miRTarBase - #MIRT003888 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CADM1   
Synonyms BL2, IGSF4, IGSF4A, NECL2, Necl-2, RA175, ST17, SYNCAM, TSLC1, sTSLC-1, sgIGSF, synCAM1
Description cell adhesion molecule 1
Transcript NM_001098517   
Other Transcripts NM_014333   
Expression
Putative miRNA Targets on CADM1
3'UTR of CADM1
(miRNA target sites are highlighted)
>CADM1|NM_001098517|3'UTR
   1 ATCAGCCTTTTTGTTTCAATGAGGTGTCCAACTGGCCCTATTTAGATGATAAAGAGACAGTGATATTGGAACTTGCGAGA
  81 AATTCGTGTGTTTTTTTATGAATGGGTGGAAAGGTGTGAGACTGGGAAGGCTTGGGATTTGCTGTGTAAAAAAAAAAAAA
 161 ATGTTCTTTGGAAAGTACACTCTGCTGTTTGACACCTCTTTTTTCGTTTGTTTGTTTGTTTAATTTTTATTTCTTCCTAC
 241 CAAGTCAAACTTGGATACTTGGATTTAGTTTCAGTAGATTGCAGAAAATTCTGTGCCTTGTTTTTTGTTTGTTTGTTGCG
 321 TTCCTTTCTTTTCCCCCTTTGTGCACATTTATTTCCTCCCTCTACCCCAATTTCGGATTTTTTCCAAAATCTCCCATTTT
 401 GGAATTTGCCTGCTGGGATTCCTTAGACTCTTTTCCTTCCCTTTTCTGTTCTAGTTTTTTACTTTTGTTTATTTTTATGG
 481 TAACTGCTTTCTGTTCCAAATTCAGTTTCATAAAAGGAGAACCAGCACAGCTTAGATTTCATAGTTCAGAATTTAGTGTA
 561 TCCATAATGCATTCTTCTCTGTTGTCGTAAAGATTTGGGTGAACAAACAATGAAAACTCTTTGCTGCTGCCCATGTTTCA
 641 AATACTTAGAGCAGTGAAGACTAGAAAATTAGACTGTGATTCAGAAAATGTTCTGTTTGCTGTGGAACTACATTACTGTA
 721 CAGGGTTATCTGCAAGTGAGGTGTGTCACAATGAGATTGAATTTCACTGTCTTTAATTCTGTATCTGTAGACGGCTCAGT
 801 ATAGATACCCTACGCTGTCCAGAAAGGTTTGGGGCAGAAAGGACTCCTCCTTTTTCCATGCCCTAAACAGACCTGACAGG
 881 TGAGGTCTGTTCCTTTTATATAAGTGGACAAATTTTGAGTTGCCACAGGAGGGGAAGTAGGGAGGGGGGAAATACAGTTC
 961 TGCTCTGGTTGTTTCTGTTCCAAATGATTCCATCCACCTTTCCCAATCGGCCTTACTTCTCACTAATTTGTAGGAAAAAG
1041 CAAGTTCGTCTGTTGTGCGAATGACTGAATGGGACAGAGTTGATTTTTTTTTTTTTTTCCTTTGTGCTTAGTTAGGAAGG
1121 CAGTAGGATGTGGCCTGCATGTACTGTATATTACAGATATTTGTCATGCTGGGATTTCCAACTCGAATCTGTGTGAAACT
1201 TTCATTCCTTCAGATTTGGCTTGACAAAGGCAGGAGGTACAAAAGAAGGGCTGGTATTGTTCTCACACTGGTCTGCTGTC
1281 GCTCTCAGTTCTCGATAGGTCAGAGCAGAGGTGGAAAAACAGCATGTACGGATTTTCAGTTACTTAATCAAAACTCAAAT
1361 GTGAGTGTTTTTATCTTTTTACCTTTCATACACTAGCCTTGGCCTCTTTCCTCAGCCTTAAGAACCATCTGCCAAAAATT
1441 ACTGATCCTCGCATGATGGCAGCCATAGTGCATAGCTACTAAAATCAGTGACCTTGAACATATCTTAGATGGGGAGCCTC
1521 GGGAAAAGGTAGAGGAGTCACGTTACCATTTACATGTTTTAAAGAAAGAAGTGTGGGGATTTTCACTGAAACGTCTAGGA
1601 AATCTAGAAGTAGTCCTGAAGGACAGAAACTAAACTCTTACCATATGTTTGGTAAGACTCCAGACTCCAGCTAACAGTCC
1681 CTATGGAAAGATGGCATCAAAAAAGATAGATCTATATATATATATAAATATATATTCTATTACATTTTCAGTGAGTAATT
1761 TTGGATTTTGCAAGGTGCATTTTTACTATTGTTACATTATGTGGAAAACTTATGCTGATTTATTTAAGGGGGAAAAAGTG
1841 TCAACTCTTTGTTATTTGAAAACATGTTTATTTTTCTTGTCTTTATTTTAACCTTTGATAGAACCATTGCAATATGGGGG
1921 CCTTTTGGGAACGGACTGGTATGTAAAAGAAAATCCATTATCGAGCAGCATTTTATTTACCCCTCCCCTATCCCTAGGCA
2001 CTTAACCAAGACAAAAAGCCACAATGAACATCCCTTTTTCAATGAATTTTATAATCTGCAGCTCTATTCCGAGCCCTTAG
2081 CACCCATTCCGACCATAGTATAATCATATCAAAGGGTGAGAATCATTTAGCATGTTGTTGAAAGGTTTTTTTTCAGTTGT
2161 TCTTTTTAGAAAAAAAGAAAAACAAAAACAAAAACAAAAAAAAAAAATCACACCATTGCTCACAGAATTGGCATCTCATT
2241 TTTGGGACCTCCCATCTTTCTGTTTTGAAAAGTGTACAGTAGTGCAGTGTTCCTGATGTAACTTTATGGCTTACAATGTT
2321 GACATGTCTCAGGTTCATGTGTTGCGATTGGTGTTTTCCGTCTCAGGTAGATTGCAAAGTGTAGGCCCCACACATTGGAA
2401 AAAATAATAATAAAACAAAGCAAAAACAGGAAATTATGGATTTTAGTTGTATATTGGTTTATGTATTTTTTCTTAAGTAT
2481 ACAGTGCACTGTTTGAAATGTATTGTTGAGTATTACTTTGTACAGGTTGATCACTTTTTTTAGAGTGAAGAAAGAACAAA
2561 CTTGTTTTTTGTGTTTTTTAAAGGAATATAAAATAATGAAGGATGTATAATTGATGCCAAATAAGCTTGTTCTTTAGTCA
2641 CACCGACGTCTTATTTTTCCCTTTAGGCCAGTTCTGTTTTTAAGGTGTACATGGACAATGTTACAGTGTAAGAAACTCCA
2721 TATCCATATGTTCCCATTCGCATTTTGTATTGGTTCATGTATACCATTTTTACAAAAAAAAAAAGAAAAAAAAGAAGTAC
2801 TATAAAATATCTGTCTTCTTAATAAAAAAAAATTAATGTTACAAAGTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA------AUACACGACGAu 5'
            ||||| ||      | | ||||||| 
Target 5' aaCAAACAATGAAAACTCTTTGCTGCTg 3'
602 - 629 158.00 -13.80
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||| :|   | |||||:| 
Target 5' tggAAAGTACACTCTGCTGTTt 3'
169 - 190 135.00 -8.90
3
miRNA  3' gugUUUGGUAAUAC--ACGACGAu 5'
             :||:||||  |  ||:||:| 
Target 5' tgaGAATCATTTAGCATGTTGTTg 3'
2117 - 2140 129.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28201854 2 COSMIC
COSN2374751 17 COSMIC
COSN30145522 48 COSMIC
COSN30526410 67 COSMIC
COSN4891969 73 COSMIC
COSN26969009 79 COSMIC
COSN13302497 85 COSMIC
COSN26969011 86 COSMIC
COSN30122060 86 COSMIC
COSN507371 90 COSMIC
COSN26969010 91 COSMIC
COSN31522805 107 COSMIC
COSN31560706 112 COSMIC
COSN30096170 118 COSMIC
COSN30509167 124 COSMIC
COSN27240389 148 COSMIC
COSN31604108 191 COSMIC
COSN31558791 205 COSMIC
COSN30126260 222 COSMIC
COSN28963084 226 COSMIC
COSN8939111 234 COSMIC
COSN30161593 262 COSMIC
COSN8640900 320 COSMIC
COSN31599455 332 COSMIC
COSN31535270 349 COSMIC
COSN30540630 362 COSMIC
COSN31481861 451 COSMIC
COSN26580087 599 COSMIC
COSN26601924 609 COSMIC
COSN8640899 672 COSMIC
COSN26547718 721 COSMIC
COSN15254064 726 COSMIC
COSN31596763 726 COSMIC
COSN23770940 844 COSMIC
COSN16884056 865 COSMIC
COSN16628369 949 COSMIC
COSN31589280 1008 COSMIC
COSN20108787 1084 COSMIC
COSN18995842 1097 COSMIC
COSN17370900 1108 COSMIC
COSN31960694 1200 COSMIC
COSN31536795 1271 COSMIC
COSN19137551 1284 COSMIC
COSN15662323 1294 COSMIC
COSN28669136 1305 COSMIC
COSN31545308 1318 COSMIC
COSN31561609 1329 COSMIC
COSN31567729 1330 COSMIC
COSN31540077 1390 COSMIC
COSN30540964 1446 COSMIC
COSN30540974 1447 COSMIC
COSN27177084 1471 COSMIC
COSN18826963 1490 COSMIC
COSN31553214 1534 COSMIC
COSN26558787 1541 COSMIC
COSN31588809 1641 COSMIC
COSN27928946 1712 COSMIC
COSN31595167 1774 COSMIC
COSN31584288 1887 COSMIC
COSN28692958 1957 COSMIC
COSN31562744 1988 COSMIC
COSN31519137 2046 COSMIC
COSN31538209 2070 COSMIC
COSN8640898 2091 COSMIC
COSN31576877 2143 COSMIC
COSN28784400 2177 COSMIC
COSN20108785 2196 COSMIC
COSN23478773 2198 COSMIC
COSN17578540 2199 COSMIC
COSN8733105 2267 COSMIC
COSN17715132 2401 COSMIC
COSN15661844 2523 COSMIC
COSN20173171 2529 COSMIC
COSN15660708 2534 COSMIC
COSN16692924 2763 COSMIC
COSN16897813 2772 COSMIC
COSN20108780 2773 COSMIC
COSN17641447 2779 COSMIC
COSN1514984 2799 COSMIC
COSN22425402 3034 COSMIC
COSN15771705 3044 COSMIC
COSN14514580 3135 COSMIC
COSN8939110 3170 COSMIC
COSN27237768 3188 COSMIC
COSN1514983 3676 COSMIC
COSN22563830 3990 COSMIC
COSN16796846 4044 COSMIC
COSN5823561 4059 COSMIC
COSN19536467 4060 COSMIC
COSN17739614 4104 COSMIC
COSN5895737 4105 COSMIC
COSN15773942 4204 COSMIC
COSN5895736 4271 COSMIC
COSN5895735 4272 COSMIC
COSN28438920 4520 COSMIC
COSN19205725 4538 COSMIC
COSN27318419 4950 COSMIC
COSN8733104 5017 COSMIC
COSN23788966 5071 COSMIC
COSN24035520 5135 COSMIC
COSN6986804 5277 COSMIC
COSN8214101 5604 COSMIC
COSN28398136 5932 COSMIC
COSN17437667 6276 COSMIC
COSN1514982 6577 COSMIC
COSN10078558 6661 COSMIC
COSN14907478 6690 COSMIC
COSN20083467 6866 COSMIC
COSN8640897 6898 COSMIC
COSN30629093 6948 COSMIC
COSN17080138 7133 COSMIC
COSN14981107 7134 COSMIC
COSN8214100 7166 COSMIC
COSN29637090 7174 COSMIC
rs4445669 1957 GWAS
rs1048932 2344 GWAS
rs5794958 2832 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs187836376 6 dbSNP
rs376057380 13 dbSNP
rs1351575590 15 dbSNP
rs1016177527 19 dbSNP
rs770626792 20 dbSNP
rs762526089 23 dbSNP
rs1017988992 31 dbSNP
rs1007863480 35 dbSNP
rs772554539 37 dbSNP
rs952853756 38 dbSNP
rs1217028762 40 dbSNP
rs374411065 46 dbSNP
rs955652504 52 dbSNP
rs1271818842 56 dbSNP
rs1288307569 59 dbSNP
rs1026292406 63 dbSNP
rs1445765121 66 dbSNP
rs994358952 72 dbSNP
rs898686354 76 dbSNP
rs1242342616 85 dbSNP
rs1033742464 86 dbSNP
rs1001611713 88 dbSNP
rs905946989 91 dbSNP
rs1158044890 92 dbSNP
rs1359965817 98 dbSNP
rs1045712772 106 dbSNP
rs1398248892 113 dbSNP
rs77073251 114 dbSNP
rs1377492874 119 dbSNP
rs1447700771 125 dbSNP
rs1282751865 126 dbSNP
rs1362120460 127 dbSNP
rs1247326964 129 dbSNP
rs1285940991 136 dbSNP
rs1166966740 138 dbSNP
rs1206409290 142 dbSNP
rs1261935881 145 dbSNP
rs1427950824 147 dbSNP
rs1420340831 152 dbSNP
rs1188403736 157 dbSNP
rs1445078220 160 dbSNP
rs1052810983 162 dbSNP
rs1451678965 162 dbSNP
rs201580425 162 dbSNP
rs1472076209 163 dbSNP
rs867847268 163 dbSNP
rs1002716280 166 dbSNP
rs906661337 175 dbSNP
rs1414114895 177 dbSNP
rs925147468 179 dbSNP
rs979252806 186 dbSNP
rs1025153690 196 dbSNP
rs796857387 199 dbSNP
rs140480084 201 dbSNP
rs544033294 202 dbSNP
rs1054063291 205 dbSNP
rs936337062 206 dbSNP
rs888799810 209 dbSNP
rs1297069310 210 dbSNP
rs1226157965 214 dbSNP
rs1264632740 215 dbSNP
rs1197817985 222 dbSNP
rs746554513 222 dbSNP
rs1420787715 223 dbSNP
rs182085717 237 dbSNP
rs1364439980 241 dbSNP
rs933073126 257 dbSNP
rs1477745320 258 dbSNP
rs1174457877 264 dbSNP
rs1408613286 272 dbSNP
rs1470479397 275 dbSNP
rs1331068465 284 dbSNP
rs555261877 291 dbSNP
rs1393643540 292 dbSNP
rs1416335387 293 dbSNP
rs1308411192 296 dbSNP
rs1348405800 297 dbSNP
rs1048876 300 dbSNP
rs1306352688 308 dbSNP
rs1284764190 310 dbSNP
rs1323839678 314 dbSNP
rs1197682134 318 dbSNP
rs751783702 319 dbSNP
rs536612468 320 dbSNP
rs771908435 332 dbSNP
rs573958980 336 dbSNP
rs1451068362 350 dbSNP
rs1197388573 362 dbSNP
rs764350445 366 dbSNP
rs1355374018 368 dbSNP
rs962987822 375 dbSNP
rs971871295 376 dbSNP
rs1017090826 395 dbSNP
rs34004242 400 dbSNP
rs1403733118 408 dbSNP
rs1001619960 410 dbSNP
rs554190790 415 dbSNP
rs1024316858 418 dbSNP
rs1014330617 420 dbSNP
rs891814089 440 dbSNP
rs45483591 441 dbSNP
rs1304412781 451 dbSNP
rs1476367122 455 dbSNP
rs147201089 458 dbSNP
rs984687491 460 dbSNP
rs1345644428 461 dbSNP
rs935280605 461 dbSNP
rs571810448 466 dbSNP
rs952718082 481 dbSNP
rs1308966702 482 dbSNP
rs903739107 487 dbSNP
rs1264741618 493 dbSNP
rs1034097980 505 dbSNP
rs1354139184 515 dbSNP
rs1224681405 519 dbSNP
rs1271134329 520 dbSNP
rs980844016 520 dbSNP
rs1490550927 535 dbSNP
rs758835265 536 dbSNP
rs1025102967 541 dbSNP
rs1480737581 546 dbSNP
rs1430624364 551 dbSNP
rs1171592558 554 dbSNP
rs1009719666 557 dbSNP
rs1423260520 563 dbSNP
rs551988854 569 dbSNP
rs746288932 571 dbSNP
rs538469438 586 dbSNP
rs569544840 587 dbSNP
rs1363661832 595 dbSNP
rs189748021 597 dbSNP
rs570239160 598 dbSNP
rs528842582 602 dbSNP
rs918284517 607 dbSNP
rs1444623907 621 dbSNP
rs1273666081 629 dbSNP
rs1235080997 633 dbSNP
rs972417406 636 dbSNP
rs962938580 637 dbSNP
rs1327054211 640 dbSNP
rs1287449803 641 dbSNP
rs1259137460 645 dbSNP
rs867214168 651 dbSNP
rs888755214 660 dbSNP
rs1255904221 663 dbSNP
rs1443177212 678 dbSNP
rs781402830 679 dbSNP
rs1386442267 680 dbSNP
rs1418504793 682 dbSNP
rs970231506 687 dbSNP
rs1024410091 688 dbSNP
rs1453992292 690 dbSNP
rs1301954874 694 dbSNP
rs559899038 704 dbSNP
rs1454381558 714 dbSNP
rs1300128328 715 dbSNP
rs879058435 718 dbSNP
rs891871618 722 dbSNP
rs1304925892 731 dbSNP
rs1434308642 734 dbSNP
rs546624749 739 dbSNP
rs901585030 743 dbSNP
rs1216757699 755 dbSNP
rs1255628988 768 dbSNP
rs1393872067 769 dbSNP
rs1205989912 773 dbSNP
rs1244181830 778 dbSNP
rs1166224310 779 dbSNP
rs1176052143 781 dbSNP
rs1409512813 783 dbSNP
rs758071943 792 dbSNP
rs1036101117 793 dbSNP
rs940501632 804 dbSNP
rs909070381 808 dbSNP
rs1403483943 809 dbSNP
rs1470805941 810 dbSNP
rs1158830242 811 dbSNP
rs1032098832 812 dbSNP
rs1000161176 813 dbSNP
rs1252160466 814 dbSNP
rs532868294 825 dbSNP
rs1043634882 826 dbSNP
rs1467609027 827 dbSNP
rs1224432467 829 dbSNP
rs1253054234 831 dbSNP
rs1215063108 834 dbSNP
rs1321642456 840 dbSNP
rs1006799025 841 dbSNP
rs1326984042 845 dbSNP
rs563864463 846 dbSNP
rs1202966251 848 dbSNP
rs889645275 856 dbSNP
rs1480651481 861 dbSNP
rs1190151686 870 dbSNP
rs1260129145 875 dbSNP
rs543972819 879 dbSNP
rs778510591 884 dbSNP
rs754447706 887 dbSNP
rs1422643657 892 dbSNP
rs1318508065 893 dbSNP
rs1408019006 909 dbSNP
rs575111056 927 dbSNP
rs1355059874 928 dbSNP
rs1435729635 936 dbSNP
rs374703534 940 dbSNP
rs1343789098 941 dbSNP
rs1370597152 942 dbSNP
rs1284180005 943 dbSNP
rs1339068401 944 dbSNP
rs559831323 945 dbSNP
rs1275664727 946 dbSNP
rs1037125314 949 dbSNP
rs1443284913 950 dbSNP
rs941003920 955 dbSNP
rs1490715126 964 dbSNP
rs753318832 982 dbSNP
rs573138060 984 dbSNP
rs1474274382 987 dbSNP
rs186834100 989 dbSNP
rs1420009150 992 dbSNP
rs753069422 994 dbSNP
rs1404689577 996 dbSNP
rs183214086 997 dbSNP
rs765865944 998 dbSNP
rs1032521333 1004 dbSNP
rs1426631172 1006 dbSNP
rs578129155 1008 dbSNP
rs756033089 1009 dbSNP
rs750299940 1010 dbSNP
rs917440920 1017 dbSNP
rs1245870775 1019 dbSNP
rs1290240211 1022 dbSNP
rs74721216 1048 dbSNP
rs761316780 1049 dbSNP
rs1282998982 1054 dbSNP
rs1453387699 1055 dbSNP
rs997580686 1058 dbSNP
rs538409766 1059 dbSNP
rs1242471173 1064 dbSNP
rs1443791622 1069 dbSNP
rs530293329 1077 dbSNP
rs1036048267 1082 dbSNP
rs1463169098 1083 dbSNP
rs1260873433 1090 dbSNP
rs1164270334 1095 dbSNP
rs968734581 1097 dbSNP
rs1491503095 1098 dbSNP
rs201815214 1098 dbSNP
rs1210231519 1099 dbSNP
rs1313488596 1099 dbSNP
rs1399173771 1099 dbSNP
rs397975978 1099 dbSNP
rs56789298 1099 dbSNP
rs59639020 1099 dbSNP
rs796751592 1099 dbSNP
rs1486695172 1100 dbSNP
rs1254004061 1101 dbSNP
rs1209945502 1104 dbSNP
rs1347423403 1106 dbSNP
rs1304520159 1108 dbSNP
rs1017598335 1113 dbSNP
rs569484067 1121 dbSNP
rs1284523023 1122 dbSNP
rs1363128075 1126 dbSNP
rs1460673846 1143 dbSNP
rs1295447453 1146 dbSNP
rs1006848211 1160 dbSNP
rs1004590557 1168 dbSNP
rs889697669 1172 dbSNP
rs1445136850 1173 dbSNP
rs1383294315 1181 dbSNP
rs542030545 1184 dbSNP
rs528106440 1185 dbSNP
rs567968562 1197 dbSNP
rs1413020797 1202 dbSNP
rs1375612295 1205 dbSNP
rs1175131773 1215 dbSNP
rs1408840850 1218 dbSNP
rs1447088627 1227 dbSNP
rs1328786947 1236 dbSNP
rs1333408632 1238 dbSNP
rs997988369 1239 dbSNP
rs896912155 1244 dbSNP
rs1430207360 1247 dbSNP
rs1036813716 1248 dbSNP
rs1221349321 1256 dbSNP
rs1264768058 1270 dbSNP
rs1461650182 1273 dbSNP
rs937227901 1275 dbSNP
rs1186943129 1280 dbSNP
rs535774069 1281 dbSNP
rs1281229048 1291 dbSNP
rs1045678489 1294 dbSNP
rs764344768 1295 dbSNP
rs191798331 1296 dbSNP
rs1250796871 1302 dbSNP
rs1174620327 1305 dbSNP
rs917941534 1320 dbSNP
rs988190981 1329 dbSNP
rs1328692707 1330 dbSNP
rs1395006848 1340 dbSNP
rs1393686525 1346 dbSNP
rs1291990254 1358 dbSNP
rs567184538 1361 dbSNP
rs1356536253 1366 dbSNP
rs1284809446 1369 dbSNP
rs546254273 1372 dbSNP
rs1323916079 1411 dbSNP
rs925397744 1414 dbSNP
rs1226444910 1415 dbSNP
rs1249501827 1424 dbSNP
rs1341366371 1428 dbSNP
rs979990828 1431 dbSNP
rs1252625100 1433 dbSNP
rs953603081 1442 dbSNP
rs956203559 1444 dbSNP
rs1029632638 1450 dbSNP
rs997798362 1451 dbSNP
rs532784474 1453 dbSNP
rs978864643 1455 dbSNP
rs563802919 1459 dbSNP
rs965645482 1464 dbSNP
rs968785176 1465 dbSNP
rs1371751829 1467 dbSNP
rs1463966338 1472 dbSNP
rs1395377280 1474 dbSNP
rs186890843 1475 dbSNP
rs763174763 1479 dbSNP
rs1007530183 1488 dbSNP
rs1367898403 1490 dbSNP
rs887523125 1500 dbSNP
rs1328054761 1513 dbSNP
rs1187146901 1517 dbSNP
rs117706029 1520 dbSNP
rs1259388827 1521 dbSNP
rs1358758199 1523 dbSNP
rs564214197 1531 dbSNP
rs1029553586 1540 dbSNP
rs760435135 1541 dbSNP
rs1001760930 1542 dbSNP
rs905708241 1547 dbSNP
rs143642985 1554 dbSNP
rs1430666329 1558 dbSNP
rs546124743 1569 dbSNP
rs949956711 1573 dbSNP
rs561542267 1578 dbSNP
rs913188173 1584 dbSNP
rs1442193377 1592 dbSNP
rs1164897386 1593 dbSNP
rs1052432833 1597 dbSNP
rs1333314472 1605 dbSNP
rs1271778452 1610 dbSNP
rs1015842883 1614 dbSNP
rs935344014 1618 dbSNP
rs1295466130 1624 dbSNP
rs888163109 1625 dbSNP
rs1440549467 1630 dbSNP
rs1334791975 1635 dbSNP
rs1314245063 1641 dbSNP
rs1380450179 1643 dbSNP
rs1329145668 1645 dbSNP
rs1392559585 1656 dbSNP
rs925348005 1660 dbSNP
rs1044044342 1661 dbSNP
rs1215247059 1671 dbSNP
rs948367982 1673 dbSNP
rs528083931 1683 dbSNP
rs1057398936 1696 dbSNP
rs1242958067 1699 dbSNP
rs1460364180 1704 dbSNP
rs1186041291 1705 dbSNP
rs953649521 1709 dbSNP
rs1164074960 1711 dbSNP
rs1418015126 1712 dbSNP
rs1156433856 1714 dbSNP
rs1461877415 1715 dbSNP
rs182067357 1715 dbSNP
rs1457480409 1716 dbSNP
rs528360416 1719 dbSNP
rs761373764 1721 dbSNP
rs1454507569 1723 dbSNP
rs1156664369 1724 dbSNP
rs745547300 1727 dbSNP
rs756789559 1727 dbSNP
rs978915254 1727 dbSNP
rs1379909846 1729 dbSNP
rs559628601 1731 dbSNP
rs947458147 1737 dbSNP
rs1363370375 1739 dbSNP
rs922127139 1743 dbSNP
rs1331443695 1755 dbSNP
rs976269515 1770 dbSNP
rs1229291434 1772 dbSNP
rs966257627 1775 dbSNP
rs1262908873 1777 dbSNP
rs1460266617 1778 dbSNP
rs1206062912 1788 dbSNP
rs1238582120 1790 dbSNP
rs1015167716 1796 dbSNP
rs796172373 1801 dbSNP
rs1439583150 1809 dbSNP
rs986148013 1813 dbSNP
rs954763646 1815 dbSNP
rs1030729315 1818 dbSNP
rs540237298 1821 dbSNP
rs1470840754 1826 dbSNP
rs10540049 1827 dbSNP
rs150204837 1827 dbSNP
rs951742707 1832 dbSNP
rs1015391902 1833 dbSNP
rs961583741 1833 dbSNP
rs1296496411 1837 dbSNP
rs1352483358 1838 dbSNP
rs1410599740 1838 dbSNP
rs1005304577 1842 dbSNP
rs888216105 1843 dbSNP
rs578083118 1847 dbSNP
rs1022639236 1851 dbSNP
rs1221327275 1851 dbSNP
rs1307404479 1858 dbSNP
rs1203106690 1868 dbSNP
rs530321178 1895 dbSNP
rs1276149130 1897 dbSNP
rs1275664536 1901 dbSNP
rs1013066779 1905 dbSNP
rs1198167034 1911 dbSNP
rs1266357100 1914 dbSNP
rs558244128 1915 dbSNP
rs1057196362 1928 dbSNP
rs7939813 1932 dbSNP
rs903398594 1933 dbSNP
rs905653115 1938 dbSNP
rs947512365 1939 dbSNP
rs1240775017 1942 dbSNP
rs575858389 1954 dbSNP
rs978974890 1956 dbSNP
rs4445669 1957 dbSNP
rs986239576 1959 dbSNP
rs933398711 1960 dbSNP
rs116847835 1962 dbSNP
rs1316134868 1983 dbSNP
rs1053053345 1986 dbSNP
rs1399853884 1988 dbSNP
rs35314086 1989 dbSNP
rs34970067 1994 dbSNP
rs935293358 2009 dbSNP
rs903874170 2011 dbSNP
rs1289005734 2013 dbSNP
rs1452948440 2022 dbSNP
rs1221918138 2030 dbSNP
rs567022947 2034 dbSNP
rs113918357 2041 dbSNP
rs747868885 2059 dbSNP
rs1044162113 2061 dbSNP
rs1471262729 2066 dbSNP
rs932094477 2069 dbSNP
rs1188152731 2070 dbSNP
rs139184287 2071 dbSNP
rs983933525 2075 dbSNP
rs976217232 2078 dbSNP
rs944896586 2090 dbSNP
rs778473450 2091 dbSNP
rs1344917423 2092 dbSNP
rs1446738860 2095 dbSNP
rs1023002297 2096 dbSNP
rs773095704 2099 dbSNP
rs1366514762 2102 dbSNP
rs1207306536 2105 dbSNP
rs1345271781 2107 dbSNP
rs983681344 2116 dbSNP
rs1228483226 2119 dbSNP
rs1302248543 2130 dbSNP
rs1283150826 2132 dbSNP
rs1445030356 2133 dbSNP
rs960048838 2135 dbSNP
rs1035369824 2142 dbSNP
rs1460808488 2149 dbSNP
rs1372576719 2153 dbSNP
rs1268296158 2154 dbSNP
rs1366726132 2154 dbSNP
rs998887253 2154 dbSNP
rs903454525 2155 dbSNP
rs1043300396 2161 dbSNP
rs1429907359 2169 dbSNP
rs1345756238 2170 dbSNP
rs1407568366 2176 dbSNP
rs1011818607 2177 dbSNP
rs1399215291 2177 dbSNP
rs889327697 2181 dbSNP
rs1432693572 2183 dbSNP
rs1373805179 2186 dbSNP
rs1448360557 2187 dbSNP
rs1173255832 2189 dbSNP
rs1435377867 2191 dbSNP
rs3210211 2192 dbSNP
rs1229913350 2195 dbSNP
rs1348074563 2195 dbSNP
rs1322564851 2196 dbSNP
rs753529730 2196 dbSNP
rs764036775 2196 dbSNP
rs570123755 2198 dbSNP
rs550202781 2199 dbSNP
rs933428430 2199 dbSNP
rs1188294233 2200 dbSNP
rs980224746 2200 dbSNP
rs374571246 2201 dbSNP
rs748855180 2201 dbSNP
rs923312381 2201 dbSNP
rs1243270724 2202 dbSNP
rs1469634074 2202 dbSNP
rs1195704823 2203 dbSNP
rs1036385505 2206 dbSNP
rs1404945496 2206 dbSNP
rs1279112116 2207 dbSNP
rs10565366 2208 dbSNP
rs1195215969 2208 dbSNP
rs1333550960 2208 dbSNP
rs1344583969 2208 dbSNP
rs58008560 2208 dbSNP
rs775225867 2208 dbSNP
rs796123288 2208 dbSNP
rs796376551 2208 dbSNP
rs940659654 2208 dbSNP
rs1272369640 2215 dbSNP
rs1024498214 2216 dbSNP
rs1211180718 2225 dbSNP
rs1482115248 2231 dbSNP
rs1184557569 2238 dbSNP
rs1349660311 2247 dbSNP
rs1480256778 2254 dbSNP
rs909202569 2255 dbSNP
rs984025018 2256 dbSNP
rs1167850017 2260 dbSNP
rs749115805 2270 dbSNP
rs113178536 2292 dbSNP
rs1431126399 2298 dbSNP
rs915776803 2301 dbSNP
rs991697721 2305 dbSNP
rs1402770499 2308 dbSNP
rs959819489 2316 dbSNP
rs1331531547 2317 dbSNP
rs1226518632 2324 dbSNP
rs1035823361 2337 dbSNP
rs1340092967 2339 dbSNP
rs1207345773 2342 dbSNP
rs998544447 2343 dbSNP
rs1048932 2344 dbSNP
rs574617061 2346 dbSNP
rs1269831329 2351 dbSNP
rs548065691 2360 dbSNP
rs1193040377 2366 dbSNP
rs781069255 2390 dbSNP
rs1050620552 2394 dbSNP
rs1168648330 2395 dbSNP
rs1364472659 2405 dbSNP
rs528304327 2407 dbSNP
rs573662684 2414 dbSNP
rs998072451 2414 dbSNP
rs146578987 2420 dbSNP
rs370221693 2420 dbSNP
rs1381474606 2427 dbSNP
rs1318343470 2435 dbSNP
rs1435549453 2436 dbSNP
rs1367246773 2440 dbSNP
rs1036884865 2441 dbSNP
rs1298418507 2461 dbSNP
rs1358824858 2462 dbSNP
rs1361161855 2465 dbSNP
rs191851974 2466 dbSNP
rs1409462928 2472 dbSNP
rs1420758790 2481 dbSNP
rs932013019 2484 dbSNP
rs1204884087 2486 dbSNP
rs1474401660 2498 dbSNP
rs1049041319 2505 dbSNP
rs1189849214 2509 dbSNP
rs372281286 2514 dbSNP
rs1384003577 2516 dbSNP
rs1421554932 2520 dbSNP
rs1166406882 2521 dbSNP
rs900563635 2523 dbSNP
rs1368656924 2526 dbSNP
rs148097690 2530 dbSNP
rs1189143394 2535 dbSNP
rs915789891 2542 dbSNP
rs991355664 2543 dbSNP
rs1435642664 2544 dbSNP
rs77465183 2545 dbSNP
rs1203137497 2553 dbSNP
rs1336015683 2575 dbSNP
rs944847257 2577 dbSNP
rs900901167 2580 dbSNP
rs1394397287 2590 dbSNP
rs1314988558 2592 dbSNP
rs928473808 2601 dbSNP
rs908068461 2603 dbSNP
rs1331662507 2604 dbSNP
rs1209839790 2605 dbSNP
rs967112804 2611 dbSNP
rs1334132180 2620 dbSNP
rs1481964828 2631 dbSNP
rs1293650575 2635 dbSNP
rs1416464439 2639 dbSNP
rs983627550 2644 dbSNP
rs533322122 2645 dbSNP
rs757039769 2647 dbSNP
rs186469240 2648 dbSNP
rs920885894 2660 dbSNP
rs1175571323 2668 dbSNP
rs1357325862 2675 dbSNP
rs1467564258 2680 dbSNP
rs1304646031 2684 dbSNP
rs180688470 2691 dbSNP
rs575795507 2696 dbSNP
rs1286694560 2697 dbSNP
rs970157415 2698 dbSNP
rs1352661281 2705 dbSNP
rs751343310 2707 dbSNP
rs1229427691 2708 dbSNP
rs916974316 2709 dbSNP
rs953631423 2718 dbSNP
rs1212945618 2726 dbSNP
rs1029632490 2728 dbSNP
rs1355206127 2730 dbSNP
rs992598455 2739 dbSNP
rs997767280 2739 dbSNP
rs1198390410 2742 dbSNP
rs1422869341 2764 dbSNP
rs1460308315 2765 dbSNP
rs1417855645 2771 dbSNP
rs1166086067 2773 dbSNP
rs1176709174 2777 dbSNP
rs1359752735 2778 dbSNP
rs902031210 2779 dbSNP
rs1015088289 2780 dbSNP
rs1176300559 2784 dbSNP
rs11417765 2785 dbSNP
rs1274631063 2785 dbSNP
rs1306501336 2785 dbSNP
rs1372607780 2785 dbSNP
rs1410732981 2785 dbSNP
rs397698938 2785 dbSNP
rs567677041 2785 dbSNP
rs1340797269 2787 dbSNP
rs1004955417 2788 dbSNP
rs1480646626 2788 dbSNP
rs955821090 2789 dbSNP
rs1191648504 2794 dbSNP
rs1220457192 2794 dbSNP
rs1489345941 2794 dbSNP
rs887826247 2794 dbSNP
rs1211326025 2795 dbSNP
rs1447625000 2799 dbSNP
rs763420892 2799 dbSNP
rs948033331 2808 dbSNP
rs73570067 2810 dbSNP
rs1056145441 2815 dbSNP
rs1323160919 2817 dbSNP
rs1305071142 2821 dbSNP
rs1439089959 2824 dbSNP
rs1294529013 2833 dbSNP
rs398115862 2833 dbSNP
rs5794958 2833 dbSNP
rs938610235 2835 dbSNP
rs1342260821 2844 dbSNP
rs1227327425 2849 dbSNP
rs1287324994 2851 dbSNP
rs1000472960 2855 dbSNP
rs142069055 2856 dbSNP
rs1247234835 2863 dbSNP
rs1463488526 2874 dbSNP
rs573389616 2875 dbSNP
rs763263682 2878 dbSNP
rs541029696 2881 dbSNP
rs945781246 2882 dbSNP
rs776587732 2887 dbSNP
rs765349555 2888 dbSNP
rs1040411557 2896 dbSNP
rs1343826545 2899 dbSNP
rs1008937737 2902 dbSNP
rs1388448938 2906 dbSNP
rs886574757 2908 dbSNP
rs1047876571 2910 dbSNP
rs1028641224 2919 dbSNP
rs930830220 2927 dbSNP
rs1365220215 2929 dbSNP
rs539736403 2936 dbSNP
rs138952477 2941 dbSNP
rs188474384 2942 dbSNP
rs1004965385 2945 dbSNP
rs1267188771 2946 dbSNP
rs887881588 2948 dbSNP
rs1453285711 2953 dbSNP
rs536682001 2954 dbSNP
rs916923892 2956 dbSNP
rs1441811903 2961 dbSNP
rs866759082 2970 dbSNP
rs1186906701 2972 dbSNP
rs1235865233 2975 dbSNP
rs4450197 2983 dbSNP
rs1411614436 2995 dbSNP
rs955769170 2995 dbSNP
rs1484879186 3000 dbSNP
rs1389975266 3001 dbSNP
rs548286709 3002 dbSNP
rs1331604998 3003 dbSNP
rs528226166 3004 dbSNP
rs1448232124 3005 dbSNP
rs978597676 3006 dbSNP
rs1348351715 3011 dbSNP
rs771439710 3017 dbSNP
rs1028210934 3018 dbSNP
rs747041979 3019 dbSNP
rs997183935 3020 dbSNP
rs559042424 3021 dbSNP
rs1370383457 3024 dbSNP
rs1018909695 3028 dbSNP
rs1008886850 3031 dbSNP
rs773613521 3045 dbSNP
rs1251396436 3048 dbSNP
rs1471754446 3052 dbSNP
rs1389011896 3055 dbSNP
rs1184752274 3057 dbSNP
rs1364793284 3058 dbSNP
rs886507599 3071 dbSNP
rs768367939 3072 dbSNP
rs565875589 3073 dbSNP
rs1414579916 3076 dbSNP
rs145091394 3083 dbSNP
rs994988369 3085 dbSNP
rs914397668 3086 dbSNP
rs1288746524 3090 dbSNP
rs1330303566 3090 dbSNP
rs1054232572 3091 dbSNP
rs931745804 3096 dbSNP
rs1276567773 3101 dbSNP
rs899348556 3103 dbSNP
rs45500191 3104 dbSNP
rs948996229 3106 dbSNP
rs117792206 3107 dbSNP
rs1433502790 3108 dbSNP
rs11215397 3118 dbSNP
rs530959940 3119 dbSNP
rs1451417903 3130 dbSNP
rs983597852 3135 dbSNP
rs561995849 3136 dbSNP
rs1455125487 3143 dbSNP
rs1261022739 3144 dbSNP
rs924341575 3147 dbSNP
rs368431938 3148 dbSNP
rs978930708 3149 dbSNP
rs1209025422 3154 dbSNP
rs947215428 3155 dbSNP
rs1256635992 3157 dbSNP
rs573298508 3158 dbSNP
rs559895865 3167 dbSNP
rs546016623 3168 dbSNP
rs1340156365 3173 dbSNP
rs1230824949 3174 dbSNP
rs7950362 3176 dbSNP
rs557246672 3180 dbSNP
rs987419886 3188 dbSNP
rs184147616 3189 dbSNP
rs1188494851 3191 dbSNP
rs1054280215 3200 dbSNP
rs1450813771 3206 dbSNP
rs1026376112 3209 dbSNP
rs1460036348 3210 dbSNP
rs1372364782 3211 dbSNP
rs995335718 3215 dbSNP
rs574377159 3217 dbSNP
rs1318489004 3218 dbSNP
rs1383966846 3218 dbSNP
rs1478652578 3218 dbSNP
rs1255109968 3223 dbSNP
rs1023549526 3225 dbSNP
rs1013132716 3228 dbSNP
rs896050259 3229 dbSNP
rs1242975341 3253 dbSNP
rs1057411642 3273 dbSNP
rs141361881 3275 dbSNP
rs556449398 3285 dbSNP
rs1208594080 3288 dbSNP
rs1266813406 3289 dbSNP
rs902867844 3292 dbSNP
rs1042772961 3295 dbSNP
rs1254942804 3303 dbSNP
rs10891802 3306 dbSNP
rs944358920 3310 dbSNP
rs1456537857 3313 dbSNP
rs1337542204 3315 dbSNP
rs1156734679 3323 dbSNP
rs921056874 3327 dbSNP
rs181422267 3329 dbSNP
rs1454303197 3335 dbSNP
rs975649048 3337 dbSNP
rs983691195 3338 dbSNP
rs562997868 3340 dbSNP
rs952294438 3347 dbSNP
rs943902970 3348 dbSNP
rs138302428 3351 dbSNP
rs982682435 3354 dbSNP
rs1295371392 3356 dbSNP
rs150486129 3360 dbSNP
rs1026743425 3375 dbSNP
rs1340635229 3377 dbSNP
rs973464523 3391 dbSNP
rs1331823254 3394 dbSNP
rs1335796684 3397 dbSNP
rs1254837103 3415 dbSNP
rs1201779380 3419 dbSNP
rs538855883 3422 dbSNP
rs569939940 3426 dbSNP
rs1035083163 3427 dbSNP
rs1472088894 3439 dbSNP
rs1179733745 3440 dbSNP
rs1389126950 3448 dbSNP
rs963794958 3449 dbSNP
rs757201051 3450 dbSNP
rs1358596472 3456 dbSNP
rs751376701 3457 dbSNP
rs550105528 3458 dbSNP
rs766853442 3472 dbSNP
rs1163937816 3475 dbSNP
rs1376263140 3485 dbSNP
rs1409504848 3486 dbSNP
rs1254497012 3487 dbSNP
rs1306554587 3488 dbSNP
rs895997984 3492 dbSNP
rs1475413717 3499 dbSNP
rs1035919286 3500 dbSNP
rs140086416 3502 dbSNP
rs12293477 3503 dbSNP
rs1310999285 3511 dbSNP
rs999109328 3514 dbSNP
rs1280494894 3515 dbSNP
rs1010189301 3516 dbSNP
rs1202598492 3520 dbSNP
rs45539744 3522 dbSNP
rs1043106349 3523 dbSNP
rs1054290024 3529 dbSNP
rs114079309 3530 dbSNP
rs1249887835 3531 dbSNP
rs899562625 3538 dbSNP
rs1434884561 3540 dbSNP
rs1175582266 3543 dbSNP
rs1395839643 3547 dbSNP
rs1199417258 3549 dbSNP
rs900262869 3552 dbSNP
rs1306416416 3560 dbSNP
rs1039441672 3571 dbSNP
rs1443347566 3573 dbSNP
rs1293362311 3575 dbSNP
rs758706263 3576 dbSNP
rs912399007 3577 dbSNP
rs1303418504 3582 dbSNP
rs1046932406 3584 dbSNP
rs12293427 3590 dbSNP
rs1340864419 3591 dbSNP
rs528564227 3602 dbSNP
rs1040153324 3603 dbSNP
rs1307753365 3606 dbSNP
rs17564430 3620 dbSNP
rs1244819713 3621 dbSNP
rs1213397363 3634 dbSNP
rs1357525325 3636 dbSNP
rs886144358 3652 dbSNP
rs117014926 3653 dbSNP
rs1448961492 3658 dbSNP
rs973795787 3661 dbSNP
rs12293411 3666 dbSNP
rs963437872 3670 dbSNP
rs1166838643 3671 dbSNP
rs1334853492 3672 dbSNP
rs1421890195 3674 dbSNP
rs577044184 3677 dbSNP
rs1410798473 3685 dbSNP
rs991587822 3696 dbSNP
rs12293364 3698 dbSNP
rs12293363 3700 dbSNP
rs960153775 3702 dbSNP
rs1309334670 3705 dbSNP
rs1448435257 3707 dbSNP
rs12293359 3709 dbSNP
rs200875733 3713 dbSNP
rs1325151938 3714 dbSNP
rs1463425137 3714 dbSNP
rs1363782491 3715 dbSNP
rs7934536 3715 dbSNP
rs1432219742 3717 dbSNP
rs1392651670 3718 dbSNP
rs1156649139 3719 dbSNP
rs1468789041 3720 dbSNP
rs1363510608 3721 dbSNP
rs1336688657 3722 dbSNP
rs1214192932 3723 dbSNP
rs1267460144 3723 dbSNP
rs1463528463 3723 dbSNP
rs1179263892 3724 dbSNP
rs1191099963 3724 dbSNP
rs1441640820 3725 dbSNP
rs1475826855 3725 dbSNP
rs1035868032 3726 dbSNP
rs1251625629 3726 dbSNP
rs1213654873 3727 dbSNP
rs1047352771 3728 dbSNP
rs930901029 3729 dbSNP
rs1292442966 3730 dbSNP
rs920821967 3731 dbSNP
rs1345273381 3732 dbSNP
rs1349495805 3732 dbSNP
rs1286287310 3733 dbSNP
rs1233654635 3734 dbSNP
rs1357083808 3734 dbSNP
rs999057116 3735 dbSNP
rs1241606694 3741 dbSNP
rs968032538 3743 dbSNP
rs1326990539 3744 dbSNP
rs1302530874 3747 dbSNP
rs1437085663 3748 dbSNP
rs1021901190 3749 dbSNP
rs1160812598 3749 dbSNP
rs1209633903 3749 dbSNP
rs1231342084 3749 dbSNP
rs1255635077 3749 dbSNP
rs1286365897 3749 dbSNP
rs1348414547 3749 dbSNP
rs1408012580 3749 dbSNP
rs1411770908 3749 dbSNP
rs1413440629 3749 dbSNP
rs1447681338 3749 dbSNP
rs1468991707 3749 dbSNP
rs1476335908 3749 dbSNP
rs991408884 3749 dbSNP
rs1011630153 3750 dbSNP
rs1315959973 3751 dbSNP
rs1344275429 3751 dbSNP
rs1218701646 3752 dbSNP
rs1278354456 3752 dbSNP
rs1486771875 3753 dbSNP
rs899516149 3753 dbSNP
rs1399902989 3754 dbSNP
rs1211869910 3755 dbSNP
rs1039389736 3758 dbSNP
rs1251471616 3759 dbSNP
rs1436453520 3760 dbSNP
rs1007941132 3764 dbSNP
rs1184547840 3769 dbSNP
rs1159499590 3771 dbSNP
rs1478022088 3773 dbSNP
rs563591230 3778 dbSNP
rs1421548909 3780 dbSNP
rs1171197507 3784 dbSNP
rs938224594 3789 dbSNP
rs928106186 3807 dbSNP
rs536473349 3810 dbSNP
rs867100030 3816 dbSNP
rs966778053 3817 dbSNP
rs1046878262 3825 dbSNP
rs1434298525 3827 dbSNP
rs929852169 3833 dbSNP
rs1235236597 3835 dbSNP
rs1274229674 3838 dbSNP
rs45486791 3839 dbSNP
rs989440920 3848 dbSNP
rs1038301059 3850 dbSNP
rs1191397643 3856 dbSNP
rs1251776874 3865 dbSNP
rs957290284 3880 dbSNP
rs1192325156 3884 dbSNP
rs73570052 3893 dbSNP
rs1454361162 3900 dbSNP
rs1187433780 3901 dbSNP
rs534347975 3910 dbSNP
rs991535497 3917 dbSNP
rs572089331 3932 dbSNP
rs900357415 3939 dbSNP
rs960101974 3942 dbSNP
rs558710176 3945 dbSNP
rs867960832 3947 dbSNP
rs1459754693 3948 dbSNP
rs977567676 3948 dbSNP
rs967600393 3956 dbSNP
rs1373234955 3961 dbSNP
rs1345343028 3962 dbSNP
rs1022271038 3965 dbSNP
rs759576146 3967 dbSNP
rs1278980675 3971 dbSNP
rs1011834217 3974 dbSNP
rs886150921 3978 dbSNP
rs964017059 3979 dbSNP
rs1017888630 3987 dbSNP
rs1007890404 3988 dbSNP
rs1229892912 3991 dbSNP
rs34848645 3996 dbSNP
rs185049395 3997 dbSNP
rs1046828666 4000 dbSNP
rs1356120768 4006 dbSNP
rs930283308 4019 dbSNP
rs151149833 4020 dbSNP
rs1207545614 4031 dbSNP
rs1268361043 4037 dbSNP
rs1055406834 4040 dbSNP
rs898345122 4041 dbSNP
rs1299850543 4047 dbSNP
rs1402053650 4052 dbSNP
rs1373935385 4053 dbSNP
rs1038653557 4066 dbSNP
rs938262171 4071 dbSNP
rs45460594 4074 dbSNP
rs895096609 4082 dbSNP
rs945444505 4083 dbSNP
rs1166682323 4089 dbSNP
rs536546712 4090 dbSNP
rs1384089896 4103 dbSNP
rs1264304312 4104 dbSNP
rs1196372328 4105 dbSNP
rs1231819668 4107 dbSNP
rs766854097 4109 dbSNP
rs1484485495 4112 dbSNP
rs1295566388 4113 dbSNP
rs1256377947 4116 dbSNP
rs201766710 4125 dbSNP
rs567479023 4128 dbSNP
rs938686731 4133 dbSNP
rs1258369370 4136 dbSNP
rs12225960 4139 dbSNP
rs193168564 4144 dbSNP
rs565807463 4147 dbSNP
rs552255632 4148 dbSNP
rs1472191072 4150 dbSNP
rs1156867221 4151 dbSNP
rs1362096038 4152 dbSNP
rs1455385926 4154 dbSNP
rs4938182 4158 dbSNP
rs964327379 4160 dbSNP
rs1413243020 4161 dbSNP
rs1315093187 4165 dbSNP
rs1018506717 4168 dbSNP
rs1231297353 4178 dbSNP
rs986418538 4179 dbSNP
rs1353722637 4184 dbSNP
rs1008662756 4195 dbSNP
rs563529770 4206 dbSNP
rs955057173 4207 dbSNP
rs1448784269 4208 dbSNP
rs1360997183 4210 dbSNP
rs1254964022 4211 dbSNP
rs1026049121 4214 dbSNP
rs1465539895 4221 dbSNP
rs769530511 4225 dbSNP
rs1482625785 4231 dbSNP
rs1173194874 4235 dbSNP
rs1474440213 4237 dbSNP
rs1412563622 4238 dbSNP
rs1182118779 4242 dbSNP
rs1394566594 4245 dbSNP
rs866022475 4248 dbSNP
rs1433027629 4250 dbSNP
rs187559880 4254 dbSNP
rs1376401727 4263 dbSNP
rs1230657418 4282 dbSNP
rs551790648 4287 dbSNP
rs1296855922 4295 dbSNP
rs142025805 4317 dbSNP
rs1392546474 4318 dbSNP
rs1301991349 4319 dbSNP
rs879492929 4332 dbSNP
rs1458155290 4334 dbSNP
rs11606838 4335 dbSNP
rs895044343 4339 dbSNP
rs1202168047 4344 dbSNP
rs1046576901 4346 dbSNP
rs1333913457 4351 dbSNP
rs776434803 4353 dbSNP
rs11606837 4357 dbSNP
rs1229069936 4358 dbSNP
rs938635692 4366 dbSNP
rs1190560255 4372 dbSNP
rs1252395118 4373 dbSNP
rs907205640 4386 dbSNP
rs1277854876 4389 dbSNP
rs1395894555 4391 dbSNP
rs1409666956 4395 dbSNP
rs1042160691 4400 dbSNP
rs1294885795 4403 dbSNP
rs1446142218 4408 dbSNP
rs1356645213 4424 dbSNP
rs1462901883 4428 dbSNP
rs77407896 4435 dbSNP
rs1369482709 4439 dbSNP
rs1442440149 4440 dbSNP
rs1333983057 4446 dbSNP
rs1460165386 4449 dbSNP
rs1349633313 4452 dbSNP
rs914681630 4458 dbSNP
rs1165991657 4469 dbSNP
rs1307877249 4470 dbSNP
rs1212943537 4471 dbSNP
rs1053895068 4472 dbSNP
rs1425173170 4473 dbSNP
rs1215618975 4485 dbSNP
rs184716624 4497 dbSNP
rs1177398145 4506 dbSNP
rs545116565 4510 dbSNP
rs1185022531 4512 dbSNP
rs942902264 4520 dbSNP
rs191268056 4521 dbSNP
rs1463541128 4527 dbSNP
rs1325918725 4530 dbSNP
rs911447734 4534 dbSNP
rs780744334 4538 dbSNP
rs1428151587 4540 dbSNP
rs987028823 4543 dbSNP
rs1232428995 4544 dbSNP
rs1291268888 4550 dbSNP
rs1336848558 4551 dbSNP
rs556373070 4552 dbSNP
rs1446532743 4567 dbSNP
rs911769164 4567 dbSNP
rs147593988 4578 dbSNP
rs1265784006 4585 dbSNP
rs746906520 4592 dbSNP
rs1223564288 4595 dbSNP
rs1187677642 4596 dbSNP
rs1416154886 4614 dbSNP
rs567517993 4616 dbSNP
rs553803691 4618 dbSNP
rs1017117846 4619 dbSNP
rs1345401418 4628 dbSNP
rs534970351 4631 dbSNP
rs541332381 4636 dbSNP
rs1357149344 4650 dbSNP
rs1012068121 4651 dbSNP
rs1377788626 4651 dbSNP
rs572402544 4653 dbSNP
rs1034896316 4654 dbSNP
rs1286516140 4658 dbSNP
rs1003470010 4672 dbSNP
rs11606814 4681 dbSNP
rs1255794062 4684 dbSNP
rs747923440 4689 dbSNP
rs1439317802 4692 dbSNP
rs906796472 4701 dbSNP
rs1232783924 4706 dbSNP
rs1367590749 4712 dbSNP
rs1294483431 4713 dbSNP
rs1159787741 4715 dbSNP
rs1010677952 4717 dbSNP
rs1459772865 4718 dbSNP
rs893208375 4733 dbSNP
rs1376942828 4738 dbSNP
rs372508369 4748 dbSNP
rs1435081462 4752 dbSNP
rs1328002509 4754 dbSNP
rs1054963921 4762 dbSNP
rs1046708999 4769 dbSNP
rs1281299585 4770 dbSNP
rs1377778071 4770 dbSNP
rs545437796 4771 dbSNP
rs1350382368 4772 dbSNP
rs892676896 4775 dbSNP
rs1419728369 4795 dbSNP
rs911390069 4798 dbSNP
rs1053951140 4799 dbSNP
rs921325097 4805 dbSNP
rs1453234323 4810 dbSNP
rs1191262127 4825 dbSNP
rs1051251495 4827 dbSNP
rs1396495469 4831 dbSNP
rs186796653 4837 dbSNP
rs944066294 4843 dbSNP
rs1394089750 4844 dbSNP
rs556627626 4845 dbSNP
rs1411548868 4846 dbSNP
rs1432509227 4856 dbSNP
rs532465876 4857 dbSNP
rs1393688673 4858 dbSNP
rs1440231513 4865 dbSNP
rs1267982082 4870 dbSNP
rs569840749 4871 dbSNP
rs183185955 4872 dbSNP
rs972407609 4875 dbSNP
rs530244231 4877 dbSNP
rs909603541 4878 dbSNP
rs1269918954 4881 dbSNP
rs950629919 4893 dbSNP
rs756596704 4900 dbSNP
rs1216126071 4901 dbSNP
rs959159106 4905 dbSNP
rs1211270794 4911 dbSNP
rs76797809 4916 dbSNP
rs1003417356 4924 dbSNP
rs541372767 4926 dbSNP
rs145184682 4927 dbSNP
rs1021320866 4930 dbSNP
rs191069031 4931 dbSNP
rs1010210948 4938 dbSNP
rs1459874381 4944 dbSNP
rs188328933 4947 dbSNP
rs1392987299 4949 dbSNP
rs559885373 4950 dbSNP
rs1400202228 4954 dbSNP
rs1230053115 4956 dbSNP
rs1362125566 4958 dbSNP
rs1171191817 4959 dbSNP
rs1009855762 4962 dbSNP
rs1193076583 4968 dbSNP
rs1274448761 4978 dbSNP
rs1006935145 4981 dbSNP
rs1378089067 4984 dbSNP
rs1178182417 4986 dbSNP
rs892688290 4987 dbSNP
rs1194114690 4996 dbSNP
rs889900494 5003 dbSNP
rs1474153126 5004 dbSNP
rs1051200883 5017 dbSNP
rs1422630270 5026 dbSNP
rs1167044791 5028 dbSNP
rs1001412596 5029 dbSNP
rs934183726 5038 dbSNP
rs1488737738 5044 dbSNP
rs1158127850 5046 dbSNP
rs183260253 5051 dbSNP
rs1265614993 5058 dbSNP
rs899985046 5061 dbSNP
rs1355247131 5076 dbSNP
rs369845233 5077 dbSNP
rs1040217594 5079 dbSNP
rs576190910 5084 dbSNP
rs148457676 5089 dbSNP
rs542779237 5090 dbSNP
rs1258508844 5095 dbSNP
rs190658188 5101 dbSNP
rs1047017719 5109 dbSNP
rs186434155 5116 dbSNP
rs1216904225 5119 dbSNP
rs533824886 5124 dbSNP
rs1277943000 5135 dbSNP
rs774681946 5142 dbSNP
rs1341929470 5146 dbSNP
rs909546947 5147 dbSNP
rs990519942 5148 dbSNP
rs959109161 5155 dbSNP
rs116941960 5158 dbSNP
rs1418500565 5159 dbSNP
rs1181092291 5169 dbSNP
rs941884237 5172 dbSNP
rs183548450 5176 dbSNP
rs1304128980 5181 dbSNP
rs1159504528 5187 dbSNP
rs966961337 5193 dbSNP
rs1375108827 5195 dbSNP
rs980968829 5199 dbSNP
rs1305025253 5202 dbSNP
rs1399546604 5206 dbSNP
rs571624544 5207 dbSNP
rs55936250 5223 dbSNP
rs1478687487 5229 dbSNP
rs1011245825 5234 dbSNP
rs957358152 5237 dbSNP
rs1032969476 5241 dbSNP
rs1006887577 5248 dbSNP
rs889851461 5265 dbSNP
rs777220215 5272 dbSNP
rs1423500401 5275 dbSNP
rs569776797 5290 dbSNP
rs987766184 5292 dbSNP
rs1212749755 5295 dbSNP
rs956956222 5300 dbSNP
rs1032624321 5304 dbSNP
rs1175433677 5305 dbSNP
rs1029731330 5312 dbSNP
rs144598547 5315 dbSNP
rs746971892 5317 dbSNP
rs1202303510 5329 dbSNP
rs1179386994 5331 dbSNP
rs900039097 5333 dbSNP
rs1037247172 5334 dbSNP
rs1257980307 5339 dbSNP
rs773324488 5343 dbSNP
rs941599797 5344 dbSNP
rs888742455 5350 dbSNP
rs189795167 5351 dbSNP
rs1282838204 5354 dbSNP
rs1296993379 5355 dbSNP
rs544878503 5357 dbSNP
rs866546649 5359 dbSNP
rs929947834 5361 dbSNP
rs567751145 5362 dbSNP
rs1220610265 5363 dbSNP
rs548019204 5370 dbSNP
rs941953711 5379 dbSNP
rs149757879 5395 dbSNP
rs981873780 5396 dbSNP
rs1202227762 5398 dbSNP
rs945188659 5409 dbSNP
rs763639774 5411 dbSNP
rs565613977 5413 dbSNP
rs538251083 5416 dbSNP
rs1443945715 5419 dbSNP
rs989365011 5420 dbSNP
rs958194946 5421 dbSNP
rs1331981078 5427 dbSNP
rs1466954968 5429 dbSNP
rs1017500295 5430 dbSNP
rs1391974320 5435 dbSNP
rs118081359 5441 dbSNP
rs1426264438 5441 dbSNP
rs139242459 5442 dbSNP
rs1029678928 5448 dbSNP
rs1466605347 5453 dbSNP
rs998680915 5456 dbSNP
rs1457579683 5457 dbSNP
rs1391675682 5460 dbSNP
rs897272683 5461 dbSNP
rs1438116722 5469 dbSNP
rs987876881 5482 dbSNP
rs956383608 5483 dbSNP
rs542367970 5485 dbSNP
rs755164818 5488 dbSNP
rs980126551 5491 dbSNP
rs1318433360 5493 dbSNP
rs1232621124 5495 dbSNP
rs1189626086 5506 dbSNP
rs1272576536 5512 dbSNP
rs1449973427 5512 dbSNP
rs1437931005 5513 dbSNP
rs1016174174 5519 dbSNP
rs185413366 5537 dbSNP
rs1485698236 5538 dbSNP
rs376629377 5539 dbSNP
rs1459520600 5556 dbSNP
rs1288152750 5576 dbSNP
rs749473290 5580 dbSNP
rs555191758 5588 dbSNP
rs1164869592 5597 dbSNP
rs146312885 5599 dbSNP
rs4936321 5605 dbSNP
rs1428225395 5611 dbSNP
rs369683712 5640 dbSNP
rs955471209 5641 dbSNP
rs1291330316 5643 dbSNP
rs756181427 5651 dbSNP
rs1230090226 5656 dbSNP
rs745328554 5664 dbSNP
rs1309403668 5669 dbSNP
rs1448873019 5671 dbSNP
rs1214750573 5672 dbSNP
rs1025711441 5675 dbSNP
rs937635074 5677 dbSNP
rs750477973 5680 dbSNP
rs561117275 5691 dbSNP
rs547626352 5694 dbSNP
rs73568120 5700 dbSNP
rs1387138809 5705 dbSNP
rs1391646436 5706 dbSNP
rs913692985 5707 dbSNP
rs1406631294 5713 dbSNP
rs1398548804 5721 dbSNP
rs1160120647 5723 dbSNP
rs1360816964 5726 dbSNP
rs1433844301 5731 dbSNP
rs538617925 5734 dbSNP
rs78276915 5738 dbSNP
rs936548323 5741 dbSNP
rs180979659 5743 dbSNP
rs1379747791 5744 dbSNP
rs1311710104 5763 dbSNP
rs17649730 5765 dbSNP
rs1442082973 5774 dbSNP
rs1210605882 5775 dbSNP
rs1245490280 5782 dbSNP
rs1314377724 5791 dbSNP
rs1281775984 5792 dbSNP
rs1444580719 5793 dbSNP
rs757753752 5796 dbSNP
rs201218345 5813 dbSNP
rs776448348 5815 dbSNP
rs1437248233 5832 dbSNP
rs1268971457 5841 dbSNP
rs954007438 5844 dbSNP
rs369020234 5845 dbSNP
rs538545007 5845 dbSNP
rs375403969 5846 dbSNP
rs141974655 5848 dbSNP
rs547661532 5849 dbSNP
rs1170525806 5859 dbSNP
rs138852617 5859 dbSNP
rs1352738487 5862 dbSNP
rs1015706507 5863 dbSNP
rs1006104059 5864 dbSNP
rs751921812 5865 dbSNP
rs1456870363 5866 dbSNP
rs1238255932 5867 dbSNP
rs1436579648 5867 dbSNP
rs1467708316 5867 dbSNP
rs1196343949 5868 dbSNP
rs1379049199 5869 dbSNP
rs1478219472 5870 dbSNP
rs565179081 5871 dbSNP
rs189426378 5872 dbSNP
rs1296173082 5873 dbSNP
rs1398372549 5874 dbSNP
rs1440399325 5876 dbSNP
rs1321797892 5877 dbSNP
rs1333099808 5880 dbSNP
rs1437615246 5884 dbSNP
rs911451947 5888 dbSNP
rs987444499 5889 dbSNP
rs1033890901 5898 dbSNP
rs1221020213 5900 dbSNP
rs955559422 5917 dbSNP
rs1333483168 5918 dbSNP
rs1360206048 5920 dbSNP
rs1207603311 5922 dbSNP
rs1269003786 5928 dbSNP
rs1451886676 5930 dbSNP
rs1025763883 5932 dbSNP
rs994244064 5940 dbSNP
rs962734008 5945 dbSNP
rs1002463039 5974 dbSNP
rs552107191 5981 dbSNP
rs1417134222 5985 dbSNP
rs1457455106 5989 dbSNP
rs186583281 5996 dbSNP
rs1393141787 5998 dbSNP
rs146093394 6002 dbSNP
rs1009261335 6009 dbSNP
rs1297911460 6010 dbSNP
rs905121962 6012 dbSNP
rs1045013376 6016 dbSNP
rs1355446510 6025 dbSNP
rs892199043 6028 dbSNP
rs1241976418 6029 dbSNP
rs4938181 6031 dbSNP
rs1356535189 6035 dbSNP
rs1204205477 6036 dbSNP
rs1283574366 6040 dbSNP
rs936478835 6050 dbSNP
rs1194183447 6057 dbSNP
rs1192023671 6060 dbSNP
rs1256707581 6061 dbSNP
rs1422055013 6061 dbSNP
rs765914091 6062 dbSNP
rs1052235083 6073 dbSNP
rs1487753297 6078 dbSNP
rs1458561828 6081 dbSNP
rs1263455369 6082 dbSNP
rs910389262 6084 dbSNP
rs1440216081 6090 dbSNP
rs141925071 6101 dbSNP
rs1402034643 6106 dbSNP
rs1394811325 6111 dbSNP
rs1314182170 6113 dbSNP
rs1340579756 6115 dbSNP
rs933235852 6116 dbSNP
rs923213423 6131 dbSNP
rs925035254 6133 dbSNP
rs562787967 6138 dbSNP
rs1043799100 6145 dbSNP
rs942411830 6147 dbSNP
rs1202131713 6162 dbSNP
rs543083840 6164 dbSNP
rs987050146 6167 dbSNP
rs1217793161 6172 dbSNP
rs1378692393 6174 dbSNP
rs4938180 6182 dbSNP
rs374870211 6184 dbSNP
rs961413286 6189 dbSNP
rs1159564169 6194 dbSNP
rs1358968218 6200 dbSNP
rs779015081 6202 dbSNP
rs1464946808 6208 dbSNP
rs1279106195 6212 dbSNP
rs918761020 6216 dbSNP
rs1445392391 6226 dbSNP
rs17118023 6231 dbSNP
rs1378573041 6232 dbSNP
rs148151832 6234 dbSNP
rs952820394 6237 dbSNP
rs577656246 6250 dbSNP
rs1002415489 6251 dbSNP
rs748032482 6255 dbSNP
rs1025255898 6262 dbSNP
rs970123861 6267 dbSNP
rs544094057 6268 dbSNP
rs1409023341 6272 dbSNP
rs1198014412 6273 dbSNP
rs66634540 6276 dbSNP
rs1459217554 6277 dbSNP
rs892150812 6279 dbSNP
rs1013518016 6281 dbSNP
rs1423830164 6284 dbSNP
rs1187876846 6299 dbSNP
rs577870733 6300 dbSNP
rs1178767244 6304 dbSNP
rs1000579898 6312 dbSNP
rs888899114 6314 dbSNP
rs1050199791 6318 dbSNP
rs1444002142 6324 dbSNP
rs556264340 6328 dbSNP
rs1292550708 6329 dbSNP
rs749506822 6333 dbSNP
rs780504914 6334 dbSNP
rs1036298940 6335 dbSNP
rs1259794806 6336 dbSNP
rs1320051296 6341 dbSNP
rs903674387 6345 dbSNP
rs1246336239 6348 dbSNP
rs1487669166 6350 dbSNP
rs1216523076 6351 dbSNP
rs939975736 6352 dbSNP
rs1477753226 6355 dbSNP
rs1169204901 6362 dbSNP
rs780366157 6364 dbSNP
rs769987360 6365 dbSNP
rs746011528 6384 dbSNP
rs781178292 6390 dbSNP
rs1163538473 6392 dbSNP
rs1347685951 6396 dbSNP
rs926721123 6398 dbSNP
rs889493071 6410 dbSNP
rs1293844294 6413 dbSNP
rs1385537219 6414 dbSNP
rs1339626426 6433 dbSNP
rs536685399 6436 dbSNP
rs751846124 6436 dbSNP
rs980924075 6437 dbSNP
rs1341122784 6440 dbSNP
rs1215239271 6443 dbSNP
rs970899813 6462 dbSNP
rs143804863 6468 dbSNP
rs918815221 6482 dbSNP
rs988414061 6486 dbSNP
rs1401457302 6487 dbSNP
rs972887674 6490 dbSNP
rs1173064919 6497 dbSNP
rs554330041 6498 dbSNP
rs1265966440 6507 dbSNP
rs1478436529 6508 dbSNP
rs1180711703 6523 dbSNP
rs1411023071 6526 dbSNP
rs1425141152 6529 dbSNP
rs910038558 6533 dbSNP
rs1359554381 6536 dbSNP
rs980244817 6544 dbSNP
rs1412632953 6545 dbSNP
rs534343534 6546 dbSNP
rs1445949579 6563 dbSNP
rs1447223970 6565 dbSNP
rs1000510310 6566 dbSNP
rs757774271 6575 dbSNP
rs571879744 6577 dbSNP
rs1230141676 6590 dbSNP
rs888851551 6596 dbSNP
rs1353342106 6613 dbSNP
rs1214817904 6624 dbSNP
rs112599074 6627 dbSNP
rs1028711287 6642 dbSNP
rs997279569 6655 dbSNP
rs1458196184 6657 dbSNP
rs149015325 6658 dbSNP
rs756408765 6668 dbSNP
rs1030954052 6671 dbSNP
rs999427850 6673 dbSNP
rs139363282 6674 dbSNP
rs887728711