-->
miRTarBase - #MIRT003110 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EGLN3   
Synonyms HIFP4H3, HIFPH3, PHD3
Description egl-9 family hypoxia inducible factor 3
Transcript NM_022073   
Expression
Putative miRNA Targets on EGLN3
3'UTR of EGLN3
(miRNA target sites are highlighted)		 
>EGLN3|NM_022073|3'UTR
   1 CCGTGCTCTGAAATCTGCTGGCCTTGTTCATTTTAGTAACGGTTCCTGAATTCTCTTAAATTCTTTGAGATCCAAAGATG
  81 GCCTCTTCAGTGACAACAATCTCCCTGCTACTTCTTGCATCCTTCACATCCCTGTCTTGTGTGTGGTACTTCATGTTTTC
 161 TTGCCAAGACTGTGTTGATCTTCAGATACTCTCTTTGCCAGATGAAGTTACTTGCTAACTCCAGAAATTCCTGCAGACAT
 241 CCTACTCGGCCAGCGGTTTACCTGATAGATTCGGTAATACTATCAAGAGAAGAGCCTAGGAGCACAGCGAGGGAATGAAC
 321 CTTACTTGCACTTTATGTATACTTCCTGATTTGAAAGGAGGAGGTTTGAAAAGAAAAAAATGGAGGTGGTAGATGCCACA
 401 GAGAGGCATCACGGAAGCCTTAACAGCAGGAAACAGAGAAATTTGTGTCATCTGAACAATTTCCAGATGTTCTTAATCCA
 481 GGGCTGTTGGGGTTTCTGGAGAATTATCACAACCTAATGACATTAATACCTCTAGAAAGGGCTGCTGTCATAGTGAACAA
 561 TTTATAAGTGTCCCATGGGGCAGACACTCCTTTTTTCCCAGTCCTGCAACCTGGATTTTCTGCCTCAGCCCCATTTTGCT
 641 GAAAATAATGACTTTCTGAATAAAGATGGCAACACAATTTTTTCTCCATTTTCAGTTCTTACCTGGGAACCTAATTCCCC
 721 AGAAGCTAAAAAACTAGACATTAGTTGTTTTGGTTGCTTTGTTGGAATGGAATTTAAATTTAAATGAAAGGAAAAATATA
 801 TCCCTGGTAGTTTTGTGTTAACCACTGATAACTGTGGAAAGAGCTAGGTCTACTGATATACAATAAACATGTGTGCATCT
 881 TGAACAATTTGAGAGGGGAGGTGGAGTTGGAAATGTGGGTGTTCCTGTTTTTTTTTTTTTTTTTTTTTTAGTTTTCCTTT
 961 TTAATGAGCTCACCCTTTAACACAAAAAAAGCAAGGTGATGTATTTTAAAAAAGGAAGTGGAAATAAAAAAATCTCAAAG
1041 CTATTTGAGTTCTCGTCTGTCCCTAGCAGTCTTTCTTCAGCTCACTTGGCTCTCTAGATCCACTGTGGTTGGCAGTATGA
1121 CCAGAATCATGGAATTTGCTAGAACTGTGGAAGCTTCTACTCCTGCAGTAAGCACAGATCGCACTGCCTCAATAACTTGG
1201 TATTGAGCACGTATTTTGCAAAAGCTACTTTTCCTAGTTTTCAGTATTACTTTCATGTTTTAAAAATCCCTTTAATTTCT
1281 TGCTTGAAAATCCCATGAACATTAAAGAGCCAGAAATATTTTCCTTTGTTATGTACGGATATATATATATATAGTCTTCC
1361 AAGATAGAAGTTTACTTTTTCCTCTTCTGGTTTTGGAAAATTTCCAGATAAGACATGTCACCATTAATTCTCAACGACTG
1441 CTCTATTTTGTTGTACGGTAATAGTTATCACCTTCTAAATTACTATGTAATTTATTCACTTATTATGTTTATTGTCTTGT
1521 ATCCTTTCTCTGGAGTGTAAGCACAATGAAGACAGGAATTTTGTATATTTTTAACCAATGCAACATACTCTCAGCACCTA
1601 AAATAGTGCCGGGAACATAGTAAGGGCTCAGTAAATACTTGTTGAATAAACTCAGTCTCCTACATTAGCATTCTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1 
miRNA  3' guuuguGGUA-ACAG--UGUGAGGu 5'
                ||||  | |  ||||||| 
Target 5' agtgtcCCATGGGGCAGACACTCCt 3'
 		567 - 591 146.00 -16.80
2 
miRNA  3' guuugUGGUAAC--AGUGUGAGGu 5'
               |||| ||   ||:||||: 
Target 5' ttttaACCAATGCAACATACTCTc 3'
 		1569 - 1592 127.00 -13.20
3 
miRNA  3' guuUGUGGUA-ACAGUGUGAGGu 5'
             :|||: | ||| |:|||:| 
Target 5' cttGCACTTTATGT-ATACTTCc 3'
 		325 - 346 126.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30497502 2 COSMIC
COSN31505017 17 COSMIC
COSN30474715 29 COSMIC
COSN13582368 41 COSMIC
COSN31531632 42 COSMIC
COSN30491857 55 COSMIC
COSN31524942 63 COSMIC
COSN8588575 63 COSMIC
COSN30182938 85 COSMIC
COSN31494498 139 COSMIC
COSN27479874 177 COSMIC
COSN31532971 255 COSMIC
COSN26554263 329 COSMIC
COSN8588574 337 COSMIC
COSN28798888 364 COSMIC
COSN31534651 373 COSMIC
COSN8152031 373 COSMIC
COSN29601020 374 COSMIC
COSN31528577 444 COSMIC
COSN8588573 463 COSMIC
COSN32145189 589 COSMIC
COSN6541808 669 COSMIC
COSN8152030 733 COSMIC
COSN20111182 927 COSMIC
COSN20092822 950 COSMIC
COSN1645581 1162 COSMIC
COSN19131157 1187 COSMIC
COSN20111180 1338 COSMIC
COSN1645580 1339 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767996972 1 dbSNP
rs755475262 2 dbSNP
rs373988135 3 dbSNP
rs763205226 4 dbSNP
rs773445892 15 dbSNP
rs370966339 16 dbSNP
rs376831403 17 dbSNP
rs772104291 18 dbSNP
rs866757700 21 dbSNP
rs745778835 24 dbSNP
rs112628025 27 dbSNP
rs1369822517 28 dbSNP
rs1362113785 35 dbSNP
rs1300573900 36 dbSNP
rs1213468169 39 dbSNP
rs372424864 40 dbSNP
rs748968570 41 dbSNP
rs776134218 75 dbSNP
rs182655912 79 dbSNP
rs796878043 97 dbSNP
rs1403589788 98 dbSNP
rs1484981578 99 dbSNP
rs926072839 101 dbSNP
rs1218492754 105 dbSNP
rs772434319 106 dbSNP
rs932360599 107 dbSNP
rs1184826219 110 dbSNP
rs368936746 118 dbSNP
rs1166023273 119 dbSNP
rs1477115885 126 dbSNP
rs1033806578 130 dbSNP
rs545133077 134 dbSNP
rs1174033677 137 dbSNP
rs976520592 138 dbSNP
rs1412531344 143 dbSNP
rs746274526 145 dbSNP
rs1345678538 146 dbSNP
rs1478945645 147 dbSNP
rs906393161 153 dbSNP
rs375880842 155 dbSNP
rs1372766294 176 dbSNP
rs908242138 188 dbSNP
rs576032427 193 dbSNP
rs1303152654 195 dbSNP
rs1046670406 202 dbSNP
rs1225827715 203 dbSNP
rs1285625341 207 dbSNP
rs1680709 211 dbSNP
rs1213766104 214 dbSNP
rs867291941 223 dbSNP
rs544135217 224 dbSNP
rs1469084419 229 dbSNP
rs1193302178 237 dbSNP
rs542530721 244 dbSNP
rs897748960 247 dbSNP
rs1033901872 248 dbSNP
rs191324358 254 dbSNP
rs553715770 255 dbSNP
rs1395965815 270 dbSNP
rs1440991972 272 dbSNP
rs1324887142 273 dbSNP
rs186488657 277 dbSNP
rs571312068 280 dbSNP
rs970560505 284 dbSNP
rs1280456552 291 dbSNP
rs1050209305 294 dbSNP
rs145014332 295 dbSNP
rs770102687 296 dbSNP
rs1335627516 298 dbSNP
rs1213108561 302 dbSNP
rs1024331665 303 dbSNP
rs1320709932 307 dbSNP
rs537514175 308 dbSNP
rs1183759180 309 dbSNP
rs932800033 315 dbSNP
rs891793735 318 dbSNP
rs1469578569 321 dbSNP
rs1156931902 323 dbSNP
rs1218809322 330 dbSNP
rs1186278464 339 dbSNP
rs747741670 342 dbSNP
rs1000819593 345 dbSNP
rs1163555389 347 dbSNP
rs1388161991 355 dbSNP
rs904783837 361 dbSNP
rs1050325958 362 dbSNP
rs11156819 364 dbSNP
rs1329984321 375 dbSNP
rs1430545174 378 dbSNP
rs922792903 380 dbSNP
rs1341581810 384 dbSNP
rs145433071 386 dbSNP
rs1040814685 389 dbSNP
rs1295695914 391 dbSNP
rs1356631928 393 dbSNP
rs1468704288 395 dbSNP
rs914166987 399 dbSNP
rs1405390912 412 dbSNP
rs1263714406 413 dbSNP
rs939755732 418 dbSNP
rs989477338 426 dbSNP
rs1482647050 433 dbSNP
rs1179716988 435 dbSNP
rs1259591680 436 dbSNP
rs548982655 445 dbSNP
rs1186645430 447 dbSNP
rs908169564 449 dbSNP
rs983817966 451 dbSNP
rs952716755 469 dbSNP
rs1171509935 480 dbSNP
rs1467360897 482 dbSNP
rs181786330 486 dbSNP
rs1421812794 490 dbSNP
rs1184559209 491 dbSNP
rs1474925531 493 dbSNP
rs189113700 498 dbSNP
rs1310682475 514 dbSNP
rs1034165018 518 dbSNP
rs980686546 530 dbSNP
rs567957029 543 dbSNP
rs547715028 558 dbSNP
rs1024802558 564 dbSNP
rs1340278753 572 dbSNP
rs1202793806 576 dbSNP
rs1189480160 586 dbSNP
rs1002262435 597 dbSNP
rs1014252851 603 dbSNP
rs1485962793 607 dbSNP
rs1199856818 608 dbSNP
rs971239059 614 dbSNP
rs1193242721 615 dbSNP
rs1384373 620 dbSNP
rs1459940124 623 dbSNP
rs140432143 625 dbSNP
rs146755049 629 dbSNP
rs1769601 630 dbSNP
rs1319549960 631 dbSNP
rs750996727 638 dbSNP
rs1376382359 647 dbSNP
rs114258042 650 dbSNP
rs2383537 656 dbSNP
rs1357418799 658 dbSNP
rs1382897220 669 dbSNP
rs1286355558 676 dbSNP
rs904545717 677 dbSNP
rs1236692502 679 dbSNP
rs1304419559 682 dbSNP
rs1384374 684 dbSNP
rs1451040050 685 dbSNP
rs1005824867 688 dbSNP
rs1384375 698 dbSNP
rs1049995193 706 dbSNP
rs997135326 717 dbSNP
rs137932091 723 dbSNP
rs758809423 728 dbSNP
rs1486778787 734 dbSNP
rs901303757 738 dbSNP
rs766391616 739 dbSNP
rs562578943 741 dbSNP
rs1169921793 742 dbSNP
rs758303769 743 dbSNP
rs542592564 747 dbSNP
rs1463277750 752 dbSNP
rs1406200653 753 dbSNP
rs368660826 757 dbSNP
rs185886948 761 dbSNP
rs1433010533 768 dbSNP
rs1174371866 769 dbSNP
rs1366085323 770 dbSNP
rs939722943 780 dbSNP
rs540106847 792 dbSNP
rs577787733 794 dbSNP
rs1158075614 798 dbSNP
rs557631494 814 dbSNP
rs908306224 819 dbSNP
rs1443188996 822 dbSNP
rs1326872215 823 dbSNP
rs914136556 837 dbSNP
rs989758008 842 dbSNP
rs1048644189 843 dbSNP
rs1298868178 844 dbSNP
rs1230683936 847 dbSNP
rs2383536 850 dbSNP
rs1318662016 858 dbSNP
rs1203330377 860 dbSNP
rs936917278 861 dbSNP
rs926618649 864 dbSNP
rs930983909 865 dbSNP
rs1292448158 867 dbSNP
rs1326551224 869 dbSNP
rs530518581 871 dbSNP
rs537972223 872 dbSNP
rs111465454 873 dbSNP
rs1025513121 878 dbSNP
rs555449134 885 dbSNP
rs1310708547 887 dbSNP
rs1420222131 899 dbSNP
rs1159153245 901 dbSNP
rs1242954568 905 dbSNP
rs1140252 916 dbSNP
rs949304992 921 dbSNP
rs1387435795 925 dbSNP
rs1437424659 926 dbSNP
rs922554653 927 dbSNP
rs1456521823 928 dbSNP
rs987944613 928 dbSNP
rs1291583755 932 dbSNP
rs1375330099 932 dbSNP
rs956293262 932 dbSNP
rs1391757824 933 dbSNP
rs1287692718 934 dbSNP
rs1348532554 935 dbSNP
rs971867981 938 dbSNP
rs961877217 939 dbSNP
rs1320752730 940 dbSNP
rs1422577196 949 dbSNP
rs1181880459 950 dbSNP
rs1218856110 950 dbSNP
rs1250273182 950 dbSNP
rs1252690294 950 dbSNP
rs1481185988 950 dbSNP
rs35754061 950 dbSNP
rs369526437 950 dbSNP
rs375149684 950 dbSNP
rs1491422133 951 dbSNP
rs202097635 951 dbSNP
rs1491099937 952 dbSNP
rs376575993 956 dbSNP
rs372020898 957 dbSNP
rs1307665521 958 dbSNP
rs1176177099 963 dbSNP
rs1016123574 969 dbSNP
rs535433988 974 dbSNP
rs1220704335 979 dbSNP
rs1031736976 980 dbSNP
rs1490268840 981 dbSNP
rs1287225053 983 dbSNP
rs566304448 990 dbSNP
rs1680710 994 dbSNP
rs1188337737 1005 dbSNP
rs1420521287 1010 dbSNP
rs968738798 1012 dbSNP
rs1167735109 1015 dbSNP
rs1388034044 1018 dbSNP
rs1028367001 1019 dbSNP
rs1436343143 1022 dbSNP
rs997068399 1026 dbSNP
rs901438098 1028 dbSNP
rs181758904 1035 dbSNP
rs1358479133 1040 dbSNP
rs1369983815 1041 dbSNP
rs1028620076 1043 dbSNP
rs997601889 1044 dbSNP
rs189395347 1054 dbSNP
rs139467669 1055 dbSNP
rs1235440450 1059 dbSNP
rs777492371 1066 dbSNP
rs551668649 1080 dbSNP
rs887305722 1098 dbSNP
rs892606342 1100 dbSNP
rs1218078041 1103 dbSNP
rs531722365 1108 dbSNP
rs1048136340 1122 dbSNP
rs1455263928 1124 dbSNP
rs931097450 1137 dbSNP
rs562629562 1142 dbSNP
rs1455455281 1149 dbSNP
rs1157732458 1167 dbSNP
rs936899047 1168 dbSNP
rs1433328159 1180 dbSNP
rs17101990 1181 dbSNP
rs1388805890 1182 dbSNP
rs17101989 1185 dbSNP
rs372129370 1192 dbSNP
rs917849165 1197 dbSNP
rs1479917403 1200 dbSNP
rs865994226 1201 dbSNP
rs935165470 1210 dbSNP
rs925140662 1211 dbSNP
rs1343500562 1212 dbSNP
rs949453240 1219 dbSNP
rs762037319 1223 dbSNP
rs917983292 1224 dbSNP
rs972152515 1224 dbSNP
rs1485175418 1233 dbSNP
rs1206872589 1234 dbSNP
rs1275305100 1236 dbSNP
rs560254891 1237 dbSNP
rs534510255 1244 dbSNP
rs8021588 1248 dbSNP
rs1476910629 1252 dbSNP
rs760855660 1256 dbSNP
rs1178947345 1267 dbSNP
rs953289911 1268 dbSNP
rs1456293827 1269 dbSNP
rs1156257662 1275 dbSNP
rs1396268049 1284 dbSNP
rs1029360887 1295 dbSNP
rs975429865 1296 dbSNP
rs965395084 1299 dbSNP
rs1313954647 1301 dbSNP
rs17101987 1304 dbSNP
rs80133311 1305 dbSNP
rs887281790 1307 dbSNP
rs1226681688 1309 dbSNP
rs1275052978 1311 dbSNP
rs1027571028 1329 dbSNP
rs995231855 1333 dbSNP
rs192432959 1336 dbSNP
rs778723199 1337 dbSNP
rs398118043 1339 dbSNP
rs1252480340 1343 dbSNP
rs544410891 1345 dbSNP
rs8021406 1348 dbSNP
rs1045750013 1349 dbSNP
rs1491402480 1354 dbSNP
rs35808198 1354 dbSNP
rs550805233 1354 dbSNP
rs71433636 1354 dbSNP
rs1412047956 1366 dbSNP
rs1308970802 1382 dbSNP
rs896184217 1387 dbSNP
rs1052296552 1389 dbSNP
rs1295630990 1415 dbSNP
rs1341213505 1416 dbSNP
rs917889995 1418 dbSNP
rs1282690635 1420 dbSNP
rs1036339085 1422 dbSNP
rs1466514506 1426 dbSNP
rs1407589269 1435 dbSNP
rs1482696085 1436 dbSNP
rs1173693665 1438 dbSNP
rs1468935388 1441 dbSNP
rs940740189 1446 dbSNP
rs1471532106 1450 dbSNP
rs555504526 1456 dbSNP
rs1186201533 1480 dbSNP
rs184942760 1485 dbSNP
rs572810614 1486 dbSNP
rs953375617 1487 dbSNP
rs921857311 1492 dbSNP
rs1428212442 1494 dbSNP
rs1750708 1495 dbSNP
rs1043965497 1496 dbSNP
rs1403504100 1501 dbSNP
rs772736769 1502 dbSNP
rs947471384 1503 dbSNP
rs1332232566 1507 dbSNP
rs1328431403 1525 dbSNP
rs1229342345 1539 dbSNP
rs921331226 1542 dbSNP
rs1241331739 1543 dbSNP
rs975525957 1544 dbSNP
rs1019920748 1548 dbSNP
rs1257743653 1565 dbSNP
rs1345574667 1566 dbSNP
rs1199389512 1573 dbSNP
rs1318874197 1581 dbSNP
rs569276714 1585 dbSNP
rs965364575 1588 dbSNP
rs1253384575 1602 dbSNP
rs1009913262 1610 dbSNP
rs1188877930 1611 dbSNP
rs912609124 1623 dbSNP
rs1448095587 1625 dbSNP
rs983017015 1639 dbSNP
rs1032799667 1642 dbSNP
rs746327895 1645 dbSNP
rs774865539 1651 dbSNP
rs996095069 1655 dbSNP
rs1384951350 1658 dbSNP
rs969550633 1660 dbSNP
rs1320194287 1663 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.686 1.1e-4 0.651 2.9e-4 24 Click to see details
GSE38226 Liver fibrosis -0.484 1.3e-2 -0.354 5.8e-2 21 Click to see details
GSE17306 Multiple myeloma 0.314 1.4e-2 0.456 5.0e-4 49 Click to see details
GSE21849 B cell lymphoma -0.389 1.9e-2 0.277 7.3e-2 29 Click to see details
GSE19350 CNS germ cell tumors 0.573 2.6e-2 0.587 2.2e-2 12 Click to see details
GSE21687 Ependynoma primary tumors 0.232 3.3e-2 0.171 8.8e-2 64 Click to see details
GSE27834 Pluripotent stem cells -0.452 3.9e-2 -0.429 4.9e-2 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.37 5.4e-2 0.035 4.4e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.167 5.8e-2 -0.169 5.6e-2 90 Click to see details
GSE28260 Renal cortex and medulla -0.414 8.0e-2 -0.423 7.5e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.216 1.2e-1 -0.231 1.0e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.202 1.8e-1 -0.407 2.7e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.152 2.3e-1 0.072 3.7e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.133 2.6e-1 0.024 4.5e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.327 2.6e-1 0.600 1.0e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells -0.113 3.0e-1 -0.117 2.9e-1 24 Click to see details
GSE17498 Multiple myeloma 0.049 3.8e-1 -0.181 1.3e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.414 0 -0.372 0 49 Click to see details
THCA -0.59 0.15 -0.300 0.31 5 Click to see details
HNSC 0.794 0.21 1.000 0.5 3 Click to see details
CHOL -0.267 0.24 -0.250 0.26 9 Click to see details
KIRC 0.102 0.3 0.039 0.42 29 Click to see details
KICH 0.164 0.35 -0.095 0.41 8 Click to see details
KIRP 0.093 0.41 -0.233 0.27 9 Click to see details
STAD -0.069 0.44 0.095 0.41 8 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
ESCA 0.071 0.45 0.400 0.25 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
Error report submission
MIRT ID*
Your e-Mail*
Memo*