miRTarBase - #MIRT003891 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM184B   
Synonyms C22orf5, FM08, HS5O6A, HSPC256
Description transmembrane protein 184B
Transcript NM_012264   
Expression
Putative miRNA Targets on TMEM184B
3'UTR of TMEM184B
(miRNA target sites are highlighted)
>TMEM184B|NM_012264|3'UTR
   1 GTGCGGGCTGCAGTGGCGGAAGTGCTGGCGCCATAGCCACGGTCAGGCTGTGCCCCACCTCCAGCCTCACCACCAGGCCA
  81 GGAGGCAGCTGGCACAGTGCTCACGCCGCCTTTATTTATTGGACCAGAAACACTCACATGTCACTTCCAGAGGAACGGGG
 161 GACAGCCAGGCTCGCCCATGGGCCTTCAGGAATATTTATACATGGCCCAGCCTGCACTGCCCGGGCGAGGGCAGAGGACA
 241 CTGGGAGCAAGGCTTATGCCCCTGCTGCCCGTCCTGTGCTGGGGGCATGCTGGGACCAGCCGCACCCAGGCCCCAATGCT
 321 TGTGTGTGGACCAGCGGCTGCAGCCTTCTAGCCCCTCCTCCCCGCGAGACTCTCAGGCTGAGGTCGGCAAGCCGTGGCTC
 401 CCCCACACACCGTGCAATACCCTGTCTGACCTGGGCTCTTCCCGCCTGCATCCCTCCCCTGTCCACCTTTGTCCAGTGCT
 481 AGATTCACCTCACCCCGGGCAGGAGTGGGGATGTGGGCGCTCTGTGGTCCTCCCCTCCTGACCCAGGCCTCTGTGGCATG
 561 CTGCAAGGATCAGAGCCAGACACCAGGAGTCACAGGCCCCACCCAGGAAGGGCATTCAGGGCCCCTGGGCACCGCTTCTG
 641 TTGAAGCAGGGGCTTCTGGGCCCCTGGGTATCCCCACCTGTCGTGGCCACACCTCTGCCTGCCTCATGCCCCTTCCCCCT
 721 GGCCTACCAAGGACAGCCCACAGCCCGCACTGCCGGCTCACTTGGGTCCTTCCTCGATAGCTTTGGGCAGAGCCCTTGCT
 801 TCCTGGCTGCTTCAGGGCTCAGGGGCTCCCAGCCCTCCTTCCCAGGCTGATGCTGGGTCCTCTCTCTCTTTGGGGCTTCT
 881 CCCTCCCGTTTCAGGGGAAAGGTCTGAGTCTCCACGTTTCAGACCAGCTTCTGGGGGAAGGCAGTCCGGCAGGGAGACCG
 961 GGAGGGGTGGCCACACAGTGGGGAGCTGGGAGGTGGGGGGAATGGTCCCAGACTCCTCTCGGGGCCCCTATCCACACAGG
1041 GCCTGGTGTTCTACCCCATCTGGCCCCTGGCCCATCTCTTCTGTGCCTTAGTCACATATGAAAGCGCCCCTCCCTGGCTC
1121 CCCATCTGTCCCACACGCTCCCTGGGGCTCTTAGTTCAGCTGCTGGCACTCGCAGGATCCTGCAGTGCTGGGCCCAGAGC
1201 CCTTGGACAGGCCTCAGGAGTGGTCAGGACCACCAAGCCCCTCCTCTCCCCCTCCACACCTCTAGACCTGGGGCCTCCGG
1281 AACCCCCAGCAGGCTGGGCTTATACTAGCTCCTGACTTAGGAAGAGCCTCGTGTCACAACACGTGTCCCTACAGGCAAAG
1361 TGTCCTGGCATTTAAAACCCAGATTATCCCTGGGTTTGGGCTGCAGTCACCTGGAGAAGCTGGTAGGGTAAGGGAGAGGG
1441 ACCCTGCCGGTGTTCACTGGGGATTCTTTCTTTTGGTCCTTCCTGGAATGAACAGGTTCCCTCCCTGCCACCTGTGAGGA
1521 GAGTTGGGGCCCAGCCGTCTTCCTGGCCTCCTTCCTTTCCTCGTGGCAGAGGCCTGCATGTGGGTGCCAGAGGCCAGCTC
1601 TCCCCCTCCATCTTGGGGGGGCGGAGCAGTTGGGCCCAAGCTGCCCGGGAGGGTGGGTGCAGACACAGGCTGAGGACCAG
1681 CCCTGGCCCTGCCCCGCCATCTGCTTTCACCAAGCTGTCTCTCCACCGTGGCTTCCCTTCTCCCTCCAGGCCAAAGTGCT
1761 GCTGATTCCCACTCCCTTGGTTTTCGCCTGCCCAGCGTTGCTGTTTGCGTGGAGGGTGGGGGGAGCTCAGTGGCAGGGAA
1841 TCAGCGGTCCGTGGGGTCGTGGGGACGGGAACATGTGCCCGACCGCTCCATCCCCTCCTCCTCCTTAGGATGCATAACCT
1921 ACCTTGTCTTTTTTTTTTTTAATTTTCTTTCCAGGTAGAGTAGCTCTTTGTACATAAAGAATACTTGAAAAATTAATTGT
2001 ATGATGTATGAGAAGACAGAGTCTCCTAGTTTTGTATCTTGTTGTATGACTGCCATGAGTTCCACCAGAAAGCCACTCTA
2081 TTTTGGTCTCTGTGACATTTTAAATGCGTGACAGAAGTGAGCAAATAAAGTGAGGAAGAAATCTATATATGAGATAATAT
2161 AGATTGTATTGAAATCTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||::|||  | |||||||| 
Target 5' tcCAGGCCA--AAGTGCTGCTg 3'
1745 - 1764 164.00 -19.90
2
miRNA  3' guGUUUGGUAAUAC----ACGACGau 5'
            |||: | |||||    ||||||  
Target 5' agCAAGGC-TTATGCCCCTGCTGCcc 3'
246 - 270 141.00 -14.60
3
miRNA  3' guGUUUGGUAAUAC---ACGACGau 5'
            ||::||  |:||   ||||||  
Target 5' ccCAGGCCTCTGTGGCATGCTGCaa 3'
542 - 566 140.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31612128 4 COSMIC
COSN30454426 5 COSMIC
COSN30122528 29 COSMIC
COSN30495360 32 COSMIC
COSN30181029 61 COSMIC
COSN31546185 100 COSMIC
COSN24391090 138 COSMIC
COSN19747945 143 COSMIC
COSN31565734 150 COSMIC
COSN31531449 174 COSMIC
COSN26664116 219 COSMIC
COSN30542731 270 COSMIC
COSN32063983 313 COSMIC
COSN20909187 352 COSMIC
COSN31524677 364 COSMIC
COSN31572401 443 COSMIC
COSN8612699 474 COSMIC
COSN26192588 490 COSMIC
COSN30545417 495 COSMIC
COSN30176186 610 COSMIC
COSN26507771 714 COSMIC
COSN30176589 715 COSMIC
COSN9165794 727 COSMIC
COSN26601029 775 COSMIC
COSN30544175 837 COSMIC
COSN31596980 1020 COSMIC
COSN26554998 1072 COSMIC
COSN31549886 1175 COSMIC
COSN9165793 1708 COSMIC
COSN29033441 1929 COSMIC
COSN17820415 1939 COSMIC
COSN32062185 1940 COSMIC
COSN30170652 1993 COSMIC
COSN26563783 2054 COSMIC
COSN1261837 2067 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1441349762 1 dbSNP
rs767823803 3 dbSNP
rs370456365 4 dbSNP
rs774571251 5 dbSNP
rs1365553223 9 dbSNP
rs376877723 17 dbSNP
rs202018170 18 dbSNP
rs1416022300 20 dbSNP
rs1190358788 22 dbSNP
rs1486178171 24 dbSNP
rs1262921885 25 dbSNP
rs1203840021 26 dbSNP
rs1332653732 29 dbSNP
rs769507993 29 dbSNP
rs1487169014 30 dbSNP
rs900304936 34 dbSNP
rs747929253 38 dbSNP
rs780873410 40 dbSNP
rs944558940 41 dbSNP
rs1233556602 47 dbSNP
rs1339527163 48 dbSNP
rs1296129768 50 dbSNP
rs1158362109 53 dbSNP
rs886344164 57 dbSNP
rs1470813416 66 dbSNP
rs1007113700 71 dbSNP
rs1459014073 73 dbSNP
rs1048140649 77 dbSNP
rs757527733 81 dbSNP
rs1191573187 84 dbSNP
rs1252140571 95 dbSNP
rs889968360 100 dbSNP
rs929975564 104 dbSNP
rs530739047 105 dbSNP
rs774864456 106 dbSNP
rs974094161 107 dbSNP
rs937439705 108 dbSNP
rs1257593140 121 dbSNP
rs1212582486 127 dbSNP
rs897234735 130 dbSNP
rs1325743972 133 dbSNP
rs10545677 138 dbSNP
rs67643847 138 dbSNP
rs2235265 143 dbSNP
rs981615535 156 dbSNP
rs895767647 157 dbSNP
rs972002779 158 dbSNP
rs1020528112 161 dbSNP
rs989507854 163 dbSNP
rs1217530981 170 dbSNP
rs544628862 173 dbSNP
rs1319998845 174 dbSNP
rs11538089 178 dbSNP
rs1032688423 182 dbSNP
rs995900130 185 dbSNP
rs1243963366 187 dbSNP
rs937250933 188 dbSNP
rs1200683131 190 dbSNP
rs1240620081 192 dbSNP
rs1475201282 202 dbSNP
rs964437463 207 dbSNP
rs927123257 209 dbSNP
rs1425882162 219 dbSNP
rs1019137589 222 dbSNP
rs1164863978 223 dbSNP
rs185088433 223 dbSNP
rs748448165 224 dbSNP
rs886310629 226 dbSNP
rs1416870541 234 dbSNP
rs1338649815 248 dbSNP
rs1407481935 252 dbSNP
rs947177174 257 dbSNP
rs1047600019 259 dbSNP
rs1399000027 260 dbSNP
rs1278359040 268 dbSNP
rs1387570105 269 dbSNP
rs988465393 270 dbSNP
rs181745898 271 dbSNP
rs898473081 285 dbSNP
rs375843707 287 dbSNP
rs937366371 288 dbSNP
rs1189384284 292 dbSNP
rs1281881033 294 dbSNP
rs927388843 297 dbSNP
rs1217642634 299 dbSNP
rs1265551631 300 dbSNP
rs540768894 301 dbSNP
rs573383274 302 dbSNP
rs11538090 314 dbSNP
rs1046269801 316 dbSNP
rs1448579262 323 dbSNP
rs1027598781 326 dbSNP
rs950245562 329 dbSNP
rs1287464366 334 dbSNP
rs1209173263 335 dbSNP
rs1335333005 336 dbSNP
rs866607060 338 dbSNP
rs554892542 344 dbSNP
rs989046282 353 dbSNP
rs1332904560 361 dbSNP
rs536935920 363 dbSNP
rs926214814 364 dbSNP
rs1352747024 365 dbSNP
rs1240557966 366 dbSNP
rs372570127 371 dbSNP
rs1484803461 376 dbSNP
rs575863331 377 dbSNP
rs1200005143 380 dbSNP
rs974390315 385 dbSNP
rs905773370 386 dbSNP
rs995966454 386 dbSNP
rs1440730164 387 dbSNP
rs1043304552 388 dbSNP
rs947208381 393 dbSNP
rs964406918 394 dbSNP
rs1052821080 396 dbSNP
rs943748837 404 dbSNP
rs1321921572 406 dbSNP
rs1326813329 409 dbSNP
rs1386726549 411 dbSNP
rs557295014 412 dbSNP
rs912220114 414 dbSNP
rs541252922 417 dbSNP
rs1018692565 420 dbSNP
rs1463651953 421 dbSNP
rs1238140690 424 dbSNP
rs1422269718 430 dbSNP
rs1180961288 431 dbSNP
rs1009064130 434 dbSNP
rs920173424 443 dbSNP
rs1174944808 444 dbSNP
rs1377805006 446 dbSNP
rs866319208 447 dbSNP
rs539037302 462 dbSNP
rs1399539286 463 dbSNP
rs11538092 464 dbSNP
rs1333203563 468 dbSNP
rs1368526763 479 dbSNP
rs1013679971 482 dbSNP
rs1302280808 482 dbSNP
rs1333018217 484 dbSNP
rs960789079 485 dbSNP
rs371314280 488 dbSNP
rs994689281 495 dbSNP
rs866770447 496 dbSNP
rs1449341010 497 dbSNP
rs1271770914 500 dbSNP
rs553867123 509 dbSNP
rs1244780639 511 dbSNP
rs1267677177 513 dbSNP
rs1434534264 517 dbSNP
rs769416872 518 dbSNP
rs1002190477 519 dbSNP
rs1054995159 524 dbSNP
rs1172754400 533 dbSNP
rs1254861378 535 dbSNP
rs1293874492 537 dbSNP
rs1021510108 546 dbSNP
rs1380740909 547 dbSNP
rs1011424725 548 dbSNP
rs1196655039 549 dbSNP
rs535168415 551 dbSNP
rs1272292311 561 dbSNP
rs1220504605 566 dbSNP
rs1052848514 571 dbSNP
rs1215391456 575 dbSNP
rs1341673783 577 dbSNP
rs1267605813 584 dbSNP
rs376049377 586 dbSNP
rs557919557 589 dbSNP
rs943822768 595 dbSNP
rs1273472136 596 dbSNP
rs780848120 599 dbSNP
rs1195170937 602 dbSNP
rs567430134 612 dbSNP
rs1411595734 623 dbSNP
rs1423159699 624 dbSNP
rs1165299788 630 dbSNP
rs754741735 633 dbSNP
rs950187387 634 dbSNP
rs913373886 638 dbSNP
rs1297854426 640 dbSNP
rs1361379003 647 dbSNP
rs1049886610 649 dbSNP
rs1053300785 651 dbSNP
rs936181709 653 dbSNP
rs926182303 665 dbSNP
rs1372152900 666 dbSNP
rs1328585439 669 dbSNP
rs1445209994 673 dbSNP
rs548924672 682 dbSNP
rs746781007 683 dbSNP
rs900647295 685 dbSNP
rs1411325190 688 dbSNP
rs908718769 689 dbSNP
rs1488399306 697 dbSNP
rs992320635 705 dbSNP
rs1235237612 707 dbSNP
rs1482606084 711 dbSNP
rs779999108 722 dbSNP
rs530808411 728 dbSNP
rs1171609516 733 dbSNP
rs1437639735 735 dbSNP
rs1157806628 736 dbSNP
rs1454590107 738 dbSNP
rs987209424 746 dbSNP
rs563441602 747 dbSNP
rs1174144190 748 dbSNP
rs1358672559 749 dbSNP
rs550922945 754 dbSNP
rs532758217 755 dbSNP
rs1375284728 760 dbSNP
rs1446570837 761 dbSNP
rs973197996 764 dbSNP
rs1310431103 767 dbSNP
rs981235070 772 dbSNP
rs542151928 774 dbSNP
rs538360224 775 dbSNP
rs1033555352 788 dbSNP
rs540703068 791 dbSNP
rs1232393469 805 dbSNP
rs1022213027 808 dbSNP
rs1439600564 811 dbSNP
rs1011453992 813 dbSNP
rs1456378820 816 dbSNP
rs1002081112 817 dbSNP
rs1177852751 820 dbSNP
rs1238569759 821 dbSNP
rs905831794 824 dbSNP
rs891704003 825 dbSNP
rs1233824830 832 dbSNP
rs1349134396 838 dbSNP
rs1305999500 841 dbSNP
rs1024742660 847 dbSNP
rs573689330 852 dbSNP
rs1178295786 853 dbSNP
rs1008042217 860 dbSNP
rs1332552367 862 dbSNP
rs1379592052 864 dbSNP
rs1434714163 866 dbSNP
rs1272758910 870 dbSNP
rs1366440579 870 dbSNP
rs890900726 872 dbSNP
rs753944255 875 dbSNP
rs764307384 877 dbSNP
rs11538087 878 dbSNP
rs867393851 879 dbSNP
rs1014319282 887 dbSNP
rs891859430 888 dbSNP
rs756399791 893 dbSNP
rs1258573694 897 dbSNP
rs561498829 900 dbSNP
rs1279663829 910 dbSNP
rs113622885 915 dbSNP
rs1053225389 916 dbSNP
rs1488839120 930 dbSNP
rs1478472995 931 dbSNP
rs1311957760 932 dbSNP
rs542873593 935 dbSNP
rs898169196 940 dbSNP
rs1377057590 944 dbSNP
rs904693246 947 dbSNP
rs1038008184 948 dbSNP
rs373075009 949 dbSNP
rs943630067 950 dbSNP
rs908792520 954 dbSNP
rs911538576 958 dbSNP
rs992355146 959 dbSNP
rs939547240 960 dbSNP
rs575847249 964 dbSNP
rs1337801374 965 dbSNP
rs144255720 970 dbSNP
rs1278814760 972 dbSNP
rs918999981 980 dbSNP
rs1341364426 981 dbSNP
rs190947479 982 dbSNP
rs963143216 985 dbSNP
rs1207906408 993 dbSNP
rs1451900953 997 dbSNP
rs1225024219 1000 dbSNP
rs1235802316 1001 dbSNP
rs1210443675 1002 dbSNP
rs1486088910 1003 dbSNP
rs1426483100 1004 dbSNP
rs75676672 1016 dbSNP
rs915274261 1020 dbSNP
rs1214855582 1021 dbSNP
rs377156335 1021 dbSNP
rs980687026 1028 dbSNP
rs1304611548 1030 dbSNP
rs971073824 1035 dbSNP
rs553428502 1039 dbSNP
rs988096804 1042 dbSNP
rs1316668678 1045 dbSNP
rs185761253 1056 dbSNP
rs1398908957 1057 dbSNP
rs1024917703 1058 dbSNP
rs1285638896 1060 dbSNP
rs1328200605 1064 dbSNP
rs955978526 1066 dbSNP
rs1283468612 1067 dbSNP
rs113791085 1070 dbSNP
rs1225964593 1071 dbSNP
rs1247848083 1079 dbSNP
rs140620902 1091 dbSNP
rs1353239920 1092 dbSNP
rs1292067049 1105 dbSNP
rs1008535433 1106 dbSNP
rs372933522 1113 dbSNP
rs891832217 1116 dbSNP
rs1356927982 1121 dbSNP
rs1187483319 1122 dbSNP
rs1295926225 1128 dbSNP
rs549117073 1130 dbSNP
rs146825517 1134 dbSNP
rs756668258 1136 dbSNP
rs904662121 1142 dbSNP
rs369464484 1161 dbSNP
rs751930550 1171 dbSNP
rs898241196 1172 dbSNP
rs759877704 1179 dbSNP
rs774611776 1185 dbSNP
rs1340968127 1193 dbSNP
rs1187251651 1201 dbSNP
rs58135276 1207 dbSNP
rs551260688 1213 dbSNP
rs1056735651 1225 dbSNP
rs1352624988 1229 dbSNP
rs1241164752 1231 dbSNP
rs541812365 1232 dbSNP
rs1191755296 1248 dbSNP
rs1052058852 1251 dbSNP
rs928963287 1252 dbSNP
rs1280017542 1257 dbSNP
rs918928009 1267 dbSNP
rs1261677232 1268 dbSNP
rs139350432 1271 dbSNP
rs1045630731 1278 dbSNP
rs946858783 1279 dbSNP
rs941800087 1285 dbSNP
rs1237963372 1287 dbSNP
rs915306678 1291 dbSNP
rs926436374 1293 dbSNP
rs1272019681 1294 dbSNP
rs980998290 1298 dbSNP
rs970619445 1315 dbSNP
rs769365593 1318 dbSNP
rs1171469850 1322 dbSNP
rs1402906455 1324 dbSNP
rs1336266428 1326 dbSNP
rs988075935 1327 dbSNP
rs145623875 1328 dbSNP
rs1031689000 1330 dbSNP
rs75292970 1331 dbSNP
rs1309468039 1335 dbSNP
rs911871285 1341 dbSNP
rs1232706081 1342 dbSNP
rs1275510701 1343 dbSNP
rs1325679956 1346 dbSNP
rs1197319784 1349 dbSNP
rs986740447 1352 dbSNP
rs1434242945 1353 dbSNP
rs879776425 1358 dbSNP
rs1197894463 1363 dbSNP
rs1028191478 1364 dbSNP
rs1165526283 1368 dbSNP
rs997082303 1370 dbSNP
rs1429396441 1379 dbSNP
rs1481102426 1382 dbSNP
rs1017730775 1383 dbSNP
rs1168482936 1386 dbSNP
rs149746330 1389 dbSNP
rs1462079963 1407 dbSNP
rs1399412888 1409 dbSNP
rs1008133160 1418 dbSNP
rs962478305 1425 dbSNP
rs1300001414 1433 dbSNP
rs1016704604 1439 dbSNP
rs543164982 1448 dbSNP
rs375361884 1449 dbSNP
rs1324384579 1455 dbSNP
rs563917041 1457 dbSNP
rs993773474 1458 dbSNP
rs897468105 1462 dbSNP
rs1045257747 1470 dbSNP
rs1188609187 1474 dbSNP
rs1264053794 1475 dbSNP
rs1467390562 1484 dbSNP
rs1488325454 1488 dbSNP
rs1252975429 1490 dbSNP
rs202185411 1492 dbSNP
rs946871543 1493 dbSNP
rs1469470543 1496 dbSNP
rs1422907048 1497 dbSNP
rs1037349980 1501 dbSNP
rs1172366078 1503 dbSNP
rs941726076 1509 dbSNP
rs926364489 1511 dbSNP
rs1044857363 1517 dbSNP
rs1052492114 1521 dbSNP
rs1307669659 1532 dbSNP
rs935381046 1534 dbSNP
rs545691478 1536 dbSNP
rs917764501 1537 dbSNP
rs987869520 1537 dbSNP
rs933963698 1544 dbSNP
rs1369951137 1552 dbSNP
rs1326566747 1553 dbSNP
rs746765980 1554 dbSNP
rs921162873 1557 dbSNP
rs1316029621 1558 dbSNP
rs371992446 1562 dbSNP
rs1443010714 1563 dbSNP
rs1261846936 1571 dbSNP
rs535484067 1576 dbSNP
rs1485877298 1578 dbSNP
rs975303293 1579 dbSNP
rs1253949321 1601 dbSNP
rs1423070862 1605 dbSNP
rs925214375 1615 dbSNP
rs578257794 1616 dbSNP
rs968740928 1617 dbSNP
rs553377369 1620 dbSNP
rs1301645362 1621 dbSNP
rs1379049874 1622 dbSNP
rs1453907684 1622 dbSNP
rs79177048 1622 dbSNP
rs955010246 1623 dbSNP
rs1237530203 1632 dbSNP
rs1284809292 1634 dbSNP
rs1003602159 1636 dbSNP
rs1453024835 1640 dbSNP
rs5756976 1641 dbSNP
rs1394850773 1644 dbSNP
rs905472363 1646 dbSNP
rs1024319624 1647 dbSNP
rs1184053806 1647 dbSNP
rs1244760977 1649 dbSNP
rs1437536602 1664 dbSNP
rs1194807873 1665 dbSNP
rs1178290874 1667 dbSNP
rs758377349 1671 dbSNP
rs1402571068 1674 dbSNP
rs1174020915 1679 dbSNP
rs893979333 1681 dbSNP
rs574040156 1693 dbSNP
rs1470593867 1694 dbSNP
rs745866970 1695 dbSNP
rs890535849 1696 dbSNP
rs898065937 1696 dbSNP
rs1278633623 1697 dbSNP
rs1037948563 1699 dbSNP
rs1480656544 1702 dbSNP
rs555572478 1703 dbSNP
rs1051797893 1708 dbSNP
rs1225027431 1711 dbSNP
rs777986621 1714 dbSNP
rs921931281 1719 dbSNP
rs975328460 1721 dbSNP
rs761260041 1724 dbSNP
rs1456305783 1727 dbSNP
rs537600003 1728 dbSNP
rs756205506 1736 dbSNP
rs1471275802 1742 dbSNP
rs1045177522 1744 dbSNP
rs1424571556 1746 dbSNP
rs1491569697 1748 dbSNP
rs1422072243 1749 dbSNP
rs1491290007 1749 dbSNP
rs1236428807 1755 dbSNP
rs1465478534 1761 dbSNP
rs949175082 1763 dbSNP
rs1443939599 1768 dbSNP
rs752724462 1776 dbSNP
rs569493217 1777 dbSNP
rs1344356216 1784 dbSNP
rs781438433 1785 dbSNP
rs181653509 1786 dbSNP
rs1285164877 1787 dbSNP
rs755179225 1789 dbSNP
rs981854478 1791 dbSNP
rs1397280493 1796 dbSNP
rs935180795 1797 dbSNP
rs1023261968 1801 dbSNP
rs925183296 1808 dbSNP
rs979383486 1809 dbSNP
rs947332240 1814 dbSNP
rs539315288 1818 dbSNP
rs1162308164 1819 dbSNP
rs1364545743 1820 dbSNP
rs116650853 1822 dbSNP
rs1304422437 1824 dbSNP
rs1455992300 1824 dbSNP
rs1362610633 1831 dbSNP
rs890576105 1834 dbSNP
rs1270648799 1837 dbSNP
rs1341252186 1843 dbSNP
rs73884660 1845 dbSNP
rs1252047972 1846 dbSNP
rs1030856803 1848 dbSNP
rs1185355958 1850 dbSNP
rs1485109373 1851 dbSNP
rs1280816114 1856 dbSNP
rs528889255 1859 dbSNP
rs111733915 1866 dbSNP
rs577335878 1867 dbSNP
rs1384293039 1878 dbSNP
rs1424905266 1879 dbSNP
rs1006434863 1880 dbSNP
rs1399575908 1881 dbSNP
rs904826864 1884 dbSNP
rs909782070 1890 dbSNP
rs1383170484 1892 dbSNP
rs1248462962 1903 dbSNP
rs1023317507 1906 dbSNP
rs1046959834 1906 dbSNP
rs1205767072 1906 dbSNP
rs1287025485 1909 dbSNP
rs1413222813 1914 dbSNP
rs372119403 1915 dbSNP
rs1355027315 1916 dbSNP
rs1313669994 1917 dbSNP
rs1013692530 1918 dbSNP
rs759679028 1920 dbSNP
rs1436993505 1921 dbSNP
rs1383181305 1930 dbSNP
rs1158499788 1936 dbSNP
rs549606294 1939 dbSNP
rs1059804 1940 dbSNP
rs141270389 1941 dbSNP
rs1469228720 1941 dbSNP
rs553539113 1941 dbSNP
rs969131050 1941 dbSNP
rs11538091 1942 dbSNP
rs1421273409 1943 dbSNP
rs3171662 1943 dbSNP
rs60490542 1943 dbSNP
rs1454346755 1944 dbSNP
rs1307409103 1950 dbSNP
rs1335383831 1952 dbSNP
rs1474574349 1953 dbSNP
rs545630089 1958 dbSNP
rs1257818453 1967 dbSNP
rs73884659 1974 dbSNP
rs1203605926 1976 dbSNP
rs1264259927 1980 dbSNP
rs1462970112 1993 dbSNP
rs999705004 2001 dbSNP
rs1445074163 2002 dbSNP
rs955065708 2022 dbSNP
rs1436858619 2023 dbSNP
rs896222697 2026 dbSNP
rs11538085 2035 dbSNP
rs996697045 2038 dbSNP
rs1037729138 2046 dbSNP
rs138367227 2046 dbSNP
rs1052648002 2053 dbSNP
rs935150189 2055 dbSNP
rs1470867113 2057 dbSNP
rs1329037378 2059 dbSNP
rs1395416058 2067 dbSNP
rs903691668 2069 dbSNP
rs761268830 2072 dbSNP
rs1331076720 2080 dbSNP
rs1006212721 2082 dbSNP
rs11538086 2084 dbSNP
rs886410196 2085 dbSNP
rs942608362 2090 dbSNP
rs1284542382 2094 dbSNP
rs1352727248 2095 dbSNP
rs1047030941 2106 dbSNP
rs1251111027 2107 dbSNP
rs1270139190 2108 dbSNP
rs1196042948 2112 dbSNP
rs1252189021 2116 dbSNP
rs1489665855 2121 dbSNP
rs910521240 2128 dbSNP
rs1231565952 2129 dbSNP
rs1198050084 2130 dbSNP
rs929871838 2137 dbSNP
rs374618234 2143 dbSNP
rs1046221654 2146 dbSNP
rs1294148671 2147 dbSNP
rs933347890 2149 dbSNP
rs923375836 2154 dbSNP
rs370925162 2160 dbSNP
rs1325118046 2165 dbSNP
rs972123102 2176 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research DIANA-microT
Original Description (Extracted from the article) ... We chose to verify one predicted MRE for each of the miRNAs that we had previously tested with “MREs” that did not abide by the miRNA binding rules (and thus did not suppress the levels of the luciferase reporter as shown in Fig. 4). ...

- Kiriakidou M; Nelson PT; Kouranov A; et al., 2004, Genes & development.

Article - Kiriakidou M; Nelson PT; Kouranov A; et al.
- Genes & development, 2004
A new paradigm of gene expression regulation has emerged recently with the discovery of microRNAs (miRNAs). Most, if not all, miRNAs are thought to control gene expression, mostly by base pairing with miRNA-recognition elements (MREs) found in their messenger RNA (mRNA) targets. Although a large number of human miRNAs have been reported, many of their mRNA targets remain unknown. Here we used a combined bioinformatics and experimental approach to identify important rules governing miRNA-MRE recognition that allow prediction of human miRNA targets. We describe a computational program, "DIANA-microT", that identifies mRNA targets for animal miRNAs and predicts mRNA targets, bearing single MREs, for human and mouse miRNAs.
LinkOut: [PMID: 15131085]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*