miRTarBase - #MIRT003885 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NIPAL2   
Synonyms NPAL2
Description NIPA like domain containing 2
Transcript NM_024759   
Expression
Putative miRNA Targets on NIPAL2
3'UTR of NIPAL2
(miRNA target sites are highlighted)
>NIPAL2|NM_024759|3'UTR
   1 CTTATCCTATGGAACTTTGCCTGATGGAAGTGACTCAACAAAGAGCCAAAGTGGAGAGAAGAAAGAGGTCTAAATGCTGA
  81 GAAGGATGGCTGTTGGCCTGTTATTCGATACCACCTTTTTAAAAAATTGCACATGTTCAATTTGTGTCAGCAGCTCTTTT
 161 ATAAGCTAACATGTGCTAGCATTCATTTCAGTCCTTTCCCCCACCTCAGCGTCTATGGACAATCGGGGACTTCCTAAGCT
 241 CTGACAGTCTAATATTTCCATGGAATGTGATTTGGAGTGTTCCCCACACCCTGGACCTCTCCCTAGTGATTATCTAGCCA
 321 GCTACACCTTACTCAGAGCCCGGCTGCTCTAGCAGGAATGTTGCACAGAAACATACATTTGCGGTTTGGCCACAGGTCGC
 401 ATAGGTGGCTTCTCCCACGGGTAGTGTCAGTTGCTTCACTTTAAAAAGTCACTTCAGCCCCACAACCTCACTCCCAAAAG
 481 AAAGGTTTGAGAGCGCTCATTTTTTTTCTAAGACACCTTTTATAAGCCTCCCTATAAAAATCTCACCTTTCAAGTACTAA
 561 GTTAGAATTGCAAGTCATCTTTTCTGAAAACTAATGCTATCAAAGTCCTCCTTTGAAAATTAAGGGTCTCTTTAAAATTA
 641 GAATTTATAAATGGCATTCAGTGATAGTGTACACCAAAATTAAAAGACCTTGACTGGTGGGCTTTTTACGTGTAAGGAAG
 721 AGGAAGTTTAAGAAGTAGGACTCTGCTTGTTTCAGTAGCCCATGTACTAAAATAGGAACAATGCAGAGATTAGCACAGCC
 801 CCTGCACAAGGCTGACACATAAATTCATGAAGCGTTAGAGACAAAAAGTAGGACTAATGTTTGTTTATTTTTTAATAAAA
 881 ATCTAGAATGGTGATGTTTTCTTCAGCTGTATGATTCTATCATACTTGAAACTGAAGAAAAATTTAATATCCTATGTCTT
 961 TTTTATAGATCTTATAATTTATCAAGTGGATTTATATGTCTTATTCTCCATATAAGTCTAAAAAATCACATTTAAATTCT
1041 TAGTGATAGTTTCACTACACATCATTTCTTCCCAAAGTCATTACCTCAAGCTTTGTAAATTCTTCTAGATAAAAGGAGAG
1121 TTGTGATTAGAGAACTGAATTTCAGCCATTTAAACCTGTAGACATAGAAAACAACCCAGTGGTCAAACCTGAGCTTCAAG
1201 AGGAAGCCCAAGTCCTCCTGTTTCCTGAATGGCTTTTCCACTCCAATTCATCACATATCTGCTAAGACACATTTGCAGGT
1281 AGAATCCATAATAATATCTGTTATTTATGATCTACCTAATATTTAAAGGAGAAGAAAAGAAGTAGCCTTCGTTGCAGCCA
1361 ACATCCAACAATAAGTCCCACCCTTAATGACATTTCAAAGCCTTCAGATCACTTCTGACATGTCTGTCCAATATCATTCC
1441 AATCAATAGTCTTGCATTTAAATAGGTTGTTTAACTCGGTGGTATTGAGACTGTAACCTTAATGGCTCAGGTCTTTTAGC
1521 TTTGTTCTTTGTCATAATCTGCACTCCTGGCCAGACTGACCAAACCTGGCTGCAAAGGAAAGAGATTTGAATTGATCACC
1601 AATGTATGAAAAATACAGAACCCATGTCTGGCTCCTAAACTCCTGGTAATAATTCCCGCCATCGTAGCAAGTGTCCCATG
1681 CATTCAGATAAAGCAGTCATAATTTATGGTGTATTTTACCGAATTGGTCCAGCATATTGGTCCTACAAGGCTCAGCCAAG
1761 AAATGTATCTGGTGCCTTAAACTACAGATTTCTGGTGACTCTTAAAACTGGTTTACAAAGATTGAGAAAACAATTAGATT
1841 GAAGAGTTTTGCTTCAAGTAGACCTGCATTCATAGCTAGAGTGCATGAGATTTTCAGCACTGTAGAATTTCACACAGGCA
1921 CAAGCATAACACCAGTACTTTAGCAGCCGCCAACAGTTGCATCTATTAAACGTTTTGAGAAATGACATTGACTTATGCAC
2001 ATTTAAGCAATCAACAATGTTTTAGAAGTCCAGGTAACATATAAAATATATTCAGACCTAGTTTTACTTTCCATATTGTT
2081 GCTCCAAAGTAAGGTAAATAGGAGTTTTAGTTGTACTGGCCTGTAAGATTTTTTAAATTACACAGTGCATGACAACAACT
2161 AAAGCCAACTCAGTCCTTCTCTTGGCATTGTGAGTTGAGGACCTTTAGCCAACTGTTAGCTCATCTGACTATCTGTCTAG
2241 ACCAAGGGTCGGCAAAGTTTTCAGTAAAGACCCACAGAGTACATATTTTGGAGTTTGTGTTGTCTGTACCAACAGACAGA
2321 CATGGTGTCTGTCCCAACTACCCAACTCTGCCATTGTAGCACTAAAGCAGCCATAGACAAGATGTAAACAGAAGAGCATG
2401 GCTGTGTTCCAGTAAAACTTTATTTACAGGCCAGGCATGGTGGCTCATGCCTGTAATCCCAGCACTCTGGGAGGCTGAGG
2481 CTGACAGATCATCTGAGGTTAGGAGTTTGGGACCAGCCTGGTCAACATAGTGAAACCCCATCTCTACTAAAAGTACAAAA
2561 ATTAGCCAGGCATGACGGTGGGTGCCTGGAGTCCCAGCTACCTGGGAGGCTGAGGCAGGAGAATCACTTGAACCCGGGAG
2641 GTGGAGGTTGCAGTGAGCCGAGATCATGCCATTGCACTCCAGCCTGGGCGACAGAGTAAGACTGTCTCAAAAACAAACAA
2721 ACAAACAAACAAACAAAAACAAGTGGCCAGTCTGTGAGCTATAGTTCCCAACACCTGGTCTAGACTCTTCTGCCCTTGCT
2801 CTGCAGCTTCTTTCCTGTTGATTGGGCATTCAGGGAAGGAGTTTAAAAAGTGACACTCATGGCTCATGACAAATGAGATA
2881 CTTTGGGAGTGTGGAAACATGGCTTGATATTTGCCTTCAGATATTTTTGCTTATATAAGTTCTAAATGGAAGTGATAAGT
2961 TCATTCTTAGGGTCCAAGTTGAAAGGCAGTGGTTCTTTTGTGAACACCACTAACTACATTCGAAAAGCCTCTCCAATTCC
3041 ACATTCCAAGTCTATAACAGCTTTGGAAATGAGTAACAATGACCTCTCATGTAGTAGATTAAAGCAGAGGCCTTTGCCAT
3121 ATGATTGTTTTTTGGCTTAAATGTTTGCTTGCCCTGTAACTGTAATACTTTGGTTACCAGAATCACTTGAAAACAAATAC
3201 AATAAAAAAATTTCTCAAGCAGTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||| ||| ||:|||| 
Target 5' tactttCCA-TAT-TGTTGCTc 3'
2065 - 2084 138.00 -10.70
2
miRNA  3' guguuUGGUAAU-ACACGACGAu 5'
               :|| ||: | ||| ||| 
Target 5' cttctGCCCTTGCTCTGCAGCTt 3'
2787 - 2809 121.00 -6.50
3
miRNA  3' guGUUUGGUAAUACACGA-CGau 5'
            :||:|:|  ||||||| ||  
Target 5' taTAAGCTAACATGTGCTAGCat 3'
160 - 182 120.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30106767 1 COSMIC
COSN30135420 14 COSMIC
COSN5030207 43 COSMIC
COSN31545733 55 COSMIC
COSN31966522 58 COSMIC
COSN31507340 92 COSMIC
COSN30100938 106 COSMIC
COSN30131046 107 COSMIC
COSN30494377 120 COSMIC
COSN30503405 127 COSMIC
COSN28865492 198 COSMIC
COSN31516243 205 COSMIC
COSN31598937 210 COSMIC
COSN30540306 218 COSMIC
COSN31541693 322 COSMIC
COSN26400913 949 COSMIC
COSN27988830 1125 COSMIC
COSN18905027 1309 COSMIC
COSN22612259 1312 COSMIC
COSN24458453 1582 COSMIC
COSN32063603 1826 COSMIC
COSN21009596 2053 COSMIC
COSN9273345 2255 COSMIC
COSN156264 2333 COSMIC
COSN2300648 2647 COSMIC
COSN9273344 2806 COSMIC
COSN23840400 2875 COSMIC
COSN28256627 3214 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764956877 1 dbSNP
rs757209970 4 dbSNP
rs180849759 9 dbSNP
rs1192447995 10 dbSNP
rs1481074559 15 dbSNP
rs1244420426 20 dbSNP
rs1182063186 23 dbSNP
rs1288962269 24 dbSNP
rs1410288727 27 dbSNP
rs1200411745 30 dbSNP
rs1218331725 32 dbSNP
rs561453780 39 dbSNP
rs369076771 40 dbSNP
rs1221901209 43 dbSNP
rs775625452 45 dbSNP
rs1275313099 48 dbSNP
rs540816475 56 dbSNP
rs759764157 58 dbSNP
rs968218993 60 dbSNP
rs1020724649 65 dbSNP
rs1421732080 67 dbSNP
rs988198854 68 dbSNP
rs1361459731 69 dbSNP
rs774867423 70 dbSNP
rs527990596 88 dbSNP
rs1427709183 91 dbSNP
rs1192210029 92 dbSNP
rs749839615 95 dbSNP
rs375403238 96 dbSNP
rs770325718 98 dbSNP
rs746572381 100 dbSNP
rs779552919 101 dbSNP
rs565620019 106 dbSNP
rs575336495 107 dbSNP
rs757085139 111 dbSNP
rs753646685 112 dbSNP
rs763995160 120 dbSNP
rs1321393826 123 dbSNP
rs1288820989 127 dbSNP
rs138418912 130 dbSNP
rs576339039 139 dbSNP
rs370441001 148 dbSNP
rs543073300 154 dbSNP
rs957248502 155 dbSNP
rs898563866 163 dbSNP
rs3735885 168 dbSNP
rs746574980 173 dbSNP
rs940025010 177 dbSNP
rs965189372 178 dbSNP
rs1161610166 183 dbSNP
rs554320842 185 dbSNP
rs891126507 186 dbSNP
rs1422332470 187 dbSNP
rs1167155081 192 dbSNP
rs1019035141 210 dbSNP
rs1401337317 215 dbSNP
rs1424622239 221 dbSNP
rs534552918 224 dbSNP
rs145745876 225 dbSNP
rs921081451 231 dbSNP
rs17358339 233 dbSNP
rs772992173 239 dbSNP
rs771987990 243 dbSNP
rs1262089953 252 dbSNP
rs1229733865 259 dbSNP
rs1315308134 263 dbSNP
rs1340941645 280 dbSNP
rs759252900 282 dbSNP
rs578232317 289 dbSNP
rs1440092602 291 dbSNP
rs111321772 292 dbSNP
rs1205804877 297 dbSNP
rs1237321625 302 dbSNP
rs1482477230 305 dbSNP
rs960328338 306 dbSNP
rs765399494 311 dbSNP
rs1386107725 317 dbSNP
rs1449037340 328 dbSNP
rs770511480 337 dbSNP
rs569602641 341 dbSNP
rs1232651000 342 dbSNP
rs553279949 344 dbSNP
rs1304578852 349 dbSNP
rs796241874 351 dbSNP
rs1434789637 356 dbSNP
rs906661899 362 dbSNP
rs981667605 367 dbSNP
rs1364039122 374 dbSNP
rs970281215 376 dbSNP
rs1023247199 377 dbSNP
rs777243667 382 dbSNP
rs539055293 383 dbSNP
rs1310895535 386 dbSNP
rs1205991010 390 dbSNP
rs1431837116 391 dbSNP
rs1358583243 392 dbSNP
rs1171863929 398 dbSNP
rs536324758 399 dbSNP
rs1436451992 401 dbSNP
rs1243976929 402 dbSNP
rs1475780751 416 dbSNP
rs898704838 418 dbSNP
rs767645659 419 dbSNP
rs567418301 426 dbSNP
rs548001947 445 dbSNP
rs1016057905 450 dbSNP
rs1004259753 458 dbSNP
rs988465745 467 dbSNP
rs1435142175 470 dbSNP
rs891095337 488 dbSNP
rs935941165 493 dbSNP
rs925850801 494 dbSNP
rs1207133985 495 dbSNP
rs1051062631 496 dbSNP
rs1448880082 497 dbSNP
rs932676807 507 dbSNP
rs536898818 508 dbSNP
rs964584201 508 dbSNP
rs4735538 513 dbSNP
rs1455445405 516 dbSNP
rs1160024415 518 dbSNP
rs987593352 521 dbSNP
rs1212442929 524 dbSNP
rs1043682079 526 dbSNP
rs950785142 530 dbSNP
rs1332296908 534 dbSNP
rs1407360929 536 dbSNP
rs1284479479 538 dbSNP
rs1348030172 540 dbSNP
rs1226961308 541 dbSNP
rs1281588921 543 dbSNP
rs571873634 554 dbSNP
rs4734392 556 dbSNP
rs1227416960 558 dbSNP
rs4734391 561 dbSNP
rs1490858628 570 dbSNP
rs1052156215 576 dbSNP
rs1298194964 585 dbSNP
rs1251000949 592 dbSNP
rs1471539832 595 dbSNP
rs1183760665 602 dbSNP
rs939102501 606 dbSNP
rs1364127791 607 dbSNP
rs927723613 608 dbSNP
rs899463376 611 dbSNP
rs755280922 614 dbSNP
rs1366971870 620 dbSNP
rs1424751667 620 dbSNP
rs1306811483 636 dbSNP
rs1355085857 645 dbSNP
rs980422746 648 dbSNP
rs1311100134 653 dbSNP
rs747544733 654 dbSNP
rs969117663 660 dbSNP
rs1408499858 670 dbSNP
rs1331344696 686 dbSNP
rs1416666980 692 dbSNP
rs562884605 694 dbSNP
rs1376193494 702 dbSNP
rs140661937 710 dbSNP
rs541487973 711 dbSNP
rs529343336 713 dbSNP
rs963166959 734 dbSNP
rs560252139 736 dbSNP
rs866588342 745 dbSNP
rs1482054689 764 dbSNP
rs188119210 766 dbSNP
rs906713719 768 dbSNP
rs571861003 773 dbSNP
rs1046974180 798 dbSNP
rs1185057823 799 dbSNP
rs955437699 806 dbSNP
rs1029729528 808 dbSNP
rs1167452115 814 dbSNP
rs1387753745 818 dbSNP
rs72680653 819 dbSNP
rs891546343 833 dbSNP
rs545274765 834 dbSNP
rs935658163 836 dbSNP
rs576289159 844 dbSNP
rs1485707722 848 dbSNP
rs1385299344 849 dbSNP
rs556124305 853 dbSNP
rs1250515073 854 dbSNP
rs1010837017 858 dbSNP
rs535912079 866 dbSNP
rs1340122186 867 dbSNP
rs1229608116 871 dbSNP
rs892271186 873 dbSNP
rs1251822169 890 dbSNP
rs567280082 891 dbSNP
rs1195663839 892 dbSNP
rs553856540 901 dbSNP
rs1479952698 906 dbSNP
rs1198540167 912 dbSNP
rs1052249921 919 dbSNP
rs939197242 925 dbSNP
rs1461524612 928 dbSNP
rs1187521233 932 dbSNP
rs532596768 937 dbSNP
rs1245734853 948 dbSNP
rs533897456 951 dbSNP
rs911753143 956 dbSNP
rs1291645191 959 dbSNP
rs1374162274 963 dbSNP
rs1235431370 966 dbSNP
rs987698157 968 dbSNP
rs1174773702 969 dbSNP
rs950836492 971 dbSNP
rs1470458180 975 dbSNP
rs1044878068 984 dbSNP
rs947673595 990 dbSNP
rs1356166576 993 dbSNP
rs1384008952 999 dbSNP
rs1296328698 1006 dbSNP
rs758513813 1013 dbSNP
rs1323980154 1016 dbSNP
rs569343786 1016 dbSNP
rs1398571927 1026 dbSNP
rs1298722862 1031 dbSNP
rs1265860067 1057 dbSNP
rs963354624 1060 dbSNP
rs1186624565 1061 dbSNP
rs1266014569 1065 dbSNP
rs1433162889 1072 dbSNP
rs1197874766 1077 dbSNP
rs377254030 1094 dbSNP
rs571836851 1095 dbSNP
rs1460711595 1102 dbSNP
rs1392100384 1117 dbSNP
rs184917331 1120 dbSNP
rs1158815402 1121 dbSNP
rs1343676217 1123 dbSNP
rs1475333328 1132 dbSNP
rs1410510637 1135 dbSNP
rs372760978 1141 dbSNP
rs1002476502 1143 dbSNP
rs1390082195 1164 dbSNP
rs1403092775 1171 dbSNP
rs369247831 1175 dbSNP
rs1025167502 1182 dbSNP
rs1010149510 1191 dbSNP
rs892601146 1202 dbSNP
rs1318392874 1203 dbSNP
rs1216034254 1208 dbSNP
rs1253246866 1220 dbSNP
rs1487215846 1222 dbSNP
rs1052865735 1225 dbSNP
rs1196934465 1242 dbSNP
rs1481022285 1243 dbSNP
rs908820695 1249 dbSNP
rs1181948890 1253 dbSNP
rs982899265 1254 dbSNP
rs904209689 1261 dbSNP
rs1271734403 1270 dbSNP
rs1368041535 1273 dbSNP
rs1422831859 1276 dbSNP
rs955571044 1279 dbSNP
rs1367498968 1288 dbSNP
rs569496668 1289 dbSNP
rs1039092391 1305 dbSNP
rs911790423 1321 dbSNP
rs1225766279 1322 dbSNP
rs1271798183 1333 dbSNP
rs1051642983 1336 dbSNP
rs62522244 1341 dbSNP
rs996889242 1346 dbSNP
rs919057337 1348 dbSNP
rs529207236 1350 dbSNP
rs560115071 1351 dbSNP
rs1011349088 1354 dbSNP
rs892371630 1359 dbSNP
rs1363776048 1361 dbSNP
rs1480755828 1363 dbSNP
rs1368433624 1373 dbSNP
rs1178643412 1382 dbSNP
rs926666119 1385 dbSNP
rs1443826294 1389 dbSNP
rs866731545 1392 dbSNP
rs746195132 1419 dbSNP
rs1383831543 1423 dbSNP
rs1003376533 1424 dbSNP
rs1169834144 1432 dbSNP
rs971045746 1437 dbSNP
rs1444621730 1447 dbSNP
rs192417390 1451 dbSNP
rs1382457890 1455 dbSNP
rs1453875525 1459 dbSNP
rs767574454 1465 dbSNP
rs1340673852 1467 dbSNP
rs1212226732 1477 dbSNP
rs956873771 1478 dbSNP
rs947840006 1481 dbSNP
rs1206151587 1484 dbSNP
rs189122363 1487 dbSNP
rs1460670653 1493 dbSNP
rs779443981 1496 dbSNP
rs1183988174 1506 dbSNP
rs1183158351 1508 dbSNP
rs1454222900 1509 dbSNP
rs1251456961 1511 dbSNP
rs1185919535 1513 dbSNP
rs1195916743 1519 dbSNP
rs565070955 1525 dbSNP
rs1174170206 1527 dbSNP
rs904259171 1531 dbSNP
rs1470473573 1534 dbSNP
rs1339107928 1536 dbSNP
rs1363546787 1539 dbSNP
rs1430622260 1540 dbSNP
rs1271329885 1542 dbSNP
rs1017304527 1551 dbSNP
rs1352933595 1552 dbSNP
rs398095993 1570 dbSNP
rs78526214 1570 dbSNP
rs940378053 1570 dbSNP
rs1261395866 1571 dbSNP
rs1233401458 1572 dbSNP
rs1322411486 1572 dbSNP
rs1203982880 1589 dbSNP
rs1264758106 1592 dbSNP
rs1445116063 1597 dbSNP
rs754332207 1599 dbSNP
rs1242665125 1616 dbSNP
rs1305307908 1621 dbSNP
rs1167262061 1625 dbSNP
rs1441322780 1639 dbSNP
rs908789555 1640 dbSNP
rs983033652 1641 dbSNP
rs934121640 1645 dbSNP
rs185208987 1647 dbSNP
rs1178921395 1649 dbSNP
rs774044495 1651 dbSNP
rs1383628829 1655 dbSNP
rs964143490 1657 dbSNP
rs1022831348 1658 dbSNP
rs1347480662 1662 dbSNP
rs1280805423 1663 dbSNP
rs374704746 1664 dbSNP
rs541639472 1671 dbSNP
rs1223723733 1677 dbSNP
rs28495420 1678 dbSNP
rs1348225572 1680 dbSNP
rs1003471720 1682 dbSNP
rs762500298 1689 dbSNP
rs542945882 1690 dbSNP
rs1478555363 1693 dbSNP
rs1448663911 1697 dbSNP
rs1220248565 1698 dbSNP
rs1023489704 1711 dbSNP
rs150266804 1716 dbSNP
rs942147008 1719 dbSNP
rs898899534 1720 dbSNP
rs11988153 1721 dbSNP
rs1410706200 1729 dbSNP
rs540960036 1733 dbSNP
rs980842675 1740 dbSNP
rs1303134384 1744 dbSNP
rs747673810 1751 dbSNP
rs1364375921 1756 dbSNP
rs940364836 1760 dbSNP
rs1405063607 1764 dbSNP
rs533464868 1768 dbSNP
rs2053934 1771 dbSNP
rs1237972938 1772 dbSNP
rs988411949 1779 dbSNP
rs1282350871 1782 dbSNP
rs956926148 1787 dbSNP
rs1290993275 1796 dbSNP
rs1360200268 1797 dbSNP
rs1224838083 1798 dbSNP
rs1248611246 1804 dbSNP
rs1437462088 1809 dbSNP
rs369234818 1810 dbSNP
rs1234942465 1812 dbSNP
rs1443210655 1814 dbSNP
rs1163462655 1818 dbSNP
rs55809211 1820 dbSNP
rs558327245 1821 dbSNP
rs934262498 1824 dbSNP
rs1424677937 1851 dbSNP
rs922881049 1857 dbSNP
rs375980697 1858 dbSNP
rs1390445427 1864 dbSNP
rs1329183187 1865 dbSNP
rs1017773835 1872 dbSNP
rs111230182 1873 dbSNP
rs1229080668 1875 dbSNP
rs1326677531 1878 dbSNP
rs915327485 1885 dbSNP
rs747595536 1886 dbSNP
rs1360083321 1887 dbSNP
rs1029928054 1889 dbSNP
rs1249677759 1894 dbSNP
rs368222338 1895 dbSNP
rs1031023970 1901 dbSNP
rs1275420892 1903 dbSNP
rs1460222175 1909 dbSNP
rs1376810631 1915 dbSNP
rs1244215591 1920 dbSNP
rs1446968616 1931 dbSNP
rs981999568 1940 dbSNP
rs375802900 1942 dbSNP
rs549361840 1947 dbSNP
rs758851761 1948 dbSNP
rs140951686 1949 dbSNP
rs566492251 1950 dbSNP
rs1385100807 1953 dbSNP
rs1024004339 1963 dbSNP
rs1037529423 1964 dbSNP
rs1415554467 1965 dbSNP
rs1419186978 1971 dbSNP
rs115080545 1972 dbSNP
rs1476491123 1976 dbSNP
rs1424569271 1977 dbSNP
rs1383334374 1979 dbSNP
rs899034756 1986 dbSNP
rs1293400279 1990 dbSNP
rs1325890407 1991 dbSNP
rs1228273226 1996 dbSNP
rs779281493 2002 dbSNP
rs1015976848 2009 dbSNP
rs1004597335 2023 dbSNP
rs757353033 2024 dbSNP
rs1045571421 2031 dbSNP
rs1187560490 2033 dbSNP
rs4735537 2035 dbSNP
rs886077471 2039 dbSNP
rs544219182 2042 dbSNP
rs1259779607 2047 dbSNP
rs533250884 2048 dbSNP
rs575299264 2073 dbSNP
rs192802448 2074 dbSNP
rs942842681 2075 dbSNP
rs1197366673 2078 dbSNP
rs754849424 2088 dbSNP
rs1479245687 2091 dbSNP
rs1053844842 2095 dbSNP
rs979640642 2101 dbSNP
rs964566973 2108 dbSNP
rs1293392543 2111 dbSNP
rs151029082 2112 dbSNP
rs1354501885 2123 dbSNP
rs1384180727 2147 dbSNP
rs1327484944 2155 dbSNP
rs1280166635 2160 dbSNP
rs924048718 2170 dbSNP
rs982097765 2171 dbSNP
rs954466494 2173 dbSNP
rs970754040 2177 dbSNP
rs751572679 2185 dbSNP
rs916500038 2188 dbSNP
rs993114589 2189 dbSNP
rs562724970 2191 dbSNP
rs961972751 2198 dbSNP
rs1260587302 2202 dbSNP
rs1486479171 2209 dbSNP
rs766084347 2221 dbSNP
rs1207473919 2235 dbSNP
rs991148425 2235 dbSNP
rs1489662918 2240 dbSNP
rs1198191902 2242 dbSNP
rs1006110328 2247 dbSNP
rs372834615 2250 dbSNP
rs574018724 2251 dbSNP
rs1004696967 2255 dbSNP
rs1014116503 2274 dbSNP
rs560168750 2275 dbSNP
rs796460201 2276 dbSNP
rs1231070903 2279 dbSNP
rs1404442709 2283 dbSNP
rs1206594923 2284 dbSNP
rs368283101 2291 dbSNP
rs577657850 2302 dbSNP
rs1052474919 2305 dbSNP
rs1306725623 2315 dbSNP
rs935322796 2318 dbSNP
rs751097919 2319 dbSNP
rs113745204 2323 dbSNP
rs1044014014 2324 dbSNP
rs1273226695 2326 dbSNP
rs1221110058 2328 dbSNP
rs1222676500 2342 dbSNP
rs1489254957 2374 dbSNP
rs1175178497 2376 dbSNP
rs997135046 2381 dbSNP
rs1419494573 2382 dbSNP
rs114435030 2386 dbSNP
rs1383325956 2388 dbSNP
rs796803043 2390 dbSNP
rs1039920608 2394 dbSNP
rs1164295935 2397 dbSNP
rs1351749445 2403 dbSNP
rs1007564254 2406 dbSNP
rs537946262 2422 dbSNP
rs1325665952 2429 dbSNP
rs893949137 2431 dbSNP
rs575718932 2435 dbSNP
rs935517410 2437 dbSNP
rs924016196 2439 dbSNP
rs1449495134 2441 dbSNP
rs1313482766 2443 dbSNP
rs923020087 2450 dbSNP
rs555555449 2453 dbSNP
rs535729848 2465 dbSNP
rs761277016 2470 dbSNP
rs1400166757 2471 dbSNP
rs949326797 2480 dbSNP
rs1201966797 2481 dbSNP
rs1250441440 2489 dbSNP
rs1458004654 2493 dbSNP
rs566871772 2497 dbSNP
rs1178813489 2498 dbSNP
rs1440258069 2501 dbSNP
rs1252098627 2506 dbSNP
rs1191548434 2508 dbSNP
rs1180289174 2528 dbSNP
rs776091152 2530 dbSNP
rs1469683424 2531 dbSNP
rs1241120158 2537 dbSNP
rs555475259 2541 dbSNP
rs1006576836 2554 dbSNP
rs1416019132 2556 dbSNP
rs1408313588 2562 dbSNP
rs990724093 2565 dbSNP
rs1169951371 2569 dbSNP
rs963643032 2576 dbSNP
rs969320552 2578 dbSNP
rs909159792 2596 dbSNP
rs1314607149 2603 dbSNP
rs546582333 2604 dbSNP
rs747454625 2613 dbSNP
rs868203515 2625 dbSNP
rs1380656009 2632 dbSNP
rs1212312585 2633 dbSNP
rs950591951 2634 dbSNP
rs1052528884 2635 dbSNP
rs766241220 2636 dbSNP
rs1460738064 2638 dbSNP
rs541621346 2639 dbSNP
rs1210684481 2642 dbSNP
rs1239160448 2643 dbSNP
rs772255026 2644 dbSNP
rs1474434944 2646 dbSNP
rs1439116089 2650 dbSNP
rs868091314 2659 dbSNP
rs903873194 2660 dbSNP
rs1373706549 2664 dbSNP
rs539413001 2671 dbSNP
rs964379323 2672 dbSNP
rs532518781 2673 dbSNP
rs758358939 2673 dbSNP
rs570828466 2679 dbSNP
rs1017704819 2683 dbSNP
rs564545726 2684 dbSNP
rs1420195832 2686 dbSNP
rs1394372269 2688 dbSNP
rs111855435 2689 dbSNP
rs1032631039 2690 dbSNP
rs1129891 2692 dbSNP
rs1340653421 2702 dbSNP
rs1220056466 2704 dbSNP
rs1281017126 2709 dbSNP
rs868208539 2712 dbSNP
rs918728282 2713 dbSNP
rs1445206480 2729 dbSNP
rs1215056147 2733 dbSNP
rs141598979 2735 dbSNP
rs62522243 2737 dbSNP
rs546598612 2738 dbSNP
rs565004015 2738 dbSNP
rs908913621 2738 dbSNP
rs969750679 2738 dbSNP
rs949513722 2739 dbSNP
rs1400620170 2743 dbSNP
rs188233216 2745 dbSNP
rs992451731 2745 dbSNP
rs1360564374 2756 dbSNP
rs895125498 2758 dbSNP
rs1300841175 2759 dbSNP
rs1055522669 2761 dbSNP
rs1344481942 2763 dbSNP
rs1485081585 2765 dbSNP
rs942076579 2774 dbSNP
rs540541982 2778 dbSNP
rs577517721 2785 dbSNP
rs182811079 2787 dbSNP
rs1314244322 2788 dbSNP
rs1286691812 2811 dbSNP
rs191297959 2814 dbSNP
rs1355881988 2817 dbSNP
rs983333138 2820 dbSNP
rs147902246 2824 dbSNP
rs1030816856 2835 dbSNP
rs1201348275 2840 dbSNP
rs1231504889 2842 dbSNP
rs1469977841 2853 dbSNP
rs144453644 2854 dbSNP
rs1360174075 2859 dbSNP
rs1022751051 2860 dbSNP
rs756283843 2862 dbSNP
rs186563656 2863 dbSNP
rs1364478760 2867 dbSNP
rs1405571677 2870 dbSNP
rs1325160825 2874 dbSNP
rs1333724959 2878 dbSNP
rs975778792 2883 dbSNP
rs1309815736 2885 dbSNP
rs964796258 2891 dbSNP
rs1290899516 2898 dbSNP
rs1017385347 2899 dbSNP
rs1243767872 2900 dbSNP
rs990216618 2905 dbSNP
rs1357199685 2913 dbSNP
rs183332669 2919 dbSNP
rs1271179181 2923 dbSNP
rs1310992268 2934 dbSNP
rs190829660 2935 dbSNP
rs1377925082 2939 dbSNP
rs1240488746 2955 dbSNP
rs1205742892 2959 dbSNP
rs999788657 2959 dbSNP
rs1443312776 2965 dbSNP
rs1183567760 2972 dbSNP
rs934223236 2978 dbSNP
rs553206992 2979 dbSNP
rs902655698 2989 dbSNP
rs1164590473 3004 dbSNP
rs1037150714 3014 dbSNP
rs1193995587 3018 dbSNP
rs1025166722 3019 dbSNP
rs1402262953 3021 dbSNP
rs908960516 3022 dbSNP
rs186881675 3029 dbSNP
rs1254859480 3040 dbSNP
rs984909071 3046 dbSNP
rs540148824 3054 dbSNP
rs1268575348 3060 dbSNP
rs1338977845 3061 dbSNP
rs1199571861 3069 dbSNP
rs1260373260 3075 dbSNP
rs570723042 3092 dbSNP
rs1203542953 3100 dbSNP
rs758083739 3107 dbSNP
rs865881951 3109 dbSNP
rs1189023896 3111 dbSNP
rs916202784 3112 dbSNP
rs1477281478 3113 dbSNP
rs1171005667 3118 dbSNP
rs992107247 3119 dbSNP
rs570341288 3121 dbSNP
rs557361778 3130 dbSNP
rs1306175882 3131 dbSNP
rs960593445 3143 dbSNP
rs941985673 3159 dbSNP
rs544699530 3176 dbSNP
rs1340003298 3178 dbSNP
rs750251983 3200 dbSNP
rs1219448110 3203 dbSNP
rs1047607018 3209 dbSNP
rs568616196 3224 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Calin GA; Cimmino A; Fabbri M; Ferracin M; et al.
- Proceedings of the National Academy of Sciences of the United States of America, 2008
MicroRNAs (miRNAs) are short noncoding RNAs regulating gene expression that play roles in human diseases, including cancer. Each miRNA is predicted to regulate hundreds of transcripts, but only few have experimental validation. In chronic lymphocytic leukemia (CLL), the most common adult human leukemia, miR-15a and miR-16-1 are lost or down-regulated in the majority of cases. After our previous work indicating a tumor suppressor function of miR-15a/16-1 by targeting the BCL2 oncogene, here, we produced a high-throughput profiling of genes modulated by miR-15a/16-1 in a leukemic cell line model (MEG-01) and in primary CLL samples. By combining experimental and bioinformatics data, we identified a miR-15a/16-1-gene signature in leukemic cells. Among the components of the miR-15a/16-1 signature, we observed a statistically significant enrichment in AU-rich elements (AREs). By examining the Gene Ontology (GO) database, a significant enrichment in cancer genes (such as MCL1, BCL2, ETS1, or JUN) that directly or indirectly affect apoptosis and cell cycle was found.
LinkOut: [PMID: 18362358]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*