miRTarBase - #MIRT003112 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADAM17   
Synonyms ADAM18, CD156B, CSVP, NISBD, NISBD1, TACE
Description ADAM metallopeptidase domain 17
Transcript NM_003183   
Expression
Putative miRNA Targets on ADAM17
3'UTR of ADAM17
(miRNA target sites are highlighted)
>ADAM17|NM_003183|3'UTR
   1 TTTAGTTCTCAGCTCTTCTGACTTAAGTGTGCAAAATATTTTTATAGATTTGACCTACAAATCAATCACAGCTTGTATTT
  81 TGTGAAGACTGGGAAGTGACTTAGCAGATGCTGGTCATGTGTTTGAACTTCCTGCAGGTAAACAGTTCTTGTGTGGTTTG
 161 GCCCTTCTCCTTTTGAAAAGGTAAGGTGAAGGTGAATCTAGCTTATTTTGAGGCTTTCAGGTTTTAGTTTTTAAAATATC
 241 TTTTGACCTGTGGTGCAAAAGCAGAAAATACAGCTGGATTGGGTTATGAATATTTACGTTTTTGTAAATTAATCTTTTAT
 321 ATTGATAACAGCACTGACTAGGGAAATGATCAGTTTTTTTTTATACACTGTAATGAACCGCTGAATATGAGGCATTTGGC
 401 ATTTATTTGTGATGACAACTGGAATAGTTTTTTTTTTTTTTTTTTTTTTTTGCCTTCAACTAAAAACAAAGGAGATAAAT
 481 CTAGTATACATTGTCTCTAAATTGTGGGTCTATTTCTAGTTATTACCCAGAGTTTTTATGTAGCAGGGAAAATATATATC
 561 TAAATTTAGAAATCATTTGGGTTAATATGGCTCTTCATAATTCTAAGACTAATGCTCTCTAGAAACCTAACCACCTACCT
 641 TACAGTGAGGGCTATACATGGTAGCCAGTTGAATTTATGGAATCTACCAACTGTTTAGGGCCCTGATTTGCTGGGCAGTT
 721 TTTCTGTATTTTATAAGTATCTTCATGTATCCCTGTTACTGATAGGGATACATGCTCTTAGAAAATTCACTATTGGCTGG
 801 GAGTGGTGGCTCATGCCTGTAATCCCAGCACTTGGAGAGGCTGAGGTTGCGCCACTACACTCCAGCCTGGGTGACAGAGT
 881 GAGACTCTGCCTCAAAAAAAAAAAAAAAAAAAAAAAATTCACTATCTACAAACCTAGAATATTTAAAATACAAAGATTGC
 961 CTGTTTTCAAACACTATTGAATAAGAGGGTGAGATATTTCTTAACAACAACAACAACAAAAAAAACAGGTTGTTTTGAAT
1041 GTGATGAGCCAGCCAGGAGATAGAATACTACCTGCCCTTAGGGTTGGGGGCTGTCCCCACAAGACTTGATACTTCAGAAA
1121 CCCTTTTTATTGACCCACAAGCAGATATTTGAATTACTTCTTACTTTATTGCTCCAGGATTCTGGATGGGCTGCATTTAC
1201 TGTGTGAAGGATAAAAATCATTAGCCTGGATTCTGATTTCTATAAATTGCCATTAAAAGCTTTTTTTCCCCTAAGAACTG
1281 AAATGTGCTCACCAGCCAAAACATTTTAACTTGTAAATTTTGAGGGCAGTTAACCAAACCTGTGACTAATCATATCTCCT
1361 CCTACCCCCCATTTCCAAGGACATTTGTTACTCAGATACTTGTTATACTAATACTTGAACTTGTACCTTATGGTATTTGC
1441 TATCTTTTAACTAGTCATGATATTCTTATACTTTAGTTACACTTTTGGAATTTGATACAAGGTTGAGTGGGGTGTGTGGG
1521 TGTATGTATGAGTGAAACAGTTCTCAAAAGAATGTAAGAAAAACCATTTTTATAAAATTGTGACTTTTTAAAAACATAGT
1601 CTTTGTCATTTATAGAATTAACAAGCTGCTCAGGGTATATTTTATAGCTGTAGCACTGATATCTGCATTAATAAATACTG
1681 TCGAAACACAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|:||| |   ||||||| 
Target 5' gttGCGCCACT---ACACTCCa 3'
846 - 864 152.00 -19.00
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |:||: | ||:|||||:: 
Target 5' cttATACTTTAGTTACACTTTt 3'
1465 - 1486 135.00 -13.00
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || ||  |||  |:|||:| 
Target 5' acAAGAC--TTG--ATACTTCa 3'
1099 - 1116 120.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1188896 62 ClinVar
1188895 75 ClinVar
COSN15660539 10 COSMIC
COSN30508158 42 COSMIC
COSN20096301 59 COSMIC
COSN31550466 66 COSMIC
COSN18726941 75 COSMIC
COSN28034127 225 COSMIC
COSN31546559 288 COSMIC
COSN1244629 332 COSMIC
COSN31576966 341 COSMIC
COSN20096295 353 COSMIC
COSN26574716 484 COSMIC
COSN30173774 543 COSMIC
COSN26575436 546 COSMIC
COSN23154548 728 COSMIC
COSN17480729 765 COSMIC
COSN1862793 772 COSMIC
COSN10010326 786 COSMIC
COSN18723978 1001 COSMIC
rs1130094 290 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1213214224 5 dbSNP
rs766895883 8 dbSNP
rs1239301502 9 dbSNP
rs755015703 10 dbSNP
rs763335447 10 dbSNP
rs1278771314 25 dbSNP
rs752044573 26 dbSNP
rs773726116 26 dbSNP
rs1157899324 27 dbSNP
rs1407761279 27 dbSNP
rs371014633 31 dbSNP
rs747638598 33 dbSNP
rs901201454 37 dbSNP
rs1460464507 40 dbSNP
rs1424089778 51 dbSNP
rs1331511067 52 dbSNP
rs1402342475 55 dbSNP
rs1290651004 60 dbSNP
rs1439971733 60 dbSNP
rs1278686349 61 dbSNP
rs3833563 62 dbSNP
rs397871862 62 dbSNP
rs756905441 62 dbSNP
rs547401766 65 dbSNP
rs374487688 66 dbSNP
rs6705408 75 dbSNP
rs1232724474 80 dbSNP
rs1258838428 82 dbSNP
rs1440025355 82 dbSNP
rs917022568 91 dbSNP
rs1056807983 98 dbSNP
rs1009815188 101 dbSNP
rs1483788186 104 dbSNP
rs1184030655 108 dbSNP
rs1343579133 111 dbSNP
rs1474705405 114 dbSNP
rs1317691027 121 dbSNP
rs1170739930 131 dbSNP
rs779832226 131 dbSNP
rs1408082590 145 dbSNP
rs1328105541 147 dbSNP
rs1359738428 153 dbSNP
rs1449934192 156 dbSNP
rs1414037058 158 dbSNP
rs1174035945 160 dbSNP
rs1341584476 164 dbSNP
rs1053889312 169 dbSNP
rs1479951669 170 dbSNP
rs1313356296 173 dbSNP
rs1425446485 175 dbSNP
rs1213441224 178 dbSNP
rs1255898184 180 dbSNP
rs1485111636 180 dbSNP
rs377317204 196 dbSNP
rs1192622477 197 dbSNP
rs926751576 204 dbSNP
rs1484684465 218 dbSNP
rs1474138035 219 dbSNP
rs1166866549 224 dbSNP
rs938144945 225 dbSNP
rs1425753505 227 dbSNP
rs551774656 227 dbSNP
rs905628838 232 dbSNP
rs1171476482 238 dbSNP
rs1241056085 245 dbSNP
rs946936013 247 dbSNP
rs1208785890 252 dbSNP
rs1328492707 259 dbSNP
rs1044124952 263 dbSNP
rs1269725442 267 dbSNP
rs1368881157 270 dbSNP
rs988163392 271 dbSNP
rs1278558823 274 dbSNP
rs1270532410 277 dbSNP
rs1347611973 281 dbSNP
rs769827227 283 dbSNP
rs1285896881 288 dbSNP
rs1130094 290 dbSNP
rs1246812797 297 dbSNP
rs987518912 297 dbSNP
rs1302407740 299 dbSNP
rs972381311 302 dbSNP
rs1394183638 305 dbSNP
rs953239993 308 dbSNP
rs1160297485 312 dbSNP
rs1387387182 314 dbSNP
rs1399219055 314 dbSNP
rs1317681648 318 dbSNP
rs1350552006 318 dbSNP
rs1443664738 323 dbSNP
rs1301873581 327 dbSNP
rs1370983004 329 dbSNP
rs1241294016 340 dbSNP
rs1281677919 345 dbSNP
rs1029217567 348 dbSNP
rs1360112235 350 dbSNP
rs1289902571 352 dbSNP
rs551456834 353 dbSNP
rs1469424994 354 dbSNP
rs939923957 359 dbSNP
rs531849283 362 dbSNP
rs111759422 363 dbSNP
rs1183682468 363 dbSNP
rs1440294173 363 dbSNP
rs5829218 363 dbSNP
rs983973717 364 dbSNP
rs1158215743 372 dbSNP
rs953829057 376 dbSNP
rs921082899 379 dbSNP
rs73149881 380 dbSNP
rs1324023776 383 dbSNP
rs1394345277 386 dbSNP
rs549261463 389 dbSNP
rs1334538305 393 dbSNP
rs878872779 402 dbSNP
rs529615832 404 dbSNP
rs1448202161 405 dbSNP
rs1359591236 409 dbSNP
rs1334364491 411 dbSNP
rs1237800851 414 dbSNP
rs895479845 416 dbSNP
rs1177927115 424 dbSNP
rs1336573898 424 dbSNP
rs1426418819 425 dbSNP
rs1418291214 427 dbSNP
rs965844048 428 dbSNP
rs1188673796 429 dbSNP
rs1458128898 429 dbSNP
rs1197507707 430 dbSNP
rs1248071398 430 dbSNP
rs77130641 430 dbSNP
rs1056819058 431 dbSNP
rs1437010327 431 dbSNP
rs189060518 432 dbSNP
rs550667141 432 dbSNP
rs1417273314 433 dbSNP
rs1009490094 434 dbSNP
rs937048191 434 dbSNP
rs1395053062 436 dbSNP
rs905379349 436 dbSNP
rs1335337050 437 dbSNP
rs1045613080 438 dbSNP
rs946892930 439 dbSNP
rs915535826 440 dbSNP
rs1202405716 441 dbSNP
rs1483191607 445 dbSNP
rs1257005908 446 dbSNP
rs1212631585 447 dbSNP
rs1306018424 448 dbSNP
rs1318021032 451 dbSNP
rs1174614269 452 dbSNP
rs1186087402 452 dbSNP
rs1200788978 452 dbSNP
rs1229061514 452 dbSNP
rs1249528579 452 dbSNP
rs1259388958 452 dbSNP
rs1338721733 452 dbSNP
rs1362292812 452 dbSNP
rs1486746495 452 dbSNP
rs1491328758 452 dbSNP
rs548548539 452 dbSNP
rs749119807 452 dbSNP
rs774018291 452 dbSNP
rs775488489 452 dbSNP
rs878917198 452 dbSNP
rs878965318 452 dbSNP
rs879238574 452 dbSNP
rs1282118425 453 dbSNP
rs1297059299 453 dbSNP
rs1325739166 453 dbSNP
rs1345471365 453 dbSNP
rs1383392745 453 dbSNP
rs1491165165 453 dbSNP
rs988384031 458 dbSNP
rs1279869210 459 dbSNP
rs1034868728 467 dbSNP
rs1367508305 471 dbSNP
rs1188331121 476 dbSNP
rs1313003116 478 dbSNP
rs1451872716 482 dbSNP
rs958287131 490 dbSNP
rs1194818980 493 dbSNP
rs1379776153 495 dbSNP
rs1397202515 495 dbSNP
rs577801051 497 dbSNP
rs1455051722 499 dbSNP
rs1286557110 506 dbSNP
rs1383632037 507 dbSNP
rs935326239 508 dbSNP
rs1305527259 509 dbSNP
rs1032535229 512 dbSNP
rs560591212 523 dbSNP
rs1002342725 527 dbSNP
rs541063831 528 dbSNP
rs1046996161 529 dbSNP
rs1491190924 529 dbSNP
rs1491537824 530 dbSNP
rs139684774 532 dbSNP
rs1255416422 535 dbSNP
rs1431250157 539 dbSNP
rs762493910 540 dbSNP
rs1029063197 542 dbSNP
rs895520079 543 dbSNP
rs1342729808 545 dbSNP
rs1036700330 555 dbSNP
rs1156496069 555 dbSNP
rs939643914 559 dbSNP
rs1183974479 560 dbSNP
rs963243554 560 dbSNP
rs10063 575 dbSNP
rs1298485936 579 dbSNP
rs1004724744 581 dbSNP
rs184660941 587 dbSNP
rs1225615438 599 dbSNP
rs1305130006 605 dbSNP
rs1328804745 613 dbSNP
rs1048369891 627 dbSNP
rs1467488987 639 dbSNP
rs746629400 639 dbSNP
rs932541507 645 dbSNP
rs576015374 655 dbSNP
rs556327133 657 dbSNP
rs1233737500 658 dbSNP
rs1481819665 663 dbSNP
rs1175905213 669 dbSNP
rs542423464 677 dbSNP
rs192681806 681 dbSNP
rs1289741043 683 dbSNP
rs976983602 684 dbSNP
rs965499823 696 dbSNP
rs1415052304 697 dbSNP
rs1460805470 698 dbSNP
rs913936425 712 dbSNP
rs988121316 713 dbSNP
rs905638500 715 dbSNP
rs1356278684 721 dbSNP
rs1341023496 726 dbSNP
rs1297431738 730 dbSNP
rs1350059019 733 dbSNP
rs1415650026 735 dbSNP
rs958005933 751 dbSNP
rs549304062 755 dbSNP
rs1032293667 759 dbSNP
rs144681167 761 dbSNP
rs369296635 761 dbSNP
rs1002447707 763 dbSNP
rs1309836659 764 dbSNP
rs1349716547 767 dbSNP
rs553628412 772 dbSNP
rs1485766814 780 dbSNP
rs563908266 782 dbSNP
rs1411332940 784 dbSNP
rs893944056 791 dbSNP
rs970034994 792 dbSNP
rs1162413651 795 dbSNP
rs1186660543 800 dbSNP
rs1421530319 803 dbSNP
rs1408167118 804 dbSNP
rs1457912695 805 dbSNP
rs1025147870 806 dbSNP
rs1169417283 810 dbSNP
rs1014129607 815 dbSNP
rs1375847157 816 dbSNP
rs1167602778 823 dbSNP
rs1052689122 824 dbSNP
rs895584758 828 dbSNP
rs1417845394 834 dbSNP
rs1353862595 837 dbSNP
rs1447357864 838 dbSNP
rs935545225 842 dbSNP
rs1183317696 851 dbSNP
rs1484171481 857 dbSNP
rs1266987886 858 dbSNP
rs371153381 859 dbSNP
rs911907608 861 dbSNP
rs1003951227 864 dbSNP
rs888136422 875 dbSNP
rs1357071323 876 dbSNP
rs1267300419 877 dbSNP
rs1236841972 880 dbSNP
rs796345982 886 dbSNP
rs1243364152 887 dbSNP
rs1328367041 888 dbSNP
rs1185862804 890 dbSNP
rs1288775317 891 dbSNP
rs1389213183 893 dbSNP
rs1343263029 894 dbSNP
rs1373837114 894 dbSNP
rs1414153115 895 dbSNP
rs1319010457 896 dbSNP
rs1347053311 897 dbSNP
rs1429160621 910 dbSNP
rs1297507391 917 dbSNP
rs1048089483 918 dbSNP
rs1191475393 918 dbSNP
rs1207619034 918 dbSNP
rs1224003400 918 dbSNP
rs1236930673 918 dbSNP
rs1240292946 918 dbSNP
rs1285661579 918 dbSNP
rs1301737071 918 dbSNP
rs1333676283 918 dbSNP
rs1343785018 918 dbSNP
rs1372438312 918 dbSNP
rs1444774987 918 dbSNP
rs1469796929 918 dbSNP
rs34525911 918 dbSNP
rs1322406364 920 dbSNP
rs932619770 924 dbSNP
rs1227210115 926 dbSNP
rs921148040 928 dbSNP
rs1386981823 929 dbSNP
rs1273304308 934 dbSNP
rs13008101 939 dbSNP
rs1211757137 957 dbSNP
rs1286574798 965 dbSNP
rs1266326451 967 dbSNP
rs1438183488 968 dbSNP
rs1183799231 977 dbSNP
rs150596640 978 dbSNP
rs141799282 979 dbSNP
rs1158455591 982 dbSNP
rs1160411672 985 dbSNP
rs1463410513 987 dbSNP
rs1163392026 989 dbSNP
rs138095350 994 dbSNP
rs1473737617 1003 dbSNP
rs1331338994 1005 dbSNP
rs138788849 1008 dbSNP
rs187433589 1008 dbSNP
rs59317355 1008 dbSNP
rs146387837 1011 dbSNP
rs1293306646 1014 dbSNP
rs1427478019 1016 dbSNP
rs368905778 1017 dbSNP
rs1452374115 1018 dbSNP
rs70948824 1018 dbSNP
rs1264784854 1019 dbSNP
rs113691871 1020 dbSNP
rs1270647940 1020 dbSNP
rs1482162099 1020 dbSNP
rs34423700 1020 dbSNP
rs373334673 1020 dbSNP
rs907675783 1020 dbSNP
rs201449226 1021 dbSNP
rs1203417334 1023 dbSNP
rs1462971090 1023 dbSNP
rs1369113225 1026 dbSNP
rs1428633570 1026 dbSNP
rs540386387 1026 dbSNP
rs1229532746 1027 dbSNP
rs1268127226 1029 dbSNP
rs1341185003 1040 dbSNP
rs1211401333 1045 dbSNP
rs1281278357 1047 dbSNP
rs981143672 1048 dbSNP
rs1464412881 1053 dbSNP
rs1486799690 1057 dbSNP
rs184520738 1059 dbSNP
rs1198761103 1061 dbSNP
rs1255583837 1062 dbSNP
rs1429568696 1065 dbSNP
rs969667977 1065 dbSNP
rs1035559627 1067 dbSNP
rs1001631783 1069 dbSNP
rs1025622731 1072 dbSNP
rs1464260534 1082 dbSNP
rs1021800364 1085 dbSNP
rs1385053526 1087 dbSNP
rs146246797 1089 dbSNP
rs1316113475 1092 dbSNP
rs1011284962 1093 dbSNP
rs1234710448 1094 dbSNP
rs1198921186 1101 dbSNP
rs141699199 1106 dbSNP
rs1274029061 1107 dbSNP
rs547311197 1109 dbSNP
rs893995863 1110 dbSNP
rs6758721 1117 dbSNP
rs1231356005 1121 dbSNP
rs1052575038 1123 dbSNP
rs1486233158 1135 dbSNP
rs1207031734 1137 dbSNP
rs1246708349 1138 dbSNP
rs962550810 1142 dbSNP
rs999679717 1145 dbSNP
rs138626956 1151 dbSNP
rs1332437824 1163 dbSNP
rs1431024163 1167 dbSNP
rs14425 1183 dbSNP
rs1364070201 1188 dbSNP
rs1433659116 1207 dbSNP
rs888190405 1208 dbSNP
rs1388551717 1222 dbSNP
rs564883483 1229 dbSNP
rs1441573878 1239 dbSNP
rs1026659228 1247 dbSNP
rs1365233657 1250 dbSNP
rs1386073755 1262 dbSNP
rs1459271662 1262 dbSNP
rs996877487 1267 dbSNP
rs544974322 1268 dbSNP
rs1317799166 1272 dbSNP
rs1241238563 1290 dbSNP
rs1172335536 1292 dbSNP
rs899767676 1294 dbSNP
rs1266354825 1305 dbSNP
rs1041333170 1313 dbSNP
rs943957427 1314 dbSNP
rs374972637 1318 dbSNP
rs751778319 1324 dbSNP
rs1255516740 1326 dbSNP
rs778083628 1328 dbSNP
rs1379549582 1334 dbSNP
rs1191025650 1349 dbSNP
rs1191123718 1351 dbSNP
rs1250751853 1358 dbSNP
rs1448882424 1359 dbSNP
rs1248713848 1364 dbSNP
rs758662486 1366 dbSNP
rs535134179 1368 dbSNP
rs936763135 1370 dbSNP
rs531451208 1375 dbSNP
rs1461836665 1381 dbSNP
rs1459897554 1382 dbSNP
rs925330229 1385 dbSNP
rs1277708956 1386 dbSNP
rs980813069 1395 dbSNP
rs1298579100 1396 dbSNP
rs942096513 1397 dbSNP
rs907728047 1405 dbSNP
rs562426682 1417 dbSNP
rs917911643 1424 dbSNP
rs959847679 1428 dbSNP
rs1292613286 1430 dbSNP
rs928576864 1433 dbSNP
rs753158471 1442 dbSNP
rs962285508 1450 dbSNP
rs542834351 1459 dbSNP
rs1481376350 1460 dbSNP
rs1015136213 1463 dbSNP
rs1011343164 1470 dbSNP
rs1227043389 1470 dbSNP
rs984923192 1475 dbSNP
rs1411495107 1480 dbSNP
rs1423210222 1483 dbSNP
rs1251 1485 dbSNP
rs1027128138 1486 dbSNP
rs553689794 1504 dbSNP
rs1356078702 1505 dbSNP
rs770808569 1506 dbSNP
rs1431793164 1514 dbSNP
rs1299170784 1516 dbSNP
rs1437963376 1517 dbSNP
rs1306389097 1518 dbSNP
rs999732120 1519 dbSNP
rs765652582 1522 dbSNP
rs890623200 1524 dbSNP
rs996540742 1526 dbSNP
rs899526914 1532 dbSNP
rs1228266765 1533 dbSNP
rs1019261551 1534 dbSNP
rs1052457509 1535 dbSNP
rs1404640873 1537 dbSNP
rs540143889 1550 dbSNP
rs1273440925 1556 dbSNP
rs1485818368 1559 dbSNP
rs747255806 1562 dbSNP
rs1212359401 1563 dbSNP
rs1429347272 1573 dbSNP
rs577465763 1578 dbSNP
rs149040017 1580 dbSNP
rs1472395236 1586 dbSNP
rs996405216 1589 dbSNP
rs1447405958 1590 dbSNP
rs900521850 1590 dbSNP
rs192592002 1597 dbSNP
rs1443870336 1599 dbSNP
rs1435594289 1600 dbSNP
rs942024326 1605 dbSNP
rs1052220677 1613 dbSNP
rs569371311 1615 dbSNP
rs756254259 1625 dbSNP
rs1047800852 1626 dbSNP
rs1226612854 1628 dbSNP
rs938526245 1633 dbSNP
rs1348098896 1634 dbSNP
rs1243085592 1637 dbSNP
rs1275818042 1638 dbSNP
rs62120347 1643 dbSNP
rs536095125 1651 dbSNP
rs1215942624 1654 dbSNP
rs1249776651 1656 dbSNP
rs1463512022 1662 dbSNP
rs766958722 1665 dbSNP
rs1449384458 1676 dbSNP
rs573141533 1678 dbSNP
rs903959440 1682 dbSNP
rs772392006 1683 dbSNP
rs1423397186 1690 dbSNP
rs955687031 1691 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293T
Location of target site 3'UTR
Tools used in this research miRanda
Original Description (Extracted from the article) ... Verification of miR-122 target genes using 3'UTR reporter assay is shown in Supporting Table 4. ...

- Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al., 2009, Hepatology (Baltimore, Md.).

Article - Tsai WC; Hsu PW; Lai TC; Chau GY; Lin CW; et al.
- Hepatology (Baltimore, Md.), 2009
UNLABELLED: MicroRNAs (miRNAs), which are inhibitors of gene expression, participate in diverse biological functions and in carcinogenesis. In this study, we show that liver-specific microRNA-122 (miR-122) is significantly down-regulated in liver cancers with intrahepatic metastasis and negatively regulates tumorigenesis. Restoration of miR-122 in metastatic Mahlavu and SK-HEP-1 cells significantly reduced in vitro migration, invasion, and anchorage-independent growth as well as in vivo tumorigenesis, angiogenesis, and intrahepatic metastasis in an orthotopic liver cancer model. Because an inverse expression pattern is often present between an miRNA and its target genes, we used a computational approach and identified multiple miR-122 candidate target genes from two independent expression microarray datasets. Thirty-two target genes were empirically verified, and this group of genes was enriched with genes regulating cell movement, cell morphology, cell-cell signaling, and transcription. We further showed that one of the miR-122 targets, ADAM17 (a disintegrin and metalloprotease 17) is involved in metastasis. Silencing of ADAM17 resulted in a dramatic reduction of in vitro migration, invasion, in vivo tumorigenesis, angiogenesis, and local invasion in the livers of nude mice, which is similar to that which occurs with the restoration of miR-122. CONCLUSION: Our study suggests that miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17. Restoration of miR-122 has a far-reaching effect on the cell. Using the concomitant down-regulation of its targets, including ADAM17, a rational therapeutic strategy based on miR-122 may prove to be beneficial for patients with hepatocellular carcinoma.
LinkOut: [PMID: 19296470]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Hep G2 , Hep 3B , SK-HEP-1
Location of target site 3'UTR
Original Description (Extracted from the article) ... Notably, the RNA level of ADAM10 and ADAM17, another validated target of miR-122, was also suppressed by miR-122 (supplemental Fig. S5). ...

- Bai S; Nasser MW; Wang B; Hsu SH; Datta J; et al., 2009, The Journal of biological chemistry.

Article - Bai S; Nasser MW; Wang B; Hsu SH; Datta J; et al.
- The Journal of biological chemistry, 2009
MicroRNAs are negative regulators of protein coding genes. The liver-specific microRNA-122 (miR-122) is frequently suppressed in primary hepatocellular carcinomas (HCCs). In situ hybridization demonstrated that miR-122 is abundantly expressed in hepatocytes but barely detectable in primary human HCCs. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and SK-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice. Further, miR-122-expressing HCC cells retained an epithelial phenotype that correlated with reduced Vimentin expression. ADAM10 (a distintegrin and metalloprotease family 10), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Conversely, depletion of the endogenous miR-122 in Huh-7 cells facilitated their tumorigenic properties with concomitant up-regulation of these targets. Expression of SRF or Igf1R partially reversed tumor suppressor function of miR-122. Further, miR-122 impeded angiogenic properties of endothelial cells in vitro. Notably, ADAM10, SRF, and Igf1R were up-regulated in primary human HCCs compared with the matching liver tissue. Co-labeling studies demonstrated exclusive localization of miR-122 in the benign livers, whereas SRF predominantly expressed in HCC. More importantly, growth and clonogenic survival of miR-122-expressing HCC cells were significantly reduced upon treatment with sorafenib, a multi-kinase inhibitor clinically effective against HCC. Collectively, these results suggest that the loss of multifunctional miR-122 contributes to the malignant phenotype of HCC cells, and miR-122 mimetic alone or in combination with anticancer drugs can be a promising therapeutic regimen against liver cancer.
LinkOut: [PMID: 19726678]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Article - Zhang H; Li Y; Lai M
- Oncogene, 2010
Metastasis is the most significant process affecting the clinical management of cancer patients and occurs in multiple sequential steps. However, the molecular pathways underlying each step still remain obscure. Recent research has shown that there is a microRNA (miRNA) network that functions as a regulator of tumor metastasis. In this paper, we review the role of miRNAs in tumor metastasis, including control of epithelial-mesenchymal transition, regulation of metastasis-associated genes and epigenetic alterations. More information on miRNAs will promote a better understanding of the molecular mechanism of metastasis.
LinkOut: [PMID: 19935707]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*