miRTarBase - #MIRT003099 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AKT3   
Synonyms MPPH, MPPH2, PKB-GAMMA, PKBG, PRKBG, RAC-PK-gamma, RAC-gamma, STK-2
Description AKT serine/threonine kinase 3
Transcript NM_005465   
Other Transcripts NM_181690   
Expression
Putative miRNA Targets on AKT3
3'UTR of AKT3
(miRNA target sites are highlighted)
>AKT3|NM_005465|3'UTR
   1 GTCTCTTTCATTCTGCTACTTCACTGTCATCTTCAATTTATTACTGAAAATGATTCCTGGACATCACCAGTCCTAGCTCT
  81 TACACATAGCAGGGGCACCTTCCGACATCCCAGACCAGCCAAGGGTCCTCACCCCTCGCCACCTTTCACCCTCATGAAAA
 161 CACACATACACGCAAATACACTCCAGTTTTTGTTTTTGCATGAAATTGTATCTCAGTCTAAGGTCTCATGCTGTTGCTGC
 241 TACTGTCTTACTATTATAGCAACTTTAAGAAGTAATTTTCCAACCTTTGGAAGTCATGAGCCCACCATTGTTCATTTGTG
 321 CACCAATTATCATCTTTTGATCTTTTAGTTTTTCCCTCAGTGAAGGCTAAATGAGATACACTGATTCTAGGTACATTTTT
 401 TAACTTTCTAGAAGAGAAAAACTAACTAGACTAAGAAGATTTAGTTTATAAATTCAGAACAAGCAATTGTGGAAGGGTGG
 481 TGGCGTGCATATGTAAAGCACATCAGATCCGTGCGTGAAGTAGGCATATATCACTAAGCTGTGGCTGGAATTGATTAGGA
 561 AGCATTTGGTAGAAGGACTGAACAACTGTTGGGATATATATATATATATATAATTTTTTTTTTTTAAATTCCTGGTGGAT
 641 ACTGTAGAAGAAGCCCATATCACATGTGGATGTCGAGACTTCACGGGCAATCATGAGCAAGTGAACACTGTTCTACCAAG
 721 AACTGAAGGCATATGCACAGTCAAGGTCACTTAAAGGGTCTTATGAAACAATTTGAGCCAGAGAGCATCTTTCCCCTGTG
 801 CTTGGAAACCTTTTTTCCTTCTTGACATTTATCACCTCTGATGGCTGAAGAATGTAGACAGGTATAATGATACTGCTTTT
 881 CACCAAAATTTCTACACCAAGGTAAACAGGTGTTTGCCTTATTTAATTTTTTACTTTCAGTTCTACGTGAATTAGCTTTT
 961 TCTCAGATGTTGAAACTTTGAATGTCCTTTTATGATTTTGTTTATATTGCAGTAGTATTTATTTTTTAGTGATGAGAATT
1041 GTATGTCATGTTAGCAAACGCAGCTCCAACTTATATAAAATAGACTTACTGCAGTTACTTTTGACCCATGTGCAAGGATT
1121 GTACACGCTGATGAGAATCATGCACTTTTTCTCCTCTGTTAAAAAAAATGATAAGGCTCTGAAATGGAATATATTGGTTA
1201 GAATTTGGCTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGCCA
1281 AGGGGTTAATGAAACAAATAGCTGTTGACGTTTGCTCATTTAAGAATTTGAAACGTTATGATGACCTGGCAACAAAAAGT
1361 AATGAAGAAAATTGAGACCTGAGTGAAGATAAGAAATGATCTTTACGTGGCAAAATGAACACATCTTGAGTATTTAGGAA
1441 ATGGGCAGTGAAGGCTAAGAACCTGGTGTGTTTCTTGGGATCATGGTACATTTATCACTGAATTAAGCCATCAGGGAAAA
1521 AACAACAAAAAAAGAGAACACCTCCAGCTTTTCTTTTTCTGTATATACTCATGTCCCCCAGATTCCAACATTTCTCACTG
1601 AAAGGGGGCATGTATGCAAACCTCATCTTTCTCCTTCATTAATGATGATCTTCAGATTAAACCCTTTGGTGCTAGGAGCT
1681 GACAATTTCCAAAGCAGCCTGTGAAGTCCTAGGGGCTGGGGGCCACTCTTGCGGCAAGCAGAAGGCCATCCTACTCCGCG
1761 GAGTGATCATGGAAATGTATTTTAGTTAAACTCTGACAGCTCCCAAACGGAAGACTACAGCATGACGTAGTATTATGATT
1841 GCATTGTATGAAAGAGCAAGTGACTTTCTAAGTAGGATGAATCATATTCATATGCAGATGTCTTAGCCTCTTGACGCTGG
1921 AAGTGTGGATTTATAGCTATGAAACCACTGCTGGCAGTGGGTGGGCCACTGGGACTGACGGGGGTTAAAGGGCATTTTAC
2001 TAAGGCAGCTAAGACATATTCAGACATCAACGTTATCCTTCTTTTTCATATTTCTACCTGAGTGAAGTTCATCCTTAGTA
2081 TTGAGTAGGAAGTTACAGTAAATGGTAGTTCATTCTTACTTACACACATAGCTAATCTTTTTTTTTTCACTTGGAATTAT
2161 GTTGAATGTTTCATTTTGACAAAAAAGTAGACTAGAAGGTATGTTCTTTAAGTTGTCTTGCATCCATTATATAAGAAAGA
2241 AACAGGTGAGAGGAAGAGCAGAAAGCTGAGACTGGCTGATGTTCAGAGCACTTACTCCTCTAGAGGGAAAGCATGACACC
2321 GAACACTAAGCACACAGCTTTTTGTTGTTTTGGTTTTTTCTCCCGCAAATCTTAAAGTGATTCCCATGACCTTGGCCAAG
2401 GACACTTCTTAAAGATTAATGACTGGCACTGACATTGCCCCAGGCGGGCCACTCCTCACACTGGCTCTCAGTTCCCAGCC
2481 ATGCCTGGGGCTCAGTCACTTCTATTCCACCCTCTGAGACTCCATTGGTGTCACACAAGGTGTCTTCTTGGCTTTGATTT
2561 TGAGAATCCCCTATTTTCACTTCCAGATCTGTCAGCTGCCATGGAGGAATAATAGAAAACCAGAAATGCGTGTAGAGGGA
2641 GATTTCTAAAACTTCCCTTGTGTCGCCCATAGTTGTAGTTTTGGGTTCTGGCAGGTGGAACACCCTGAAACCTGGAATCA
2721 TTCTATGAGAATACAGTTCAGACTTTGCAGACTCCAGCCCATACTAACTGTCATGAAGCTTGACTTCTTGTCATAATGCA
2801 GCCATCTTGGAGGAAATTGGCCATTTCTGCTTAGATGGTTGGCAGGGTCGCGCTCAGCTTTGCTTTCTACACTAATTACA
2881 TAGCATTATTCAAGTATTGTTTTCCATTTCCCATCCCTGATTTCCAGCTTCTTAAAGCTGACTGTTCTTGCAGGGGCCAC
2961 TTGCTTCTCCTAGAGTACAAAAGTAAGGGCCTTCCTTACTAACTGCAGGGTCTCTCTATTACACCTCAACATACACACTT
3041 TGCTGCTACTGTTTGTACTGTCTACAGTAGAATTTCCTTATCTTGCTCCTGGTAGTGCATTACAGGCAAGCATGAAATGT
3121 AAAGTATTTATTTAAATAAAAAGAAAACCTCTAAATTGGTAATTGAATTACCTCCCTGTAGCTTTATAGTTTGTGACATT
3201 TCTTGACCTTGCTAGTTCTTTCATTAGATCTGCGCAAGATCTAGTCATCTGGTTAAGGATTTTAAGCAGATGCAACTATA
3281 AACCCAAGAAACTGTATTACTATTACTGTTGGTCATACTAAACCTGTCTATTTCCTGAAGTATATGACCCACAAGGATGT
3361 GGAATAACTAGGAGAAACTGTTTTTGTACACTGTACATCCTTAGTATTTTTACACGTATATGATAGGGATGAACATGATT
3441 TTCCTTCGTACAGACAGCTTAAATAAAGCACTATGTCAATCTGCTACTTCTCTGTTTATTGTTGTTGGATGTGGTTCTAT
3521 AATCCCCCCAAATTAAATCTTCTTTAATGAAAACATGATTTTTAATAGCCCCAGCTGGTATTAACCTACCTTGTATAAAA
3601 TGTGACAGGAAAATATAGAAATAATTCCTTGTAGCTCACACACACACACATAGGGGATCATTTTTACTTCAGTGAAATGG
3681 CAGTAGTGCGGTTGTGCAAACTTTGATGAACGGCTGCTTCTGAGGGGAAACGCTGACCTCTCAGCACTGGATTTAGGATG
3761 GATGTACTGTGAAGCCAGGGATGAAGGAGGTCTCAGACCCTGGGGACATTCAGACCCGAATCATCTATACAACACACGGT
3841 TTGGACCCAGAATCTGAAGGAATGTAGCTTTTCATTAACGTCTTCCTGATAATGTACTGCTCTGCATATTTCCTTTCTTA
3921 GAGTGTATTTCTAACAACATGTCATGGCAAATTAACAAACTTAGACGTGGGTGATGTAGATGGGTAGGATGGCTGGACTG
4001 CAGTCTGACTTCACGTTGAATCATTCTGGATGGGGCCTTTTTCTGATTTTACCTCATAAAGCTACTATTGTAGAAACTTG
4081 GCTTTGCTCCTGTGACGAAGCCAGACAGAGGAATGGCTTTTGGGACCAGAGTGAGTCAAGCATGTATGTGTATGTCACAC
4161 GGCCAAATTTGAGGGCATTCTCACATGTGCTCTTCTCTCAAAACCACTGGGGTTGACAGATCCAGGAGGCTAAAAAAAAG
4241 TGACCTCTATAATTCTTTAAAGGTGCTATTTTTAGAATATTGTATAATTTATTCACAGTATATCTAAAACAGAATTAAGG
4321 ACAATTAAAATATCTTATGTGACAGCCTTTATGTCTAGCACATTTGATGAAATAAAAAACTTCTGAATCTGAATAGAAGT
4401 TCTACTGTTTCAGGCTTGAACCTTTTACATGCTCAAGAGATTCAAATGGTCTCTGTGTGTAGATCATGCCACCGCCTCCA
4481 AAGCCTAATCCACATCACTTCTGAGAGGCAAGGCTGAGCATATGGTGACATCAGCTCTGTGTTGAGATGGTGATGAGGAT
4561 GATGGCTCGCTGGCCAGGCAGGGCAGCCGAAGGTCAGGGACCTGTCCTAACTAACTGCAGCCTTGCCTTTAGTGTTTGTC
4641 ATTCTCAGATACAACACGGTATGTCCAGTGTCCGTTTTTATTACTTTAAAGCATTTGAGGGCTTAATTGTGTATAGTAGA
4721 AATACTATTTTAGACAAATAATTATCTGTGTACAGATATTTGATATACTCTAAGTAAATTTTCTAATTTCACTAAGTACG
4801 TTTTTAGGCTCCTCTCAAATACTGCGTATTGAAGAAAAAAATCTGACACCACCGAGCCAAAGATGCTTTTTTGTCTGTTT
4881 TCGTTGTTTAACAGAATGGAAAGAGTAATGCATAGTGCTTCCTGGTGTCTCCTGATTGATTGATTGTGCACAAAGTAGGA
4961 CGATAAATAAATAAAATGGAGTCTGATGGGACATTGATTAAAGGTGAAGGATGATTGATATATAGATCATGAAAAGAAAA
5041 ATGAATGGCAGGAAAAAAAGTTTGGTCCTTAATATACTTTGGCCTAGTTAAAATATGTGCCTTTTTGGTGTGTTTTGTTC
5121 ATCACTACAAGATAAAAAGGAAACATTACAACTCAAGTCTTTAAAAAGTTCATTTATTGAAAATCATATGTATAACCTAG
5201 CATACGAATGAGCAGATTTAAACACATAACTTCAAGCCATTTCTGAAAACATACACCAGGAGCTCTGCTCAGCTAGAGTC
5281 AGACTCCAGCTCCAGCCCGACTGCGTGCGGGGACAGCGCCCGCGTTGATGAGGACCAGCCCCACTGCAGGCTGAGGCGGT
5361 GTCACCCTGGGAAGGTCGTGGTGCGTTGTGGCATATTAAGTCTAAACCAGATGAATGTAAATATCTCTTTGTAAATCATT
5441 TATTTCACTCTGTTCCATCCAGGTCAGCAATCAGATTGTGGCATGCTGGGTAACTGGAAAAAATAATAAAAAGTAAGTTT
5521 CAATAGCTCAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUG-GUAACAG------UGUGAGGu 5'
            ||||| |||   |      ||||||| 
Target 5' aaAACACACATACACGCAAATACACTCCa 3'
157 - 185 150.00 -18.70
2
miRNA  3' guuugUGGUAACAG-----UGUGAGGu 5'
               ||| ||| |     |||||:| 
Target 5' ccatgACC-TTGGCCAAGGACACTTCt 3'
2384 - 2409 132.00 -13.20
3
miRNA  3' guuuGU-GGUAACAGUGUGAGGu 5'
              || |:|  |||| ||||| 
Target 5' tgctCAGCTAGAGTCAGACTCCa 3'
5266 - 5288 130.00 -17.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
387204 7 ClinVar
296922 5160 ClinVar
296921 5177 ClinVar
296920 5252 ClinVar
296919 5315 ClinVar
296918 5367 ClinVar
296917 5403 ClinVar
853144 5484 ClinVar
COSN30521347 5 COSMIC
COSN30185556 13 COSMIC
COSN31486454 22 COSMIC
COSN30148892 28 COSMIC
COSN28816008 65 COSMIC
COSN25052855 67 COSMIC
COSN31552909 86 COSMIC
COSN25539116 115 COSMIC
COSN31586428 139 COSMIC
COSN31485814 188 COSMIC
COSN21953840 408 COSMIC
COSN22423699 421 COSMIC
COSN8452850 421 COSMIC
COSN30108173 611 COSMIC
COSN25109943 674 COSMIC
COSN31591422 796 COSMIC
COSN30268237 881 COSMIC
COSN31571317 887 COSMIC
COSN31539851 909 COSMIC
COSN31544801 1039 COSMIC
COSN17327665 1071 COSMIC
COSN15660406 1187 COSMIC
COSN31571315 1222 COSMIC
COSN5202726 1239 COSMIC
COSN15894832 1261 COSMIC
COSN31543742 1310 COSMIC
COSN28664457 1335 COSMIC
COSN19656930 1503 COSMIC
COSN24297735 1575 COSMIC
COSN31541233 1617 COSMIC
COSN31528048 1715 COSMIC
COSN29166323 1732 COSMIC
COSN31578935 1755 COSMIC
COSN31521812 1786 COSMIC
COSN19446184 1827 COSMIC
COSN20096202 1853 COSMIC
COSN30543621 1942 COSMIC
COSN1440245 1958 COSMIC
COSN31516005 2032 COSMIC
COSN27363893 2137 COSMIC
COSN31535474 2178 COSMIC
COSN7213175 2217 COSMIC
COSN5369593 2525 COSMIC
COSN29094002 2905 COSMIC
COSN8452849 3067 COSMIC
COSN1440244 3411 COSMIC
COSN8452848 4763 COSMIC
COSN4749577 4933 COSMIC
COSN28870851 5318 COSMIC
COSN31502318 5330 COSMIC
COSN31560700 5347 COSMIC
COSN30712282 5356 COSMIC
COSN30751536 5399 COSMIC
COSN23177651 5411 COSMIC
COSN30104708 5415 COSMIC
COSM7094679 5493 COSMIC
COSM7094677 5500 COSMIC
COSM6062432 5505 COSMIC
COSN26965721 5509 COSMIC
COSN26392492 5514 COSMIC
COSN213389 5515 COSMIC
rs9428966 651 GWAS
rs67027895 1335 GWAS
rs34770086 1856 GWAS
rs1058305 3909 GWAS
rs14403 4658 GWAS
rs145504297 4946 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766019860 3 dbSNP
rs746704800 4 dbSNP
rs769005975 4 dbSNP
rs543291675 7 dbSNP
rs370750588 9 dbSNP
rs918344063 9 dbSNP
rs764600594 10 dbSNP
rs1184602716 15 dbSNP
rs1480409905 19 dbSNP
rs761768321 24 dbSNP
rs753649886 28 dbSNP
rs1328222784 36 dbSNP
rs763992613 40 dbSNP
rs775103000 41 dbSNP
rs192105293 44 dbSNP
rs552302039 45 dbSNP
rs1208690839 50 dbSNP
rs768201175 56 dbSNP
rs958725921 67 dbSNP
rs781391076 77 dbSNP
rs1430430535 79 dbSNP
rs114728802 85 dbSNP
rs1309249426 89 dbSNP
rs1157582039 91 dbSNP
rs1018048352 92 dbSNP
rs557020197 103 dbSNP
rs1348927637 104 dbSNP
rs1363775802 114 dbSNP
rs1407065453 115 dbSNP
rs1303918815 116 dbSNP
rs1349667269 117 dbSNP
rs1221812326 122 dbSNP
rs985366925 127 dbSNP
rs187407614 137 dbSNP
rs1323370745 138 dbSNP
rs1002951735 142 dbSNP
rs907036161 143 dbSNP
rs550667375 144 dbSNP
rs1289037896 154 dbSNP
rs1036163793 171 dbSNP
rs746726491 172 dbSNP
rs1010910652 173 dbSNP
rs1480527945 176 dbSNP
rs1175887870 186 dbSNP
rs892460681 187 dbSNP
rs1031120360 195 dbSNP
rs1005125780 207 dbSNP
rs1166300526 211 dbSNP
rs771057786 215 dbSNP
rs1004024259 218 dbSNP
rs887672158 221 dbSNP
rs1472511042 236 dbSNP
rs1409933147 237 dbSNP
rs1164478313 240 dbSNP
rs879610006 244 dbSNP
rs1049479371 251 dbSNP
rs931649369 257 dbSNP
rs1299722297 259 dbSNP
rs1373775531 267 dbSNP
rs1451824096 282 dbSNP
rs1483530974 283 dbSNP
rs1360999711 284 dbSNP
rs1246308733 290 dbSNP
rs1219603175 291 dbSNP
rs1246020085 300 dbSNP
rs1273239922 303 dbSNP
rs921638257 305 dbSNP
rs1206166205 307 dbSNP
rs370949990 318 dbSNP
rs1290258335 321 dbSNP
rs1183533663 323 dbSNP
rs1208037855 324 dbSNP
rs557784596 326 dbSNP
rs1289743139 333 dbSNP
rs1446556340 348 dbSNP
rs944407476 353 dbSNP
rs534559707 364 dbSNP
rs977591163 366 dbSNP
rs1354905388 373 dbSNP
rs183115836 376 dbSNP
rs771792175 382 dbSNP
rs1384955963 384 dbSNP
rs1453255453 391 dbSNP
rs1049081021 408 dbSNP
rs372332395 410 dbSNP
rs1272740443 412 dbSNP
rs990829608 419 dbSNP
rs1351988357 423 dbSNP
rs1326989799 425 dbSNP
rs918237068 426 dbSNP
rs1203392787 429 dbSNP
rs70961726 429 dbSNP
rs1457228187 430 dbSNP
rs1463090326 433 dbSNP
rs867294808 453 dbSNP
rs1241670369 455 dbSNP
rs45498504 461 dbSNP
rs192817317 479 dbSNP
rs188008375 480 dbSNP
rs1034346977 485 dbSNP
rs1480214049 486 dbSNP
rs1174055688 487 dbSNP
rs779300358 502 dbSNP
rs1470300742 503 dbSNP
rs1424493630 504 dbSNP
rs910947721 504 dbSNP
rs1432229994 506 dbSNP
rs971414870 510 dbSNP
rs1344525051 511 dbSNP
rs985272089 514 dbSNP
rs1015436907 515 dbSNP
rs1187684386 520 dbSNP
rs1284118021 526 dbSNP
rs368698280 528 dbSNP
rs1445380345 534 dbSNP
rs968487664 539 dbSNP
rs1463527425 545 dbSNP
rs914530273 557 dbSNP
rs1197533317 562 dbSNP
rs1209225039 564 dbSNP
rs1311117189 570 dbSNP
rs1431164052 573 dbSNP
rs1004707282 575 dbSNP
rs1275810786 577 dbSNP
rs1157951677 587 dbSNP
rs887632135 595 dbSNP
rs989128331 599 dbSNP
rs1304687815 602 dbSNP
rs1364396310 605 dbSNP
rs1402794228 606 dbSNP
rs1027570578 611 dbSNP
rs1234365727 612 dbSNP
rs1363416386 612 dbSNP
rs1252372910 613 dbSNP
rs139770173 613 dbSNP
rs956759869 613 dbSNP
rs996129952 613 dbSNP
rs900430555 614 dbSNP
rs1451999347 615 dbSNP
rs550577285 625 dbSNP
rs1159074715 626 dbSNP
rs1230943912 626 dbSNP
rs1471154019 626 dbSNP
rs182785210 626 dbSNP
rs60854028 626 dbSNP
rs758243739 629 dbSNP
rs1174042839 631 dbSNP
rs1179115228 632 dbSNP
rs1023692736 636 dbSNP
rs1365848604 637 dbSNP
rs9428966 651 dbSNP
rs1416438243 652 dbSNP
rs1042557173 657 dbSNP
rs190951746 666 dbSNP
rs888612324 669 dbSNP
rs545475704 672 dbSNP
rs1382154107 674 dbSNP
rs1048672880 675 dbSNP
rs540435625 684 dbSNP
rs1357386305 685 dbSNP
rs1195433286 693 dbSNP
rs994811235 697 dbSNP
rs1439275396 704 dbSNP
rs914763283 713 dbSNP
rs772124321 714 dbSNP
rs754164872 731 dbSNP
rs1242405445 733 dbSNP
rs1187043280 738 dbSNP
rs1482882530 742 dbSNP
rs559877618 748 dbSNP
rs1235301191 751 dbSNP
rs1184950317 752 dbSNP
rs1211585623 756 dbSNP
rs1368525657 764 dbSNP
rs1312448631 771 dbSNP
rs1165726996 773 dbSNP
rs1467968993 784 dbSNP
rs1411954534 785 dbSNP
rs990407887 795 dbSNP
rs1332667776 811 dbSNP
rs1273499520 817 dbSNP
rs1382754354 817 dbSNP
rs1225662923 822 dbSNP
rs937559398 829 dbSNP
rs1340503456 839 dbSNP
rs1300194667 843 dbSNP
rs927552543 854 dbSNP
rs981383829 870 dbSNP
rs879697511 873 dbSNP
rs765267766 896 dbSNP
rs1268584857 900 dbSNP
rs1301222379 901 dbSNP
rs543218384 902 dbSNP
rs1199078184 910 dbSNP
rs1262251902 915 dbSNP
rs186169175 933 dbSNP
rs573066313 946 dbSNP
rs983981409 947 dbSNP
rs1427347857 976 dbSNP
rs1376104293 979 dbSNP
rs1190606385 985 dbSNP
rs1215020409 985 dbSNP
rs1374396194 994 dbSNP
rs1326410896 1000 dbSNP
rs1171893688 1006 dbSNP
rs1168213352 1010 dbSNP
rs1339195749 1018 dbSNP
rs1427990594 1018 dbSNP
rs1049467029 1028 dbSNP
rs140237232 1031 dbSNP
rs61833175 1047 dbSNP
rs1170862716 1050 dbSNP
rs914377541 1053 dbSNP
rs1027869355 1059 dbSNP
rs543442802 1060 dbSNP
rs1267121935 1069 dbSNP
rs900399497 1074 dbSNP
rs1018883443 1078 dbSNP
rs1256465719 1079 dbSNP
rs796769872 1089 dbSNP
rs1202897170 1092 dbSNP
rs1485723966 1102 dbSNP
rs1250356926 1114 dbSNP
rs1263193311 1118 dbSNP
rs1202598712 1123 dbSNP
rs982118932 1126 dbSNP
rs1253512958 1127 dbSNP
rs3203274 1128 dbSNP
rs1228588040 1135 dbSNP
rs1008552448 1138 dbSNP
rs1429036789 1141 dbSNP
rs1178903910 1169 dbSNP
rs1479630285 1169 dbSNP
rs759359511 1169 dbSNP
rs1311248832 1194 dbSNP
rs749778855 1222 dbSNP
rs1362532336 1232 dbSNP
rs1023763028 1238 dbSNP
rs1012328485 1240 dbSNP
rs1343433681 1261 dbSNP
rs1406500440 1265 dbSNP
rs952883970 1275 dbSNP
rs1230478175 1276 dbSNP
rs1042135029 1279 dbSNP
rs1236778952 1282 dbSNP
rs577707263 1285 dbSNP
rs1011105298 1289 dbSNP
rs1262046948 1294 dbSNP
rs1353719665 1297 dbSNP
rs1221302749 1304 dbSNP
rs1266270724 1308 dbSNP
rs893562967 1309 dbSNP
rs1054513062 1317 dbSNP
rs1489972217 1318 dbSNP
rs937528426 1324 dbSNP
rs1268427952 1329 dbSNP
rs1419012232 1332 dbSNP
rs67027895 1335 dbSNP
rs1382313582 1339 dbSNP
rs897413467 1355 dbSNP
rs1045986906 1358 dbSNP
rs950053385 1363 dbSNP
rs1363980435 1369 dbSNP
rs1459594239 1378 dbSNP
rs1372619290 1380 dbSNP
rs1336764240 1389 dbSNP
rs534699374 1390 dbSNP
rs1389666971 1398 dbSNP
rs1309037486 1400 dbSNP
rs145484972 1401 dbSNP
rs375448036 1406 dbSNP
rs952189374 1407 dbSNP
rs1049497484 1411 dbSNP
rs920711650 1422 dbSNP
rs1221765227 1425 dbSNP
rs1266473229 1431 dbSNP
rs1480504710 1439 dbSNP
rs1176036561 1442 dbSNP
rs1240538947 1457 dbSNP
rs892863168 1465 dbSNP
rs1183089445 1467 dbSNP
rs75599485 1475 dbSNP
rs1383398391 1476 dbSNP
rs974547357 1482 dbSNP
rs1165742475 1501 dbSNP
rs76423396 1502 dbSNP
rs70961725 1503 dbSNP
rs1333325524 1506 dbSNP
rs756210255 1506 dbSNP
rs752703071 1508 dbSNP
rs767739715 1509 dbSNP
rs966393400 1522 dbSNP
rs537607617 1523 dbSNP
rs916570552 1524 dbSNP
rs1250755950 1526 dbSNP
rs1294383045 1529 dbSNP
rs1307327456 1533 dbSNP
rs1260342645 1534 dbSNP
rs990924188 1534 dbSNP
rs748569248 1536 dbSNP
rs755143860 1538 dbSNP
rs1203512432 1540 dbSNP
rs1241431182 1541 dbSNP
rs1010573607 1546 dbSNP
rs893523057 1547 dbSNP
rs1488372110 1555 dbSNP
rs765857745 1564 dbSNP
rs1263976777 1566 dbSNP
rs952923823 1573 dbSNP
rs1172579058 1574 dbSNP
rs370465013 1575 dbSNP
rs1027041337 1579 dbSNP
rs1469290486 1582 dbSNP
rs1216170036 1588 dbSNP
rs750247763 1590 dbSNP
rs115740111 1593 dbSNP
rs1448086069 1596 dbSNP
rs1287741671 1599 dbSNP
rs1359458711 1600 dbSNP
rs775629461 1601 dbSNP
rs1020320237 1610 dbSNP
rs1280494207 1626 dbSNP
rs1287863403 1627 dbSNP
rs2275521 1633 dbSNP
rs1223501911 1637 dbSNP
rs571599853 1642 dbSNP
rs1277092067 1646 dbSNP
rs1444234961 1661 dbSNP
rs889473689 1669 dbSNP
rs1241537947 1678 dbSNP
rs1352368862 1681 dbSNP
rs950315979 1683 dbSNP
rs1307999768 1684 dbSNP
rs765048740 1708 dbSNP
rs1386367714 1715 dbSNP
rs1388319009 1718 dbSNP
rs376781950 1720 dbSNP
rs1048170948 1722 dbSNP
rs1011170037 1729 dbSNP
rs1427221116 1730 dbSNP
rs1157751109 1732 dbSNP
rs529091593 1733 dbSNP
rs1461952257 1739 dbSNP
rs1387795611 1749 dbSNP
rs551610301 1750 dbSNP
rs1052835521 1753 dbSNP
rs1458389623 1754 dbSNP
rs1404683461 1756 dbSNP
rs761715712 1757 dbSNP
rs183400807 1758 dbSNP
rs907025612 1759 dbSNP
rs559552412 1760 dbSNP
rs911763765 1761 dbSNP
rs549605049 1767 dbSNP
rs1195867554 1770 dbSNP
rs1469336282 1784 dbSNP
rs1219137110 1785 dbSNP
rs763872282 1791 dbSNP
rs1264135287 1795 dbSNP
rs1490236721 1797 dbSNP
rs1268083712 1805 dbSNP
rs948597839 1808 dbSNP
rs760118113 1809 dbSNP
rs1261314314 1815 dbSNP
rs915805696 1821 dbSNP
rs966990985 1826 dbSNP
rs760274781 1827 dbSNP
rs920007017 1828 dbSNP
rs1010960837 1830 dbSNP
rs957750741 1834 dbSNP
rs1321999037 1836 dbSNP
rs972839248 1843 dbSNP
rs1437885496 1845 dbSNP
rs961874247 1846 dbSNP
rs1019722598 1855 dbSNP
rs34770086 1857 dbSNP
rs538216688 1857 dbSNP
rs954308013 1858 dbSNP
rs529465390 1868 dbSNP
rs1359013627 1874 dbSNP
rs557453245 1875 dbSNP
rs1291845286 1885 dbSNP
rs1001942208 1887 dbSNP
rs151083954 1890 dbSNP
rs1441422963 1892 dbSNP
rs1178734677 1894 dbSNP
rs1024387221 1897 dbSNP
rs1384013988 1908 dbSNP
rs1014440470 1915 dbSNP
rs1164628235 1918 dbSNP
rs771886035 1920 dbSNP
rs1406291507 1923 dbSNP
rs1173828067 1924 dbSNP
rs1031874058 1927 dbSNP
rs577602285 1928 dbSNP
rs1310088856 1936 dbSNP
rs1048002666 1939 dbSNP
rs1242958651 1949 dbSNP
rs1386521534 1951 dbSNP
rs1247730418 1960 dbSNP
rs113768661 1964 dbSNP
rs540642563 1970 dbSNP
rs1459040889 1973 dbSNP
rs35197966 1974 dbSNP
rs774630157 1979 dbSNP
rs899206795 1980 dbSNP
rs1039130545 1982 dbSNP
rs1440179502 1990 dbSNP
rs1368718366 2000 dbSNP
rs943401551 2002 dbSNP
rs911983788 2009 dbSNP
rs1048967642 2021 dbSNP
rs1343191990 2025 dbSNP
rs931345244 2031 dbSNP
rs531329460 2032 dbSNP
rs1235236934 2039 dbSNP
rs1405500662 2040 dbSNP
rs555005002 2044 dbSNP
rs535312241 2047 dbSNP
rs1341217197 2048 dbSNP
rs1295045969 2051 dbSNP
rs190950461 2063 dbSNP
rs564075522 2070 dbSNP
rs1319725831 2071 dbSNP
rs769595591 2072 dbSNP
rs1219229659 2077 dbSNP
rs940139371 2086 dbSNP
rs1195367631 2089 dbSNP
rs539325565 2095 dbSNP
rs1342740113 2096 dbSNP
rs1201699907 2097 dbSNP
rs912618614 2104 dbSNP
rs570624987 2111 dbSNP
rs1403652890 2118 dbSNP
rs954174200 2119 dbSNP
rs957934327 2123 dbSNP
rs552114137 2124 dbSNP
rs957290949 2127 dbSNP
rs1033272588 2131 dbSNP
rs1428630621 2132 dbSNP
rs1174400605 2138 dbSNP
rs551766297 2146 dbSNP
rs185750644 2147 dbSNP
rs1296562122 2148 dbSNP
rs1400420569 2148 dbSNP
rs879188187 2148 dbSNP
rs1167089121 2150 dbSNP
rs1476703583 2151 dbSNP
rs1374113481 2153 dbSNP
rs970426157 2157 dbSNP
rs1282348218 2158 dbSNP
rs1310383772 2160 dbSNP
rs1235239765 2184 dbSNP
rs1024690912 2186 dbSNP
rs1349316122 2187 dbSNP
rs1463199083 2187 dbSNP
rs1440793926 2189 dbSNP
rs760538042 2191 dbSNP
rs372540763 2197 dbSNP
rs1024026532 2199 dbSNP
rs1014821867 2201 dbSNP
rs7521027 2215 dbSNP
rs1026982631 2218 dbSNP
rs1482843517 2231 dbSNP
rs1272269709 2242 dbSNP
rs1156890157 2243 dbSNP
rs748250019 2246 dbSNP
rs995135617 2258 dbSNP
rs1420478794 2267 dbSNP
rs145577971 2270 dbSNP
rs1365220529 2278 dbSNP
rs181761083 2281 dbSNP
rs781207359 2286 dbSNP
rs1049484119 2293 dbSNP
rs1334700991 2297 dbSNP
rs943370382 2298 dbSNP
rs1237361055 2300 dbSNP
rs890516916 2303 dbSNP
rs1051885780 2304 dbSNP
rs563859604 2310 dbSNP
rs897712672 2319 dbSNP
rs1037049717 2320 dbSNP
rs189812314 2321 dbSNP
rs1265291289 2333 dbSNP
rs1356817937 2333 dbSNP
rs755232002 2334 dbSNP
rs1408905699 2335 dbSNP
rs774370271 2350 dbSNP
rs751781333 2353 dbSNP
rs1439573646 2354 dbSNP
rs199913818 2360 dbSNP
rs932858106 2360 dbSNP
rs1327320540 2364 dbSNP
rs989726462 2365 dbSNP
rs1440621008 2372 dbSNP
rs1164330788 2377 dbSNP
rs1347954938 2377 dbSNP
rs936551997 2385 dbSNP
rs1459219786 2391 dbSNP
rs926558903 2397 dbSNP
rs990829378 2404 dbSNP
rs1444404121 2411 dbSNP
rs1332794027 2426 dbSNP
rs1376986590 2440 dbSNP
rs957660055 2443 dbSNP
rs1310102548 2446 dbSNP
rs1323108314 2449 dbSNP
rs924827846 2454 dbSNP
rs550525204 2456 dbSNP
rs545459817 2462 dbSNP
rs1397599665 2467 dbSNP
rs1457716484 2468 dbSNP
rs977120909 2470 dbSNP
rs1163205496 2473 dbSNP
rs1472059096 2475 dbSNP
rs980374243 2476 dbSNP
rs1458252935 2480 dbSNP
rs1181538431 2482 dbSNP
rs1024099545 2484 dbSNP
rs1165233838 2485 dbSNP
rs1422565264 2486 dbSNP
rs1464056549 2491 dbSNP
rs74336886 2491 dbSNP
rs958557197 2503 dbSNP
rs1300519019 2504 dbSNP
rs775699655 2505 dbSNP
rs1380912475 2518 dbSNP
rs186529223 2522 dbSNP
rs982594989 2523 dbSNP
rs541031327 2525 dbSNP
rs1317669723 2531 dbSNP
rs1438192947 2534 dbSNP
rs897751198 2538 dbSNP
rs1026450369 2546 dbSNP
rs1208058790 2551 dbSNP
rs1319162196 2552 dbSNP
rs1015217845 2556 dbSNP
rs1235748976 2565 dbSNP
rs1484362042 2567 dbSNP
rs995419177 2571 dbSNP
rs1293429383 2572 dbSNP
rs139937615 2573 dbSNP
rs1172505316 2579 dbSNP
rs572054039 2580 dbSNP
rs1424277523 2588 dbSNP
rs765011290 2595 dbSNP
rs1413784532 2601 dbSNP
rs1173355042 2608 dbSNP
rs1348049581 2609 dbSNP
rs1360385412 2614 dbSNP
rs1466284310 2615 dbSNP
rs891121367 2615 dbSNP
rs1340343316 2627 dbSNP
rs1442411108 2629 dbSNP
rs1051153913 2630 dbSNP
rs1280434602 2637 dbSNP
rs1363284187 2646 dbSNP
rs1219086451 2656 dbSNP
rs1276667311 2660 dbSNP
rs1314007332 2664 dbSNP
rs561486286 2668 dbSNP
rs1017884421 2677 dbSNP
rs899901913 2679 dbSNP
rs554033053 2690 dbSNP
rs1460381259 2693 dbSNP
rs1263555043 2727 dbSNP
rs541508475 2736 dbSNP
rs756503106 2743 dbSNP
rs545521169 2744 dbSNP
rs1426721600 2745 dbSNP
rs575858335 2747 dbSNP
rs764115509 2751 dbSNP
rs924889942 2757 dbSNP
rs1157489138 2764 dbSNP
rs978073862 2770 dbSNP
rs949732963 2778 dbSNP
rs1300437640 2780 dbSNP
rs115052218 2784 dbSNP
rs1273557867 2790 dbSNP
rs1369864530 2791 dbSNP
rs1235149756 2803 dbSNP
rs1009620218 2806 dbSNP
rs892546487 2810 dbSNP
rs1351793191 2816 dbSNP
rs1219071394 2822 dbSNP
rs1053601523 2836 dbSNP
rs1179170545 2837 dbSNP
rs760654508 2845 dbSNP
rs936520749 2847 dbSNP
rs1027784964 2849 dbSNP
rs926527724 2850 dbSNP
rs1044982150 2851 dbSNP
rs1478286490 2853 dbSNP
rs973264951 2868 dbSNP
rs1377875470 2871 dbSNP
rs962185570 2880 dbSNP
rs1245967089 2882 dbSNP
rs1196455927 2883 dbSNP
rs1469800192 2885 dbSNP
rs1273775177 2888 dbSNP
rs1014878701 2889 dbSNP
rs1409233206 2897 dbSNP
rs1405103967 2899 dbSNP
rs949055977 2904 dbSNP
rs1321940962 2906 dbSNP
rs1352137713 2910 dbSNP
rs917627177 2915 dbSNP
rs920866433 2928 dbSNP
rs1232597660 2930 dbSNP
rs1374750026 2937 dbSNP
rs1242648412 2938 dbSNP
rs111693173 2940 dbSNP
rs542125133 2944 dbSNP
rs1355860322 2946 dbSNP
rs1285666142 2950 dbSNP
rs574643961 2964 dbSNP
rs1029634648 2972 dbSNP
rs1274674017 2978 dbSNP
rs1235889499 2985 dbSNP
rs759317449 2990 dbSNP
rs1458695584 2991 dbSNP
rs1182123599 3005 dbSNP
rs1367561227 3011 dbSNP
rs919690094 3012 dbSNP
rs1304872234 3018 dbSNP
rs1462486165 3018 dbSNP
rs553734288 3018 dbSNP
rs1170566302 3026 dbSNP
rs973540510 3029 dbSNP
rs1449131157 3031 dbSNP
rs1329569470 3039 dbSNP
rs774045853 3049 dbSNP
rs1340108680 3064 dbSNP
rs1446005420 3066 dbSNP
rs1373583871 3072 dbSNP
rs1285803641 3077 dbSNP
rs1335222125 3080 dbSNP
rs963569199 3090 dbSNP
rs899921076 3091 dbSNP
rs1017851868 3097 dbSNP
rs1319857959 3098 dbSNP
rs1007848720 3103 dbSNP
rs1434921223 3107 dbSNP
rs955136499 3108 dbSNP
rs1189178281 3112 dbSNP
rs936221260 3117 dbSNP
rs1161358997 3127 dbSNP
rs1030292564 3131 dbSNP
rs1475722046 3134 dbSNP
rs903341232 3135 dbSNP
rs371101051 3142 dbSNP
rs1467592025 3143 dbSNP
rs1401577663 3146 dbSNP
rs527566262 3146 dbSNP
rs892520808 3159 dbSNP
rs1455442111 3174 dbSNP
rs1055406836 3175 dbSNP
rs1336376712 3198 dbSNP
rs1253337431 3213 dbSNP
rs565928779 3214 dbSNP
rs1187860051 3219 dbSNP
rs1463487117 3225 dbSNP
rs1243405752 3227 dbSNP
rs147485107 3232 dbSNP
rs1000634158 3233 dbSNP
rs144570659 3234 dbSNP
rs1235965232 3235 dbSNP
rs1350504597 3236 dbSNP
rs1044955892 3241 dbSNP
rs949272739 3246 dbSNP
rs1304615592 3267 dbSNP
rs1228382718 3279 dbSNP
rs917830993 3284 dbSNP
rs1194500520 3296 dbSNP
rs188429522 3298 dbSNP
rs763385760 3299 dbSNP
rs556358888 3302 dbSNP
rs1376312333 3312 dbSNP
rs55666313 3318 dbSNP
rs1419264244 3324 dbSNP
rs546800010 3330 dbSNP
rs987239709 3330 dbSNP
rs954637664 3347 dbSNP
rs1058413 3351 dbSNP
rs773400350 3355 dbSNP
rs4282803 3356 dbSNP
rs1046705239 3358 dbSNP
rs1363204527 3364 dbSNP
rs1234812295 3375 dbSNP
rs747431119 3382 dbSNP
rs1303427833 3390 dbSNP
rs1028830740 3393 dbSNP
rs929645939 3394 dbSNP
rs1487040730 3395 dbSNP
rs1311311542 3397 dbSNP
rs1206282448 3403 dbSNP
rs919674121 3416 dbSNP
rs770316522 3424 dbSNP
rs1395693309 3429 dbSNP
rs963536716 3440 dbSNP
rs883582 3448 dbSNP
rs1365367456 3450 dbSNP
rs1454149053 3451 dbSNP
rs1292683101 3453 dbSNP
rs113989963 3455 dbSNP
rs1442931227 3458 dbSNP
rs954959762 3473 dbSNP
rs1237566929 3474 dbSNP
rs1186983708 3475 dbSNP
rs1317712531 3477 dbSNP
rs1240235988 3479 dbSNP
rs1482650719 3481 dbSNP
rs1254687629 3485 dbSNP
rs1212654653 3486 dbSNP
rs748622052 3488 dbSNP
rs1216084674 3491 dbSNP
rs183861885 3497 dbSNP
rs1457348321 3498 dbSNP
rs1031012840 3501 dbSNP
rs1252961369 3504 dbSNP
rs1419838168 3505 dbSNP
rs1281550685 3508 dbSNP
rs896073432 3510 dbSNP
rs1463000008 3515 dbSNP
rs1204845187 3519 dbSNP
rs1165529747 3528 dbSNP
rs747020584 3535 dbSNP
rs1443970238 3539 dbSNP
rs538301014 3540 dbSNP
rs1373623366 3541 dbSNP
rs1395021054 3543 dbSNP
rs1312542883 3545 dbSNP
rs1320270634 3550 dbSNP
rs1215613765 3566 dbSNP
rs1378543640 3577 dbSNP
rs778161726 3580 dbSNP
rs1274386247 3584 dbSNP
rs527315754 3585 dbSNP
rs1291506576 3608 dbSNP
rs1416920067 3615 dbSNP
rs937058305 3616 dbSNP
rs1196850201 3623 dbSNP
rs1032383625 3626 dbSNP
rs1253086875 3626 dbSNP
rs16356 3626 dbSNP
rs397831754 3626 dbSNP
rs368033370 3628 dbSNP
rs1460294290 3630 dbSNP
rs1037481653 3633 dbSNP
rs1188337459 3649 dbSNP
rs905296382 3650 dbSNP
rs372382366 3651 dbSNP
rs561325233 3651 dbSNP
rs907598981 3651 dbSNP
rs541396136 3653 dbSNP
rs987271306 3653 dbSNP
rs1356001863 3661 dbSNP
rs1171065227 3670 dbSNP
rs537527172 3673 dbSNP
rs1417033743 3688 dbSNP
rs974621882 3689 dbSNP
rs192437955 3690 dbSNP
rs1297894167 3692 dbSNP
rs1058304 3694 dbSNP
rs1209728726 3702 dbSNP
rs780337464 3704 dbSNP
rs1250658959 3711 dbSNP
rs898195788 3712 dbSNP
rs1262118660 3720 dbSNP
rs75847692 3731 dbSNP
rs1395427501 3732 dbSNP
rs189486611 3738 dbSNP
rs184373409 3739 dbSNP
rs1432126102 3741 dbSNP
rs1173282671 3743 dbSNP
rs895981445 3756 dbSNP
rs1434883292 3761 dbSNP
rs1313945809 3765 dbSNP
rs1056089607 3769 dbSNP
rs1002177974 3771 dbSNP
rs986269094 3781 dbSNP
rs1205913121 3787 dbSNP
rs572502589 3790 dbSNP
rs1301267573 3796 dbSNP
rs933511599 3799 dbSNP
rs1350328880 3800 dbSNP
rs370563834 3801 dbSNP
rs1285111209 3807 dbSNP
rs535815351 3808 dbSNP
rs547675480 3817 dbSNP
rs1217631378 3818 dbSNP
rs1242656316 3818 dbSNP
rs907631466 3818 dbSNP
rs192979757 3825 dbSNP
rs373176480 3827 dbSNP
rs767170769 3835 dbSNP
rs1356114342 3837 dbSNP
rs756172746 3838 dbSNP
rs1399350015 3844 dbSNP
rs556335908 3848 dbSNP
rs933188304 3850 dbSNP
rs979406368 3879 dbSNP
rs188241383 3880 dbSNP
rs1023689924 3884 dbSNP
rs1013408640 3885 dbSNP
rs896334913 3887 dbSNP
rs974710553 3895 dbSNP
rs1166956900 3896 dbSNP
rs1461531817 3900 dbSNP
rs1348748650 3906 dbSNP
rs1058305 3909 dbSNP
rs1284616908 3920 dbSNP
rs1321121961 3930 dbSNP
rs994526099 3935 dbSNP
rs1211731764 3936 dbSNP
rs113544916 3937 dbSNP
rs763016492 3938 dbSNP
rs979174570 3938 dbSNP
rs1177422497 3939 dbSNP
rs1253177223 3940 dbSNP
rs750973612 3941 dbSNP
rs1020416150 3943 dbSNP
rs1160660324 3948 dbSNP
rs534852128 3949 dbSNP
rs766074349 3961 dbSNP
rs1163373060 3963 dbSNP
rs1397276717 3964 dbSNP
rs550016430 3966 dbSNP
rs1330692618 3967 dbSNP
rs1335551710 3970 dbSNP
rs1334209714 3972 dbSNP
rs1448183974 3973 dbSNP
rs1378147453 3978 dbSNP
rs149318674 3988 dbSNP
rs531561178 3989 dbSNP
rs1335338902 3993 dbSNP
rs933500303 3995 dbSNP
rs923465631 3996 dbSNP
rs1237224190 3998 dbSNP
rs988332662 4004 dbSNP
rs138661915 4005 dbSNP
rs1307488362 4007 dbSNP
rs1439260858 4008 dbSNP
rs1386036545 4009 dbSNP
rs548162696 4011 dbSNP
rs925558493 4014 dbSNP
rs568378973 4015 dbSNP
rs1420672289 4023 dbSNP
rs547790258 4030 dbSNP
rs1462363291 4034 dbSNP
rs1170147931 4035 dbSNP
rs979374963 4035 dbSNP
rs1051486828 4042 dbSNP
rs969389953 4043 dbSNP
rs1387364696 4046 dbSNP
rs1329757916 4061 dbSNP
rs1358757515 4062 dbSNP
rs933052466 4066 dbSNP
rs1156291522 4081 dbSNP
rs1455068642 4088 dbSNP
rs1485574537 4089 dbSNP
rs1217930550 4095 dbSNP
rs531160211 4096 dbSNP
rs1196055630 4097 dbSNP
rs562287245 4101 dbSNP
rs916646835 4103 dbSNP
rs1454116405 4106 dbSNP
rs1209183726 4107 dbSNP
rs1260046823 4109 dbSNP
rs1475855818 4111 dbSNP
rs992692036 4117 dbSNP
rs936479379 4124 dbSNP
rs925231629 4128 dbSNP
rs978027490 4130 dbSNP
rs1401783377 4133 dbSNP
rs1433018011 4137 dbSNP
rs946060746 4141 dbSNP
rs1399381187 4143 dbSNP
rs183108225 4143 dbSNP
rs1261183695 4144 dbSNP
rs1316094166 4145 dbSNP
rs1203429346 4146 dbSNP
rs762363178 4147 dbSNP
rs1025859862 4148 dbSNP
rs1486865081 4148 dbSNP
rs1227539101 4149 dbSNP
rs529724119 4150 dbSNP
rs1233774764 4152 dbSNP
rs1345378579 4152 dbSNP
rs1282978924 4153 dbSNP
rs1345478688 4154 dbSNP
rs1486187057 4154 dbSNP
rs994033975 4155 dbSNP
rs776940854 4156 dbSNP
rs960127861 4160 dbSNP
rs1034401690 4161 dbSNP
rs1325763963 4162 dbSNP
rs1315662294 4163 dbSNP
rs962590503 4164 dbSNP
rs1016889684 4166 dbSNP
rs1028556325 4171 dbSNP
rs1006542047 4181 dbSNP
rs889493917 4185 dbSNP
rs532373474 4190 dbSNP
rs1452828516 4192 dbSNP
rs1301898916 4201 dbSNP
rs1387056421 4210 dbSNP
rs1050855162 4217 dbSNP
rs998307958 4223 dbSNP
rs1432470625 4226 dbSNP
rs1368127046 4240 dbSNP
rs980677697 4240 dbSNP
rs1352469196 4244 dbSNP
rs963573860 4248 dbSNP
rs1259260908 4254 dbSNP
rs1353550132 4255 dbSNP
rs1016961195 4261 dbSNP
rs1252502388 4267 dbSNP
rs1393715712 4271 dbSNP
rs775991264 4274 dbSNP
rs1053012192 4278 dbSNP
rs935516711 4280 dbSNP
rs560069415 4282 dbSNP
rs1455115035 4289 dbSNP
rs1156750207 4290 dbSNP
rs1365312489 4294 dbSNP
rs1454293356 4294 dbSNP
rs1029971897 4297 dbSNP
rs1392153151 4298 dbSNP
rs1462585708 4307 dbSNP
rs1325922103 4312 dbSNP
rs1372159642 4314 dbSNP
rs1389315197 4319 dbSNP
rs1305383017 4333 dbSNP
rs1337880545 4336 dbSNP
rs1240438199 4338 dbSNP
rs997110393 4339 dbSNP
rs900263514 4341 dbSNP
rs1038780959 4342 dbSNP
rs925527371 4352 dbSNP
rs1191601036 4355 dbSNP
rs1273884142 4355 dbSNP
rs1430397633 4357 dbSNP
rs1175679506 4358 dbSNP
rs1252458927 4358 dbSNP
rs1419489472 4362 dbSNP
rs1186902375 4376 dbSNP
rs1262437647 4377 dbSNP
rs936536092 4377 dbSNP
rs1476106706 4382 dbSNP
rs1165093808 4383 dbSNP
rs1353398717 4385 dbSNP
rs562536728 4385 dbSNP
rs60418621 4387 dbSNP
rs1282268528 4389 dbSNP
rs549248513 4390 dbSNP
rs575280622 4391 dbSNP
rs917813953 4398 dbSNP
rs1057165113 4400 dbSNP
rs1268369261 4406 dbSNP
rs1294038911 4411 dbSNP
rs1306963771 4424 dbSNP
rs1202481329 4430 dbSNP
rs916615487 4435 dbSNP
rs1481051388 4436 dbSNP
rs1209891768 4437 dbSNP
rs1255125070 4442 dbSNP
rs992180505 4443 dbSNP
rs1486643875 4444 dbSNP
rs1418215747 4445 dbSNP
rs938622698 4446 dbSNP
rs1171843456 4448 dbSNP
rs961052137 4452 dbSNP
rs72759895 4453 dbSNP
rs1433711432 4455 dbSNP
rs769095830 4456 dbSNP
rs980201901 4457 dbSNP
rs1417207304 4461 dbSNP
rs1303967558 4466 dbSNP
rs1412592943 4466 dbSNP
rs1376862451 4467 dbSNP
rs1212899224 4468 dbSNP
rs1313065334 4472 dbSNP
rs963908607 4473 dbSNP
rs192666357 4474 dbSNP
rs1277980232 4477 dbSNP
rs1396150550 4477 dbSNP
rs1166669627 4479 dbSNP
rs1463976647 4480 dbSNP
rs1373777268 4487 dbSNP
rs1187284063 4492 dbSNP
rs576502470 4496 dbSNP
rs1486510506 4499 dbSNP
rs76260670 4505 dbSNP
rs1474374734 4508 dbSNP
rs909362925 4510 dbSNP
rs1484819481 4527 dbSNP
rs1187767404 4529 dbSNP
rs1261800182 4535 dbSNP
rs962559726 4548 dbSNP
rs1437033558 4552 dbSNP
rs1171329763 4554 dbSNP
rs1396470307 4557 dbSNP
rs1436998882 4557 dbSNP
rs1177171041 4568 dbSNP
rs1016857367 4569 dbSNP
rs1006844740 4581 dbSNP
rs1290764751 4585 dbSNP
rs556652272 4588 dbSNP
rs1440492061 4589 dbSNP
rs1301562311 4593 dbSNP
rs1350260412 4600 dbSNP
rs953949832 4601 dbSNP
rs1197539896 4604 dbSNP
rs199934849 4607 dbSNP
rs372828319 4608 dbSNP
rs1339965596 4609 dbSNP
rs1260846031 4616 dbSNP
rs113626297 4617 dbSNP
rs997177765 4617 dbSNP
rs1228280648 4629 dbSNP
rs1254510194 4637 dbSNP
rs1017801475 4638 dbSNP
rs370859816 4640 dbSNP
rs1000603825 4642 dbSNP
rs759924823 4643 dbSNP
rs1389964673 4646 dbSNP
rs1029701362 4647 dbSNP
rs1323903680 4655 dbSNP
rs997881994 4656 dbSNP
rs903578164 4657 dbSNP
rs14403 4658 dbSNP
rs1370870336 4659 dbSNP
rs577238555 4659 dbSNP
rs1268719240 4665 dbSNP
rs999631155 4669 dbSNP
rs896403435 4670 dbSNP
rs1211286475 4673 dbSNP
rs1274505897 4674 dbSNP
rs1401626482 4674 dbSNP
rs1164789642 4675 dbSNP
rs1232701100 4676 dbSNP
rs1459965105 4676 dbSNP
rs370653813 4680 dbSNP
rs1468951987 4681 dbSNP
rs1420044047 4684 dbSNP
rs1475128558 4685 dbSNP
rs1166008434 4687 dbSNP
rs527249482 4689 dbSNP
rs756915501 4689 dbSNP
rs1328473238 4693 dbSNP
rs1469803127 4707 dbSNP
rs1288679398 4709 dbSNP
rs540512970 4709 dbSNP
rs1354820509 4711 dbSNP
rs1231369323 4714 dbSNP
rs904071061 4715 dbSNP
rs1043949041 4717 dbSNP
rs554085662 4722 dbSNP
rs1213432509 4725 dbSNP
rs1270472316 4727 dbSNP
rs1439131731 4730 dbSNP
rs1207745615 4733 dbSNP
rs1183676529 4735 dbSNP
rs1485664240 4737 dbSNP
rs1186387520 4739 dbSNP
rs1044897924 4741 dbSNP
rs1167350299 4742 dbSNP
rs1473180513 4742 dbSNP
rs1252321379 4743 dbSNP
rs1417645857 4747 dbSNP
rs1211678191 4748 dbSNP
rs1308474091 4759 dbSNP
rs1336311216 4765 dbSNP
rs1412897308 4766 dbSNP
rs779958646 4769 dbSNP
rs534084821 4770 dbSNP
rs1226073841 4772 dbSNP
rs1340937370 4772 dbSNP
rs1222912203 4773 dbSNP
rs1228664980 4778 dbSNP
rs1341117484 4778 dbSNP
rs916856567 4779 dbSNP
rs942144315 4779 dbSNP
rs1347652738 4783 dbSNP
rs1056838866 4792 dbSNP
rs1348074499 4798 dbSNP
rs1278186205 4799 dbSNP
rs909259039 4799 dbSNP
rs1444859766 4800 dbSNP
rs939394966 4806 dbSNP
rs918647314 4810 dbSNP
rs1378050626 4811 dbSNP
rs1192653237 4814 dbSNP
rs972880051 4816 dbSNP
rs1240421460 4822 dbSNP
rs941164306 4825 dbSNP
rs909680563 4826 dbSNP
rs568415808 4827 dbSNP
rs559718404 4835 dbSNP
rs1402825878 4837 dbSNP
rs1381575376 4842 dbSNP
rs1400381198 4842 dbSNP
rs1327655676 4848 dbSNP
rs1435141708 4849 dbSNP
rs953922505 4852 dbSNP
rs374751487 4853 dbSNP
rs1029596135 4854 dbSNP
rs1258132776 4861 dbSNP
rs1440090905 4866 dbSNP
rs1205041176 4876 dbSNP
rs1282301712 4877 dbSNP
rs976813735 4877 dbSNP
rs1191746044 4881 dbSNP
rs371717791 4882 dbSNP
rs1253140296 4883 dbSNP
rs955757904 4886 dbSNP
rs1200816999 4888 dbSNP
rs761918810 4890 dbSNP
rs964754653 4890 dbSNP
rs1156773557 4891 dbSNP
rs1390683768 4891 dbSNP
rs186540139 4893 dbSNP
rs1457323877 4894 dbSNP
rs1324562971 4897 dbSNP
rs1368422924 4898 dbSNP
rs1017288057 4903 dbSNP
rs1444743280 4903 dbSNP
rs1225060725 4905 dbSNP
rs1314473429 4905 dbSNP
rs1000908218 4912 dbSNP
rs1331761327 4926 dbSNP
rs1209443632 4929 dbSNP
rs967829510 4936 dbSNP
rs36095248 4944 dbSNP
rs1020674617 4945 dbSNP
rs1211835921 4946 dbSNP
rs1267843297 4947 dbSNP
rs145504297 4947 dbSNP
rs71703794 4947 dbSNP
rs749837277 4947 dbSNP
rs771514140 4947 dbSNP
rs1285942888 4950 dbSNP
rs1472874039 4958 dbSNP
rs552280426 4961 dbSNP
rs777772187 4962 dbSNP
rs1293778475 4964 dbSNP
rs1391194903 4976 dbSNP
rs554842444 4976 dbSNP
rs905086063 4978 dbSNP
rs532131586 4982 dbSNP
rs1232800839 4987 dbSNP
rs1352938480 4991 dbSNP
rs1044416309 4993 dbSNP
rs542088024 4994 dbSNP
rs1332726274 5000 dbSNP
rs1022381331 5005 dbSNP
rs1266275639 5005 dbSNP
rs1480391276 5012 dbSNP
rs1193924592 5013 dbSNP
rs887870674 5015 dbSNP
rs1483368112 5017 dbSNP
rs1294585635 5018 dbSNP
rs536202149 5020 dbSNP
rs1430133638 5025 dbSNP
rs574806824 5030 dbSNP
rs923422596 5033 dbSNP
rs1460150244 5035 dbSNP
rs1012381948 5036 dbSNP
rs1167168643 5040 dbSNP
rs377238670 5041 dbSNP
rs1372776750 5043 dbSNP
rs895373921 5043 dbSNP
rs976196104 5047 dbSNP
rs943646035 5053 dbSNP
rs1343448961 5060 dbSNP
rs1377547557 5060 dbSNP
rs556470880 5063 dbSNP
rs910759822 5063 dbSNP
rs1225485986 5066 dbSNP
rs1276554210 5067 dbSNP
rs1342645320 5070 dbSNP
rs1209819384 5086 dbSNP
rs1255341596 5090 dbSNP
rs939345420 5091 dbSNP
rs549532932 5094 dbSNP
rs1420531970 5095 dbSNP
rs544459823 5096 dbSNP
rs772404544 5097 dbSNP
rs1168378349 5099 dbSNP
rs1426421676 5107 dbSNP
rs1170063712 5115 dbSNP
rs1491114544 5116 dbSNP
rs968117933 5117 dbSNP
rs1173330810 5121 dbSNP
rs1357994843 5129 dbSNP
rs774615107 5131 dbSNP
rs1303545797 5134 dbSNP
rs747882785 5152 dbSNP
rs1432934591 5154 dbSNP
rs987878432 5156 dbSNP
rs1233302598 5157 dbSNP
rs781285113 5157 dbSNP
rs577416381 5160 dbSNP
rs1491383470 5162 dbSNP
rs1034870359 5163 dbSNP
rs1491176274 5163 dbSNP
rs941385064 5164 dbSNP
rs575251064 5165 dbSNP
rs182270139 5166 dbSNP
rs985264155 5168 dbSNP
rs1453417549 5169 dbSNP
rs879828098 5171 dbSNP
rs1057515459 5177 dbSNP
rs932531158 5180 dbSNP
rs1423473844 5184 dbSNP
rs922494824 5184 dbSNP
rs1017225402 5185 dbSNP
rs1177460803 5186 dbSNP
rs1474151091 5189 dbSNP
rs754820382 5192 dbSNP
rs1322565095 5193 dbSNP
rs751110482 5203 dbSNP
rs1216151809 5205 dbSNP
rs1485125868 5213 dbSNP
rs1006255810 5223 dbSNP
rs1369428285 5227 dbSNP
rs765775428 5228 dbSNP
rs978401873 5229 dbSNP
rs1306228365 5231 dbSNP
rs1326904871 5232 dbSNP
rs1210123519 5239 dbSNP
rs1057515485 5252 dbSNP
rs1268190431 5252 dbSNP
rs1280115832 5254 dbSNP
rs3831932 5255 dbSNP
rs1211399410 5256 dbSNP
rs758117117 5256 dbSNP
rs1192075550 5261 dbSNP
rs1407904208 5262 dbSNP
rs529869615 5263 dbSNP
rs1161540311 5268 dbSNP
rs901905596 5289 dbSNP
rs1302601533 5297 dbSNP
rs1214427076 5298 dbSNP
rs1022697911 5299 dbSNP
rs1360036631 5304 dbSNP
rs1012350839 5305 dbSNP
rs1348619916 5306 dbSNP
rs910841165 5308 dbSNP
rs561213869 5309 dbSNP
rs544501776 5312 dbSNP
rs1035671456 5313 dbSNP
rs1226067360 5314 dbSNP
rs1057515424 5315 dbSNP
rs1291591480 5317 dbSNP
rs1003761778 5318 dbSNP
rs913554173 5320 dbSNP
rs1251533365 5321 dbSNP
rs960458468 5322 dbSNP
rs987784074 5322 dbSNP
rs369944084 5323 dbSNP
rs1037009232 5324 dbSNP
rs764805387 5330 dbSNP
rs372086684 5339 dbSNP
rs1169541118 5348 dbSNP
rs562761595 5357 dbSNP
rs558774589 5358 dbSNP
rs888521002 5359 dbSNP
rs762181040 5361 dbSNP
rs577274111 5365 dbSNP
rs554190542 5367 dbSNP
rs932476961 5378 dbSNP
rs1356687860 5384 dbSNP
rs369079480 5385 dbSNP
rs1274427017 5386 dbSNP
rs1340522689 5388 dbSNP
rs1041284158 5397 dbSNP
rs887001769 5400 dbSNP
rs1253184007 5402 dbSNP
rs1057515484 5403 dbSNP
rs368945100 5403 dbSNP
rs373195978 5413 dbSNP
rs1384170638 5419 dbSNP
rs1396420857 5420 dbSNP
rs1372096004 5421 dbSNP
rs1185584029 5422 dbSNP
rs1239262973 5424 dbSNP
rs1473271068 5424 dbSNP
rs763036740 5425 dbSNP
rs779134954 5427 dbSNP
rs1370704204 5429 dbSNP
rs370202653 5429 dbSNP
rs769698229 5432 dbSNP
rs934557305 5436 dbSNP
rs748705341 5437 dbSNP
rs745346608 5446 dbSNP
rs901936599 5450 dbSNP
rs534167122 5452 dbSNP
rs574680728 5453 dbSNP
rs747348160 5457 dbSNP
rs376082705 5462 dbSNP
rs758064710 5463 dbSNP
rs1268199421 5470 dbSNP
rs1474766803 5474 dbSNP
rs750000450 5478 dbSNP
rs1489827909 5480 dbSNP
rs778917211 5481 dbSNP
rs778488043 5484 dbSNP
rs368277791 5486 dbSNP
rs1370873441 5492 dbSNP
rs1275793561 5494 dbSNP
rs756661933 5495 dbSNP
rs749233183 5504 dbSNP
rs757087091 5504 dbSNP
rs777493329 5508 dbSNP
rs1281295303 5510 dbSNP
rs1304405458 5510 dbSNP
rs753870692 5513 dbSNP
rs1350739174 5514 dbSNP
rs755938534 5519 dbSNP
rs377508562 5523 dbSNP
rs760595628 5526 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Bai S; Nasser MW; Wang B; Hsu SH; Datta J; et al.
- The Journal of biological chemistry, 2009
MicroRNAs are negative regulators of protein coding genes. The liver-specific microRNA-122 (miR-122) is frequently suppressed in primary hepatocellular carcinomas (HCCs). In situ hybridization demonstrated that miR-122 is abundantly expressed in hepatocytes but barely detectable in primary human HCCs. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and SK-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice. Further, miR-122-expressing HCC cells retained an epithelial phenotype that correlated with reduced Vimentin expression. ADAM10 (a distintegrin and metalloprotease family 10), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Conversely, depletion of the endogenous miR-122 in Huh-7 cells facilitated their tumorigenic properties with concomitant up-regulation of these targets. Expression of SRF or Igf1R partially reversed tumor suppressor function of miR-122. Further, miR-122 impeded angiogenic properties of endothelial cells in vitro. Notably, ADAM10, SRF, and Igf1R were up-regulated in primary human HCCs compared with the matching liver tissue. Co-labeling studies demonstrated exclusive localization of miR-122 in the benign livers, whereas SRF predominantly expressed in HCC. More importantly, growth and clonogenic survival of miR-122-expressing HCC cells were significantly reduced upon treatment with sorafenib, a multi-kinase inhibitor clinically effective against HCC. Collectively, these results suggest that the loss of multifunctional miR-122 contributes to the malignant phenotype of HCC cells, and miR-122 mimetic alone or in combination with anticancer drugs can be a promising therapeutic regimen against liver cancer.
LinkOut: [PMID: 19726678]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research DIANAmicroT , miRanda , miRDB , TargetMiner
Original Description (Extracted from the article) ... miR-122 directly binds to the 3’UTR of hsa-AKT3. ...

- Nassirpour R; Mehta PP; Yin MJ, 2013, PloS one.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:| | |   ||||||| 
Target 5' uacACGCAAAU---ACACUCCa 3'
3 - 21
Article - Nassirpour R; Mehta PP; Yin MJ
- PloS one, 2013
MicroRNAs (miRNAs) have been implicated in the orchestration of diverse cellular processes including differentiation, proliferation, and apoptosis and are believed to play pivotal roles as oncogenes and tumor suppressors. miR-122, a liver specific miRNA, is significantly down-regulated in most hepatocellular carcinomas (HCCs) but its role in tumorigenesis remains poorly understood. Here we identify AKT3 as a novel and direct target of miR-122. Restoration of miR-122 expression in HCC cell lines decreases AKT3 levels, inhibits cell migration and proliferation, and induces apoptosis. These anti-tumor phenotypes can be rescued by reconstitution of AKT3 expression indicating the essential role of AKT3 in miR-122 mediated HCC transformation. In vivo, restoration of miR-122 completely inhibited xenograft growth of HCC tumor in mice. Our data strongly suggest that miR-122 is a tumor suppressor that targets AKT3 to regulate tumorigenesis in HCCs and a potential therapeutic candidate for liver cancer.
LinkOut: [PMID: 24244539]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.788 2.4e-6 -0.613 7.2e-4 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.536 7.4e-3 0.296 1.0e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.498 7.8e-3 -0.375 3.9e-2 23 Click to see details
GSE27834 Pluripotent stem cells 0.554 1.3e-2 0.624 4.9e-3 16 Click to see details
GSE28260 Renal cortex and medulla 0.59 1.7e-2 0.566 2.2e-2 13 Click to see details
GSE38226 Liver fibrosis -0.269 1.2e-1 -0.326 7.5e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.15 2.4e-1 -0.059 3.9e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.132 2.6e-1 0.121 2.8e-1 25 Click to see details
GSE17306 Multiple myeloma -0.081 2.9e-1 -0.055 3.5e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.078 3.4e-1 -0.010 4.8e-1 32 Click to see details
GSE19350 CNS germ cell tumors -0.122 3.5e-1 0.122 3.5e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.032 3.8e-1 0.012 4.6e-1 90 Click to see details
GSE21849 B cell lymphoma 0.053 3.9e-1 0.228 1.2e-1 29 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.139 4.0e-1 0.714 5.5e-2 6 Click to see details
GSE26953 Aortic valvular endothelial cells 0.051 4.1e-1 0.024 4.6e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.027 4.2e-1 -0.009 4.7e-1 64 Click to see details
GSE17498 Multiple myeloma -0.02 4.5e-1 -0.028 4.3e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.592 0 -0.452 0 49 Click to see details
KIRP -0.585 0.05 -0.633 0.03 9 Click to see details
STAD -0.606 0.06 -0.643 0.04 8 Click to see details
HNSC 0.94 0.11 0.500 0.33 3 Click to see details
KIRC -0.151 0.22 -0.126 0.26 29 Click to see details
KICH 0.22 0.3 0.238 0.29 8 Click to see details
CHOL 0.177 0.32 0.267 0.24 9 Click to see details
THCA 0.271 0.33 0.600 0.14 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
ESCA -0.179 0.39 -0.400 0.25 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1