115737 1458 dbSNP
rs1202699542 1461 dbSNP
rs782507321 1461 dbSNP
rs924132868 1472 dbSNP
rs1206088496 1478 dbSNP
rs782635817 1486 dbSNP
rs989760283 1487 dbSNP
rs1223797870 1488 dbSNP
rs1374879012 1492 dbSNP
rs1277400605 1495 dbSNP
rs1441095801 1499 dbSNP
rs1383226677 1501 dbSNP
rs916554669 1503 dbSNP
rs1338506766 1504 dbSNP
rs782231402 1507 dbSNP
rs1405207041 1514 dbSNP
rs1159838285 1522 dbSNP
rs781980803 1524 dbSNP
rs1175690713 1529 dbSNP
rs1469863881 1530 dbSNP
rs1244008329 1532 dbSNP
rs1460270168 1532 dbSNP
rs1262991755 1533 dbSNP
rs1318180569 1539 dbSNP
rs782310464 1541 dbSNP
rs1222816417 1542 dbSNP
rs1316748695 1543 dbSNP
rs190285737 1543 dbSNP
rs782154768 1545 dbSNP
rs1381775008 1547 dbSNP
rs879978606 1551 dbSNP
rs1432878714 1554 dbSNP
rs930047255 1555 dbSNP
rs1419197804 1556 dbSNP
rs1386030323 1557 dbSNP
rs782791276 1558 dbSNP
rs782287443 1561 dbSNP
rs941916996 1563 dbSNP
rs1037645847 1565 dbSNP
rs1187587595 1568 dbSNP
rs900162119 1571 dbSNP
rs1240899891 1572 dbSNP
rs781807513 1577 dbSNP
rs1293415350 1589 dbSNP
rs782424357 1590 dbSNP
rs1358449503 1599 dbSNP
rs1296089688 1604 dbSNP
rs1216227983 1605 dbSNP
rs1359715907 1606 dbSNP
rs1288229577 1610 dbSNP
rs782051619 1612 dbSNP
rs1366345600 1613 dbSNP
rs1305169230 1616 dbSNP
rs890171562 1617 dbSNP
rs1368221638 1618 dbSNP
rs782746041 1620 dbSNP
rs1430689187 1628 dbSNP
rs1417925482 1631 dbSNP
rs1186455037 1636 dbSNP
rs1490369391 1637 dbSNP
rs1031565922 1641 dbSNP
rs1219773581 1643 dbSNP
rs1490096552 1647 dbSNP
rs182492647 1647 dbSNP
rs1305556912 1652 dbSNP
rs1294765853 1653 dbSNP
rs1224103927 1658 dbSNP
rs781836599 1658 dbSNP
rs1346202422 1661 dbSNP
rs1285316243 1673 dbSNP
rs1403212133 1675 dbSNP
rs1390228963 1682 dbSNP
rs1298977948 1684 dbSNP
rs1463794086 1684 dbSNP
rs1353194327 1689 dbSNP
rs782130189 1690 dbSNP
rs1481079372 1694 dbSNP
rs1196603648 1698 dbSNP
rs1432106260 1699 dbSNP
rs1250707611 1704 dbSNP
rs1197250619 1705 dbSNP
rs187402436 1714 dbSNP
rs1023928249 1715 dbSNP
rs969375498 1719 dbSNP
rs782746782 1721 dbSNP
rs1204183457 1723 dbSNP
rs1325538818 1726 dbSNP
rs1261198768 1728 dbSNP
rs927958218 1740 dbSNP
rs868912150 1748 dbSNP
rs782639726 1749 dbSNP
rs116458030 1751 dbSNP
rs781883385 1765 dbSNP
rs1371603645 1767 dbSNP
rs1331146996 1771 dbSNP
rs191895487 1780 dbSNP
rs1408864626 1788 dbSNP
rs1174912054 1791 dbSNP
rs1363934249 1798 dbSNP
rs941901302 1799 dbSNP
rs185641751 1803 dbSNP
rs900464199 1806 dbSNP
rs1183916245 1811 dbSNP
rs1462498763 1814 dbSNP
rs1241125943 1820 dbSNP
rs782548797 1823 dbSNP
rs143259546 1827 dbSNP
rs1261437980 1829 dbSNP
rs1344387141 1829 dbSNP
rs1051347042 1834 dbSNP
rs890140304 1835 dbSNP
rs1335299555 1840 dbSNP
rs781890670 1841 dbSNP
rs1396009734 1842 dbSNP
rs1385006811 1843 dbSNP
rs1159749792 1845 dbSNP
rs1379241928 1848 dbSNP
rs1451018589 1848 dbSNP
rs1163836507 1850 dbSNP
rs1241104671 1850 dbSNP
rs1446225979 1850 dbSNP
rs1186724526 1851 dbSNP
rs1247060605 1852 dbSNP
rs1263810263 1852 dbSNP
rs1285570493 1852 dbSNP
rs1447556578 1852 dbSNP
rs1487350981 1852 dbSNP
rs577998631 1852 dbSNP
rs59477955 1852 dbSNP
rs74969520 1852 dbSNP
rs1362006341 1853 dbSNP
rs1244555294 1865 dbSNP
rs1313425408 1865 dbSNP
rs1327480853 1866 dbSNP
rs1320865996 1867 dbSNP
rs782755597 1870 dbSNP
rs188923107 1871 dbSNP
rs1359418710 1875 dbSNP
rs1303367831 1876 dbSNP
rs782191703 1881 dbSNP
rs1383125653 1885 dbSNP
rs1030780275 1887 dbSNP
rs782335305 1889 dbSNP
rs193072696 1896 dbSNP
rs1476873232 1898 dbSNP
rs1262624436 1899 dbSNP
rs1223457677 1901 dbSNP
rs1490890372 1910 dbSNP
rs1288019304 1917 dbSNP
rs782651038 1920 dbSNP
rs969594259 1927 dbSNP
rs982373816 1929 dbSNP
rs1283413788 1939 dbSNP
rs782319447 1944 dbSNP
rs782199093 1945 dbSNP
rs1034994555 1947 dbSNP
rs1406280250 1949 dbSNP
rs1363281025 1951 dbSNP
rs1322493517 1954 dbSNP
rs184600505 1957 dbSNP
rs951436541 1964 dbSNP
rs1166062727 1965 dbSNP
rs1477475557 1965 dbSNP
rs782263538 1967 dbSNP
rs782553087 1970 dbSNP
rs782684314 1971 dbSNP
rs1245131051 1973 dbSNP
rs1198510386 1975 dbSNP
rs1438741448 1982 dbSNP
rs1275613074 1990 dbSNP
rs1197268925 1995 dbSNP
rs1317806900 1995 dbSNP
rs963539363 1996 dbSNP
rs1264333598 2003 dbSNP
rs1224756306 2007 dbSNP
rs1364885513 2010 dbSNP
rs1273865783 2013 dbSNP
rs1442546376 2018 dbSNP
rs782423622 2019 dbSNP
rs1337274148 2027 dbSNP
rs1326557141 2032 dbSNP
rs1464927831 2034 dbSNP
rs782248257 2035 dbSNP
rs921783559 2040 dbSNP
rs1423225965 2052 dbSNP
rs1470658807 2054 dbSNP
rs931879052 2055 dbSNP
rs188286694 2060 dbSNP
rs781959594 2061 dbSNP
rs935046613 2064 dbSNP
rs1457612461 2065 dbSNP
rs373533267 2069 dbSNP
rs1309908907 2074 dbSNP
rs1277346409 2079 dbSNP
rs1223879701 2080 dbSNP
rs200591282 2080 dbSNP
rs1306644824 2082 dbSNP
rs1445679197 2098 dbSNP
rs1383339337 2107 dbSNP
rs1338610988 2112 dbSNP
rs782302851 2113 dbSNP
rs893517136 2114 dbSNP
rs1011080816 2117 dbSNP
rs1401386747 2119 dbSNP
rs1410371033 2119 dbSNP
rs1157089843 2125 dbSNP
rs1439469805 2129 dbSNP
rs1386298259 2130 dbSNP
rs1185929409 2132 dbSNP
rs1482537959 2136 dbSNP
rs782034619 2142 dbSNP
rs782416697 2143 dbSNP
rs1448226468 2145 dbSNP
rs1045228872 2151 dbSNP
rs1239051060 2152 dbSNP
rs905378756 2153 dbSNP
rs1316951188 2154 dbSNP
rs1378288105 2155 dbSNP
rs1289390899 2156 dbSNP
rs1431493643 2161 dbSNP
rs782055708 2176 dbSNP
rs1296553237 2180 dbSNP
rs1419370411 2182 dbSNP
rs1366457092 2193 dbSNP
rs1165805973 2197 dbSNP
rs1422448035 2209 dbSNP
rs1413622061 2212 dbSNP
rs868937681 2216 dbSNP
rs181416504 2227 dbSNP
rs1476100633 2237 dbSNP
rs1260478987 2239 dbSNP
rs1215404079 2240 dbSNP
rs1490400136 2246 dbSNP
rs1035298618 2248 dbSNP
rs782331752 2249 dbSNP
rs1293522057 2258 dbSNP
rs1219043115 2260 dbSNP
rs1320899417 2261 dbSNP
rs951449146 2263 dbSNP
rs1216321290 2265 dbSNP
rs183975029 2272 dbSNP
rs1276339042 2277 dbSNP
rs1399496627 2283 dbSNP
rs1346320233 2285 dbSNP
rs1295508645 2287 dbSNP
rs1349719248 2289 dbSNP
rs868967741 2290 dbSNP
rs782142228 2291 dbSNP
rs1467682131 2297 dbSNP
rs782805368 2297 dbSNP
rs1422148963 2301 dbSNP
rs1192243402 2307 dbSNP
rs1480486426 2312 dbSNP
rs781974279 2315 dbSNP
rs1189171068 2317 dbSNP
rs1488029219 2321 dbSNP
rs1251725766 2324 dbSNP
rs1206397731 2325 dbSNP
rs1315931863 2327 dbSNP
rs1257359101 2329 dbSNP
rs781957717 2331 dbSNP
rs148549154 2333 dbSNP
rs1303658421 2334 dbSNP
rs1385358061 2337 dbSNP
rs782760708 2337 dbSNP
rs1367309759 2338 dbSNP
rs1170604726 2340 dbSNP
rs1299063963 2340 dbSNP
rs1398667601 2340 dbSNP
rs201565507 2340 dbSNP
rs1469868422 2342 dbSNP
rs1173494494 2343 dbSNP
rs1378919251 2343 dbSNP
rs1432191548 2343 dbSNP
rs1250822359 2344 dbSNP
rs782726632 2345 dbSNP
rs781795426 2346 dbSNP
rs1204292015 2347 dbSNP
rs1237490190 2347 dbSNP
rs1324345793 2347 dbSNP
rs1257874973 2348 dbSNP
rs1307994894 2349 dbSNP
rs1311779821 2349 dbSNP
rs962800309 2349 dbSNP
rs1242684948 2350 dbSNP
rs1375235892 2351 dbSNP
rs975489549 2351 dbSNP
rs1331249781 2352 dbSNP
rs1403687043 2352 dbSNP
rs1454030653 2352 dbSNP
rs1300514604 2353 dbSNP
rs1465116942 2354 dbSNP
rs1160154744 2355 dbSNP
rs1363949431 2355 dbSNP
rs1437574944 2355 dbSNP
rs1184094973 2356 dbSNP
rs1198743901 2356 dbSNP
rs1254024696 2356 dbSNP
rs1379505898 2356 dbSNP
rs782620779 2356 dbSNP
rs1242663945 2357 dbSNP
rs1247197843 2357 dbSNP
rs1261529310 2357 dbSNP
rs1309044388 2357 dbSNP
rs1311208535 2357 dbSNP
rs1342722103 2357 dbSNP
rs1351936642 2357 dbSNP
rs1482970028 2357 dbSNP
rs386828607 2357 dbSNP
rs1299628220 2358 dbSNP
rs1385120472 2358 dbSNP
rs1394938684 2358 dbSNP
rs782657987 2358 dbSNP
rs1163929947 2359 dbSNP
rs1186836379 2359 dbSNP
rs1359531826 2359 dbSNP
rs1366579136 2359 dbSNP
rs1473663536 2359 dbSNP
rs1219039035 2360 dbSNP
rs1285590451 2360 dbSNP
rs1487409937 2360 dbSNP
rs782070621 2360 dbSNP
rs1210736987 2361 dbSNP
rs1244760099 2361 dbSNP
rs1264188757 2361 dbSNP
rs1279494658 2361 dbSNP
rs1326474257 2361 dbSNP
rs1358982561 2361 dbSNP
rs781879274 2361 dbSNP
rs1303386945 2362 dbSNP
rs1388384497 2362 dbSNP
rs1406875922 2362 dbSNP
rs921752218 2362 dbSNP
rs781827741 2363 dbSNP
rs781869057 2363 dbSNP
rs1195860091 2364 dbSNP
rs1425732813 2364 dbSNP
rs782563419 2364 dbSNP
rs1199920039 2365 dbSNP
rs1476883011 2365 dbSNP
rs1288216318 2366 dbSNP
rs1453661496 2366 dbSNP
rs1209650953 2367 dbSNP
rs782794765 2368 dbSNP
rs1216178735 2369 dbSNP
rs1316834865 2370 dbSNP
rs1275063104 2372 dbSNP
rs1438234984 2374 dbSNP
rs1322609228 2375 dbSNP
rs1329108725 2375 dbSNP
rs911852952 2376 dbSNP
rs1168525955 2377 dbSNP
rs1402283667 2377 dbSNP
rs1464115963 2377 dbSNP
rs1423068377 2378 dbSNP
rs1479106443 2379 dbSNP
rs1245223274 2381 dbSNP
rs1198530281 2382 dbSNP
rs1240569363 2383 dbSNP
rs782426702 2384 dbSNP
rs1197367179 2385 dbSNP
rs1456915925 2386 dbSNP
rs1278765238 2387 dbSNP
rs1220487455 2388 dbSNP
rs1240591345 2388 dbSNP
rs1273882379 2388 dbSNP
rs782140380 2388 dbSNP
rs1378907565 2389 dbSNP
rs1052073823 2390 dbSNP
rs1446001234 2391 dbSNP
rs1406772769 2393 dbSNP
rs199517976 2394 dbSNP
rs1416254031 2401 dbSNP
rs1423247163 2402 dbSNP
rs189148096 2404 dbSNP
rs181649974 2405 dbSNP
rs1238584635 2406 dbSNP
rs1211550542 2408 dbSNP
rs186680592 2409 dbSNP
rs1440261383 2410 dbSNP
rs1277456345 2412 dbSNP
rs782625509 2413 dbSNP
rs1216943979 2414 dbSNP
rs1355543090 2421 dbSNP
rs192411309 2422 dbSNP
rs1306755794 2424 dbSNP
rs1239184482 2425 dbSNP
rs782506684 2429 dbSNP
rs1044859595 2430 dbSNP
rs782649911 2433 dbSNP
rs781826798 2435 dbSNP
rs1285889255 2436 dbSNP
rs1357560361 2439 dbSNP
rs1450291648 2439 dbSNP
rs782817266 2447 dbSNP
rs1420589237 2449 dbSNP
rs1056726878 2457 dbSNP
rs1362727427 2458 dbSNP
rs1157184489 2463 dbSNP
rs781784931 2464 dbSNP
rs1415148000 2469 dbSNP
rs1184167007 2476 dbSNP
rs1471509274 2487 dbSNP
rs1236424804 2488 dbSNP
rs182087007 2492 dbSNP
rs1193790843 2494 dbSNP
rs1489037727 2498 dbSNP
rs185231913 2502 dbSNP
rs782188865 2503 dbSNP
rs1226585960 2509 dbSNP
rs963058892 2512 dbSNP
rs1400717586 2516 dbSNP
rs782417708 2525 dbSNP
rs782673570 2528 dbSNP
rs1453477451 2543 dbSNP
rs1350877974 2544 dbSNP
rs1167485662 2546 dbSNP
rs1404052472 2548 dbSNP
rs782236707 2548 dbSNP
rs1413730393 2549 dbSNP
rs1028400104 2560 dbSNP
rs782446798 2572 dbSNP
rs1478519281 2577 dbSNP
rs782722995 2578 dbSNP
rs1260586389 2582 dbSNP
rs987226779 2585 dbSNP
rs1248285981 2586 dbSNP
rs1219150280 2593 dbSNP
rs1320999986 2602 dbSNP
rs1019202073 2606 dbSNP
rs1219262055 2607 dbSNP
rs1320162706 2615 dbSNP
rs781866510 2622 dbSNP
rs1276513204 2628 dbSNP
rs1381902109 2632 dbSNP
rs1368607709 2633 dbSNP
rs956621190 2640 dbSNP
rs73569623 2641 dbSNP
rs782526656 2644 dbSNP
rs1394302627 2651 dbSNP
rs189555071 2654 dbSNP
rs1466719564 2660 dbSNP
rs1420902649 2661 dbSNP
rs946394002 2662 dbSNP
rs1433370316 2665 dbSNP
rs782057066 2665 dbSNP
rs111837982 2679 dbSNP
rs1189187957 2680 dbSNP
rs1488039957 2688 dbSNP
rs926398492 2693 dbSNP
rs939083043 2697 dbSNP
rs1238713604 2715 dbSNP
rs1200501139 2718 dbSNP
rs1459118512 2721 dbSNP
rs1256189597 2722 dbSNP
rs1056599349 2726 dbSNP
rs1312931545 2728 dbSNP
rs1217828623 2733 dbSNP
rs1303681402 2733 dbSNP
rs1370798908 2734 dbSNP
rs782436861 2735 dbSNP
rs940269415 2736 dbSNP
rs1398784229 2741 dbSNP
rs1297061354 2744 dbSNP
rs782597300 2746 dbSNP
rs1360468567 2758 dbSNP
rs1039056298 2763 dbSNP
rs1453545525 2766 dbSNP
rs1380721407 2767 dbSNP
rs1180307129 2774 dbSNP
rs898495962 2775 dbSNP
rs1249748324 2778 dbSNP
rs782025231 2782 dbSNP
rs996843822 2783 dbSNP
rs1257969028 2784 dbSNP
rs1208345007 2786 dbSNP
rs1347573788 2790 dbSNP
rs1310403561 2792 dbSNP
rs1375258683 2794 dbSNP
rs1028284163 2797 dbSNP
rs1396106536 2799 dbSNP
rs782166653 2803 dbSNP
rs1403800666 2804 dbSNP
rs1300677037 2809 dbSNP
rs891176918 2814 dbSNP
rs1433668506 2815 dbSNP
rs782217394 2816 dbSNP
rs1160172843 2821 dbSNP
rs1417635328 2831 dbSNP
rs1363152592 2835 dbSNP
rs1188232560 2837 dbSNP
rs1424450833 2840 dbSNP
rs1258401440 2842 dbSNP
rs1185941451 2847 dbSNP
rs182538210 2848 dbSNP
rs1018756151 2850 dbSNP
rs1219168607 2862 dbSNP
rs956771215 2866 dbSNP
rs139820579 2867 dbSNP
rs1246214297 2871 dbSNP
rs1022667578 2872 dbSNP
rs782088429 2874 dbSNP
rs1309894946 2876 dbSNP
rs782748217 2879 dbSNP
rs781788658 2881 dbSNP
rs1340675596 2887 dbSNP
rs1299720289 2888 dbSNP
rs781987547 2890 dbSNP
rs1397908362 2892 dbSNP
rs1384025031 2896 dbSNP
rs1163749253 2897 dbSNP
rs939051832 2900 dbSNP
rs782453246 2904 dbSNP
rs2051161 2905 dbSNP
rs1474927659 2915 dbSNP
rs1264150472 2919 dbSNP
rs782415439 2920 dbSNP
rs1445603440 2924 dbSNP
rs1261415660 2925 dbSNP
rs940218366 2932 dbSNP
rs1038616026 2935 dbSNP
rs1271844413 2938 dbSNP
rs1232139394 2941 dbSNP
rs1318083299 2941 dbSNP
rs898713234 2950 dbSNP
rs932913961 2951 dbSNP
rs1397804139 2954 dbSNP
rs1325510943 2955 dbSNP
rs1049688312 2957 dbSNP
rs1388299327 2963 dbSNP
rs891144488 2965 dbSNP
rs1388412962 2967 dbSNP
rs781903593 2971 dbSNP
rs1460979092 2975 dbSNP
rs1424468125 2981 dbSNP
rs1032201883 2983 dbSNP
rs1172940820 2986 dbSNP
rs35765618 2987 dbSNP
rs1474528921 2991 dbSNP
rs1372728523 3000 dbSNP
rs1453748285 3002 dbSNP
rs1213665712 3010 dbSNP
rs892290084 3011 dbSNP
rs186903406 3012 dbSNP
rs1212323034 3016 dbSNP
rs1338267367 3018 dbSNP
rs1009853596 3021 dbSNP
rs1275084371 3023 dbSNP
rs1022129748 3025 dbSNP
rs1329197543 3031 dbSNP
rs1302543751 3032 dbSNP
rs967921960 3033 dbSNP
rs1402416947 3042 dbSNP
rs1333375334 3044 dbSNP
rs1408294107 3045 dbSNP
rs1396027004 3047 dbSNP
rs1173446609 3059 dbSNP
rs1002132692 3065 dbSNP
rs1393711237 3066 dbSNP
rs1193429120 3069 dbSNP
rs1033329876 3075 dbSNP
rs782026508 3082 dbSNP
rs782653162 3083 dbSNP
rs991916306 3085 dbSNP
rs191655605 3087 dbSNP
rs782208365 3089 dbSNP
rs1436776914 3091 dbSNP
rs146709716 3092 dbSNP
rs4898408 3097 dbSNP
rs781948895 3103 dbSNP
rs782094030 3104 dbSNP
rs5945135 3105 dbSNP
rs782427190 3107 dbSNP
rs139191015 3110 dbSNP
rs1440109423 3113 dbSNP
rs782558516 3120 dbSNP
rs782711098 3122 dbSNP
rs193301371 3123 dbSNP
rs1049989782 3126 dbSNP
rs782265677 3134 dbSNP
rs1420706525 3136 dbSNP
rs944069508 3143 dbSNP
rs1382686017 3148 dbSNP
rs1176050783 3152 dbSNP
rs1469152090 3155 dbSNP
rs1053205500 3167 dbSNP
rs1484449787 3168 dbSNP
rs782340328 3170 dbSNP
rs1011667445 3172 dbSNP
rs1043548274 3173 dbSNP
rs1282031640 3175 dbSNP
rs1223198531 3177 dbSNP
rs368083325 3181 dbSNP
rs1356993724 3184 dbSNP
rs1284814563 3189 dbSNP
rs781972615 3190 dbSNP
rs1353733337 3206 dbSNP
rs1312558759 3209 dbSNP
rs1400985051 3213 dbSNP
rs1157524462 3214 dbSNP
rs1400581899 3216 dbSNP
rs1415169569 3219 dbSNP
rs1164435519 3222 dbSNP
rs782055846 3224 dbSNP
rs903704739 3225 dbSNP
rs1473974620 3227 dbSNP
rs782711465 3228 dbSNP
rs1193987181 3230 dbSNP
rs879971882 3233 dbSNP
rs782017622 3234 dbSNP
rs782166048 3235 dbSNP
rs868979138 3236 dbSNP
rs1322182894 3239 dbSNP
rs1291955107 3240 dbSNP
rs782775553 3240 dbSNP
rs1235197368 3245 dbSNP
rs1292867583 3248 dbSNP
rs1219528481 3250 dbSNP
rs1364372130 3254 dbSNP
rs1287442396 3255 dbSNP
rs1013632245 3267 dbSNP
rs1350965507 3278 dbSNP
rs1328599605 3279 dbSNP
rs1459387935 3280 dbSNP
rs1416591121 3281 dbSNP
rs184890065 3283 dbSNP
rs1416954284 3285 dbSNP
rs1185657237 3286 dbSNP
rs115858644 3288 dbSNP
rs1211781269 3291 dbSNP
rs782731682 3292 dbSNP
rs973868614 3293 dbSNP
rs782519083 3295 dbSNP
rs781785632 3296 dbSNP
rs1309429270 3297 dbSNP
rs782338864 3298 dbSNP
rs954239684 3299 dbSNP
rs1214348606 3303 dbSNP
rs985669446 3304 dbSNP
rs1306245116 3305 dbSNP
rs186832055 3306 dbSNP
rs912854410 3308 dbSNP
rs1463081045 3309 dbSNP
rs1352387946 3311 dbSNP
rs944305665 3312 dbSNP
rs1433523201 3320 dbSNP
rs1396708386 3332 dbSNP
rs782663867 3336 dbSNP
rs1238714725 3340 dbSNP
rs1453678185 3340 dbSNP
rs782692024 3341 dbSNP
rs1481699778 3342 dbSNP
rs145003570 3343 dbSNP
rs1282866223 3345 dbSNP
rs1313022261 3345 dbSNP
rs1232559734 3347 dbSNP
rs1370834482 3349 dbSNP
rs1310703449 3353 dbSNP
rs1392622079 3357 dbSNP
rs947432667 3359 dbSNP
rs1297227858 3362 dbSNP
rs782255488 3364 dbSNP
rs1466185421 3367 dbSNP
rs191306098 3371 dbSNP
rs1433934408 3386 dbSNP
rs184221068 3392 dbSNP
rs1183957472 3395 dbSNP
rs903683479 3399 dbSNP
rs782227874 3403 dbSNP
rs12845059 3405 dbSNP
rs896360986 3407 dbSNP
rs1259891803 3409 dbSNP
rs1013518366 3415 dbSNP
rs1209158950 3416 dbSNP
rs1347698495 3423 dbSNP
rs782313158 3425 dbSNP
rs782395512 3428 dbSNP
rs1241868796 3431 dbSNP
rs1305620239 3432 dbSNP
rs1315681776 3432 dbSNP
rs781933719 3437 dbSNP
rs896842275 3443 dbSNP
rs1310773926 3446 dbSNP
rs781934872 3450 dbSNP
rs1360987221 3452 dbSNP
rs1451491454 3453 dbSNP
rs1363163843 3459 dbSNP
rs1026724297 3461 dbSNP
rs782279209 3463 dbSNP
rs1475610706 3475 dbSNP
rs1420287368 3476 dbSNP
rs1186127647 3477 dbSNP
rs954207943 3478 dbSNP
rs1262806159 3479 dbSNP
rs1207289850 3491 dbSNP
rs1485138343 3497 dbSNP
rs782046658 3498 dbSNP
rs188803906 3503 dbSNP
rs1336364194 3508 dbSNP
rs1291038554 3515 dbSNP
rs1232253839 3520 dbSNP
rs985553360 3521 dbSNP
rs1319963455 3529 dbSNP
rs1380327981 3530 dbSNP
rs1384148745 3532 dbSNP
rs1294110035 3535 dbSNP
rs1462000295 3541 dbSNP
rs1019786968 3544 dbSNP
rs1420175314 3546 dbSNP
rs1162903047 3549 dbSNP
rs1474978393 3552 dbSNP
rs1373859122 3557 dbSNP
rs782159857 3567 dbSNP
rs1195706344 3568 dbSNP
rs965983369 3573 dbSNP
rs1261606358 3579 dbSNP
rs1214917819 3591 dbSNP
rs181193960 3605 dbSNP
rs1270691433 3606 dbSNP
rs1212529747 3610 dbSNP
rs913203445 3615 dbSNP
rs947446880 3620 dbSNP
rs978841572 3621 dbSNP
rs781989274 3624 dbSNP
rs1325679037 3626 dbSNP
rs185470165 3627 dbSNP
rs782009680 3630 dbSNP
rs1392239834 3632 dbSNP
rs782157894 3636 dbSNP
rs1323890817 3640 dbSNP
rs1460995103 3641 dbSNP
rs1397463904 3642 dbSNP
rs1169911448 3644 dbSNP
rs896338849 3647 dbSNP
rs370554973 3654 dbSNP
rs1372821949 3658 dbSNP
rs1194690715 3659 dbSNP
rs189942576 3660 dbSNP
rs782041750 3670 dbSNP
rs1036980904 3679 dbSNP
rs1251697065 3690 dbSNP
rs1192452259 3691 dbSNP
rs1437974939 3697 dbSNP
rs1274634677 3698 dbSNP
rs896805516 3701 dbSNP
rs1338370041 3709 dbSNP
rs1280729785 3710 dbSNP
rs1236222498 3717 dbSNP
rs995173374 3725 dbSNP
rs1368616919 3726 dbSNP
rs1302649843 3731 dbSNP
rs149078749 3732 dbSNP
rs782814704 3750 dbSNP
rs41312790 3760 dbSNP
rs782069178 3765 dbSNP
rs1020175820 3772 dbSNP
rs1408392013 3776 dbSNP
rs1396053305 3778 dbSNP
rs965595793 3780 dbSNP
rs782510180 3787 dbSNP
rs116229551 3794 dbSNP
rs1173606985 3798 dbSNP
rs1020577157 3807 dbSNP
rs1234063624 3811 dbSNP
rs1179087733 3814 dbSNP
rs1436797249 3816 dbSNP
rs1257796275 3822 dbSNP
rs781827243 3824 dbSNP
rs782497132 3825 dbSNP
rs1345548174 3827 dbSNP
rs1279500038 3833 dbSNP
rs1224225679 3838 dbSNP
rs1352794683 3853 dbSNP
rs781840452 3855 dbSNP
rs72616489 3857 dbSNP
rs1313791082 3861 dbSNP
rs782111727 3865 dbSNP
rs1374075749 3870 dbSNP
rs782040345 3873 dbSNP
rs1401753833 3874 dbSNP
rs1410805697 3885 dbSNP
rs1469229838 3888 dbSNP
rs1418114364 3895 dbSNP
rs186071181 3901 dbSNP
rs1484500382 3909 dbSNP
rs782525765 3921 dbSNP
rs917730938 3930 dbSNP
rs949281173 3934 dbSNP
rs1256495101 3945 dbSNP
rs1216248903 3952 dbSNP
rs782680237 3955 dbSNP
rs1282139155 3958 dbSNP
rs897031014 3961 dbSNP
rs781886305 3979 dbSNP
rs1048019918 3986 dbSNP
rs889465590 3991 dbSNP
rs1006575648 4000 dbSNP
rs1235314110 4010 dbSNP
rs1353831920 4018 dbSNP
rs1302563071 4021 dbSNP
rs1431949992 4025 dbSNP
rs1347446459 4026 dbSNP
rs1316918837 4027 dbSNP
rs782247828 4033 dbSNP
rs1394640533 4037 dbSNP
rs782392274 4041 dbSNP
rs1166511623 4044 dbSNP
rs1040828087 4052 dbSNP
rs901337410 4073 dbSNP
rs1416740134 4093 dbSNP
rs1186875577 4094 dbSNP
rs1476309261 4097 dbSNP
rs1240255386 4099 dbSNP
rs1215046075 4102 dbSNP
rs1010365927 4103 dbSNP
rs781947987 4110 dbSNP
rs968931842 4111 dbSNP
rs782217915 4115 dbSNP
rs1332876439 4122 dbSNP
rs1312344028 4138 dbSNP
rs782551547 4144 dbSNP
rs1268908961 4145 dbSNP
rs1434965162 4150 dbSNP
rs782301212 4150 dbSNP
rs1327267038 4155 dbSNP
rs1034333167 4160 dbSNP
rs1170758854 4160 dbSNP
rs781930299 4161 dbSNP
rs1411427445 4165 dbSNP
rs1417067965 4166 dbSNP
rs781805602 4167 dbSNP
rs958725094 4170 dbSNP
rs1254827358 4174 dbSNP
rs782475652 4175 dbSNP
rs35766651 4177 dbSNP
rs1265048685 4178 dbSNP
rs1205546623 4184 dbSNP
rs1309506118 4187 dbSNP
rs917379220 4200 dbSNP
rs1271243312 4203 dbSNP
rs1228148028 4207 dbSNP
rs1349220185 4215 dbSNP
rs962440299 4219 dbSNP
rs1438040298 4221 dbSNP
rs1366351463 4231 dbSNP
rs1298275960 4233 dbSNP
rs1443872749 4240 dbSNP
rs1352404195 4243 dbSNP
rs1167666915 4246 dbSNP
rs1435166208 4252 dbSNP
rs189801020 4280 dbSNP
rs1171726931 4298 dbSNP
rs1431485626 4303 dbSNP
rs782381755 4308 dbSNP
rs931204786 4314 dbSNP
rs1481709068 4320 dbSNP
rs1231456368 4335 dbSNP
rs1204892023 4345 dbSNP
rs1349100814 4348 dbSNP
rs1283063307 4357 dbSNP
rs782009730 4359 dbSNP
rs1048319913 4391 dbSNP
rs115277539 4402 dbSNP
rs942402279 4410 dbSNP
rs1041113229 4411 dbSNP
rs1224979432 4419 dbSNP
rs1370708840 4430 dbSNP
rs900889160 4437 dbSNP
rs1010417621 4443 dbSNP
rs1041867675 4450 dbSNP
rs180721411 4459 dbSNP
rs1310864609 4464 dbSNP
rs1465446817 4465 dbSNP
rs1364327040 4466 dbSNP
rs1159912165 4469 dbSNP
rs904716226 4476 dbSNP
rs1181792621 4481 dbSNP
rs1409991775 4481 dbSNP
rs1486135408 4483 dbSNP
rs1260001581 4491 dbSNP
rs1209180926 4518 dbSNP
rs1000437386 4519 dbSNP
rs1261885353 4534 dbSNP
rs781794607 4541 dbSNP
rs1314652361 4544 dbSNP
rs1287294833 4547 dbSNP
rs1233464446 4553 dbSNP
rs1034635544 4559 dbSNP
rs958691332 4578 dbSNP
rs1357005426 4587 dbSNP
rs1014215732 4618 dbSNP
rs1385579704 4621 dbSNP
rs1290606565 4622 dbSNP
rs1455392278 4625 dbSNP
rs1386481834 4629 dbSNP
rs1158562643 4644 dbSNP
rs185024500 4652 dbSNP
rs1420307705 4655 dbSNP
rs1185848238 4660 dbSNP
rs1423663684 4676 dbSNP
rs1263004973 4679 dbSNP
rs962123526 4680 dbSNP
rs1266892939 4681 dbSNP
rs1213774274 4686 dbSNP
rs972574645 4694 dbSNP
rs1336479575 4704 dbSNP
rs1270958153 4712 dbSNP
rs782213566 4715 dbSNP
rs918399268 4720 dbSNP
rs1243757722 4746 dbSNP
rs952574958 4747 dbSNP
rs1326861801 4753 dbSNP
rs782804902 4755 dbSNP
rs1297492176 4757 dbSNP
rs1319902587 4769 dbSNP
rs1364383248 4769 dbSNP
rs1380421161 4769 dbSNP
rs1462083418 4780 dbSNP
rs1396951882 4785 dbSNP
rs1161716160 4790 dbSNP
rs1457699927 4791 dbSNP
rs782409345 4802 dbSNP
rs1373944938 4804 dbSNP
rs1195819577 4807 dbSNP
rs1448129861 4822 dbSNP
rs781899794 4824 dbSNP
rs782511136 4832 dbSNP
rs191538460 4841 dbSNP
rs1193710267 4844 dbSNP
rs1469450962 4850 dbSNP
rs983993833 4856 dbSNP
rs1208824722 4857 dbSNP
rs1339700471 4867 dbSNP
rs911101330 4877 dbSNP
rs1225921541 4883 dbSNP
rs1304153467 4889 dbSNP
rs1341351109 4889 dbSNP
rs782283133 4894 dbSNP
rs1373345326 4898 dbSNP
rs1321693259 4905 dbSNP
rs1386386391 4911 dbSNP
rs1397487506 4912 dbSNP
rs1169948890 4914 dbSNP
rs782692054 4919 dbSNP
rs1428301552 4927 dbSNP
rs1390069271 4933 dbSNP
rs1174873219 4937 dbSNP
rs1455985644 4939 dbSNP
rs782482090 4940 dbSNP
rs1197559450 4942 dbSNP
rs1437992590 4955 dbSNP
rs782659099 4956 dbSNP
rs1202751549 4977 dbSNP
rs922281927 4978 dbSNP
rs1482627469 4988 dbSNP
rs945798299 5016 dbSNP
rs1280923610 5019 dbSNP
rs782188278 5054 dbSNP
rs782331410 5055 dbSNP
rs782563453 5064 dbSNP
rs1273082393 5068 dbSNP
rs1232638994 5070 dbSNP
rs1336575950 5073 dbSNP
rs182995502 5080 dbSNP
rs1408365264 5081 dbSNP
rs936194451 5085 dbSNP
rs1370285832 5093 dbSNP
rs781953719 5095 dbSNP
rs1437056485 5097 dbSNP
rs782097425 5098 dbSNP
rs1171473941 5121 dbSNP
rs782090282 5122 dbSNP
rs1365148515 5129 dbSNP
rs1014933281 5130 dbSNP
rs1024285073 5131 dbSNP
rs782703954 5141 dbSNP
rs1440568718 5142 dbSNP
rs1277899640 5145 dbSNP
rs1199913349 5148 dbSNP
rs142355638 5188 dbSNP
rs1290318223 5191 dbSNP
rs1027727904 5193 dbSNP
rs782649071 5196 dbSNP
rs983887503 5199 dbSNP
rs1294232098 5213 dbSNP
rs146354251 5216 dbSNP
rs1357920464 5222 dbSNP
rs963973027 5223 dbSNP
rs1400757045 5227 dbSNP
rs977097865 5229 dbSNP
rs922279252 5233 dbSNP
rs1156356981 5236 dbSNP
rs1472021694 5240 dbSNP
rs1418138197 5256 dbSNP
rs187149300 5261 dbSNP
rs977167323 5262 dbSNP
rs2032057 5264 dbSNP
rs1236812061 5275 dbSNP
rs1448693854 5277 dbSNP
rs1270025596 5286 dbSNP
rs935743299 5293 dbSNP
rs367810522 5294 dbSNP
rs782054679 5298 dbSNP
rs191427935 5339 dbSNP
rs1230353259 5346 dbSNP
rs41299130 5364 dbSNP
rs183459179 5384 dbSNP
rs187737156 5385 dbSNP
rs192465759 5386 dbSNP
rs1027621921 5394 dbSNP
rs1456301949 5398 dbSNP
rs1394755900 5408 dbSNP
rs782079973 5409 dbSNP
rs782738162 5410 dbSNP
rs1168287834 5411 dbSNP
rs1476320629 5421 dbSNP
rs1246181585 5427 dbSNP
rs1186755451 5429 dbSNP
rs1464530901 5433 dbSNP
rs1018046912 5438 dbSNP
rs1223984768 5453 dbSNP
rs1320171688 5455 dbSNP
rs1289525956 5460 dbSNP
rs781784763 5460 dbSNP
rs1215535381 5475 dbSNP
rs1344916198 5477 dbSNP
rs1296131361 5478 dbSNP
rs781831278 5484 dbSNP
rs1433685937 5495 dbSNP
rs976688902 5498 dbSNP
rs1294806629 5500 dbSNP
rs1433772774 5506 dbSNP
rs1348960057 5507 dbSNP
rs1030033823 5512 dbSNP
rs1170868445 5520 dbSNP
rs782451366 5532 dbSNP
rs782661975 5533 dbSNP
rs1167934041 5537 dbSNP
rs1454670913 5539 dbSNP
rs1395722022 5541 dbSNP
rs1192994292 5543 dbSNP
rs1487594420 5547 dbSNP
rs967323673 5549 dbSNP
rs1205654198 5555 dbSNP
rs1484263209 5561 dbSNP
rs1272964930 5564 dbSNP
rs1228262446 5576 dbSNP
rs1349240118 5591 dbSNP
rs1302689866 5597 dbSNP
rs1217031950 5607 dbSNP
rs1366468900 5609 dbSNP
rs781859036 5611 dbSNP
rs1298433543 5613 dbSNP
rs1411400256 5627 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.78 8.3e-4 0.703 3.7e-3 13 Click to see details
GSE28544 Breast cancer -0.602 9.3e-4 -0.671 1.7e-4 24 Click to see details
GSE14794 Lymphoblastoid cells -0.264 6.0e-3 -0.218 2.0e-2 90 Click to see details
GSE32688 Pancreatic cancer 0.301 4.7e-2 0.312 4.1e-2 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.301 7.2e-2 -0.262 1.0e-1 25 Click to see details
GSE21849 B cell lymphoma 0.17 1.9e-1 0.276 7.4e-2 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.155 2.6e-1 -0.099 3.4e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.109 3.1e-1 0.031 4.4e-1 23 Click to see details
GSE19350 CNS germ cell tumors -0.158 3.1e-1 0.021 4.7e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.1 3.2e-1 -0.260 1.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.058 3.2e-1 0.075 2.8e-1 64 Click to see details
GSE17306 Multiple myeloma 0.064 3.3e-1 0.143 1.6e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.11 3.4e-1 0.165 2.7e-1 16 Click to see details
GSE38226 Liver fibrosis -0.08 3.7e-1 -0.125 2.9e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.17 3.7e-1 -0.257 3.1e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells -0.064 3.8e-1 0.032 4.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.317 0.01 -0.277 0.03 49 Click to see details
CHOL -0.724 0.01 -0.683 0.02 9 Click to see details
KIRP -0.603 0.04 -0.600 0.04 9 Click to see details
STAD -0.455 0.13 -0.333 0.21 8 Click to see details
ESCA -0.563 0.16 -0.100 0.44 5 Click to see details
HNSC 0.867 0.17 0.500 0.33 3 Click to see details
THCA -0.361 0.28 -0.600 0.14 5 Click to see details
KICH -0.249 0.28 -0.167 0.35 8 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
KIRC -0.109 0.29 -0.073 0.35 29 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43