miRTarBase - #MIRT004364 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BCL2L2   
Synonyms BCL-W, BCL2-L-2, BCLW, PPP1R51
Description BCL2 like 2
Transcript NM_004050   
Expression
Putative miRNA Targets on BCL2L2
3'UTR of BCL2L2
(miRNA target sites are highlighted)
>BCL2L2|NM_004050|3'UTR
   1 AAGTCCAGGGCCAGGTGGGGCTAGGTGTGGCTGGGGGCCAGGAGAGCAGGAACAGAACAGAGAAATGCCCTTGGAAGAAG
  81 TGGAGTTGGTGGATGGGTGGGCATGGAACAGGATGGGCAGAGAAAGGGTAGTGTGTGAGGGAGCTGAGTAGGCCAGGTAG
 161 GCGATTGGAAGAGTGAGCAGGACACAGAGGGGAGGGGAATGTTTTGGCAAGTTTAGGGGCACAGGAGATGTAGTCGTTCC
 241 AGGGCTGGGGGAGGTGGGAGGGATCACGCCTATAGGTGTGGGCACATGAAACGACCTGGAACTTGCTTCACAGCCCTGAG
 321 GAAGGTGGACTTACATAAGCAGCTGTATTCCATTAGATGAGTGGGATTTAGGGAACGCAGAAGGCACATCCCTTTGGAAT
 401 GGAAGCTTAGGGGTTCTCAGGTGATAGGGAGAGGTGGCTGTTAACAGTGGGCTGCTTGGACACGCGTGTGCATGTGCACG
 481 CATGCTGGTGTGCATGCTGGGCTGCCTGGCAAATCTGGTGGTGATGGGATTCCTCAAGGAGAAAACATTCCCTCTTGCAA
 561 TGGCAAGAACTAGGGGCAGTTCTCTGTCCCTCCTCCCAACCCCTCCTTTCCCCTGCCCTTGTCCTGATGCCTCAAGGCTT
 641 AGAGAGAAACATTGTATCCAGACCGAGGGCTCTGCTGCTTCTTTCCAGAAAGTGATTGGCAAGGCTTTGGAGAGAAGAGC
 721 AGTTCTGCAGCTGGCCTTGTTCCTTCATCATCCCCCTTCCTTGTGCATTATGCACTTGCTGCTGCCTCCTGGGCTCTGAT
 801 AGAAGGGCAGGGCTGTTGAGCCTGGATGGGTGGAGGCTTAGGTAGCCGGACCTGCCTGCCACCCTCCTCTCCCACTCAGG
 881 CACAATGGTGCCTAAAGTGTTTCCAATCTCTGGGACCTCTGTACCCAAACTGAAACTCTAAATTGGGGCCCTAACTAATT
 961 TTCCTTTTGAGGTTGTGGGCATAAGTGCTGATCTAGAATACAGTCTGGGTCCCACACTGTGTCTCAGTGAGACTGTTGAT
1041 GCCTTGAGATGACCATTTCAGATCTGAATCCCATGGGTGTGAGGGTGATGGGTACTCCAGGACTGGCCTATGCTGTGTTG
1121 TGGGCTTTGGTTCGGCTTTATCAGGGGCCAGGCATATGGGTTCTAGAGTACCTACCATGACCTAGAAGCATTTATGATTT
1201 ATTTGAAGCCACACTGTTTGCATGGGTGTTACTTGTCTGTACCTCAGAGTCTGAGGATGTTAACTTTGGAACTCGCAGTC
1281 CTCTAGAACAGCTTCAGATTATGGCTTTTTCTTTTGAGGAAGAAATTATTCACTCCAGATGCATGCCCTGAGCCAGACCT
1361 CACTGCTGCACTTTCCAAGGTGCTAAGATTGCTGCTCTCCAATGCTAACTTTCTGACACAGTGCTCTAGAACCCTGCCTG
1441 TGGTCCTGAGCACTGATCACCTTAGCTAGACCATGGTTGACTCTTCTTGGAGATTTTCACTTGGTCCTAGAATGTGGCAA
1521 CGTAGTTGTGCTCGCCAGAACGTGGGACCAAATTGGCCTCAGGTGTTGAGTCCAGACTTCTGCTTTTGAGAGAGGGCTGC
1601 ACTTTTTCATGGTATTTCTAGGGGAGGTGGTAGGCTGCATGTGCCACTTGGTCTTGTTGTGAGTATGCTGACACCAGAAA
1681 CTCAGAGCCAGCTTGTGGCAAGCAGTTGGGGTGGGGGGTCTCTGACTTGCTCAGGACAAACTAGGCCAGTGGTTTTCAAA
1761 CTGCTTGGCAGAGCCCTGAAGTTTCCTAGGGGTTGCCTCAGGAGTCCTTGGGGAGATGAAGGGGGTGGGGAGCTGAGCAG
1841 GCTGGGCAATTTGCCCTCAAACAGAACAGCTCCCCTTGTAGCTGTCTTACATATTGGGGTTCAGGGTAAGATTTTATTTG
1921 CATTAAGGGGTTTGCTGCTGAAAAAAAGTTGGAAAACCACTGACTAGACCATCGGCTCCAAATTGGAGTCTGTGCTTCCT
2001 TCCCCAGGTATGGAGCACACTCTTCACCCTACCCTCTACCACAGGACACATATCCCTGTTAGCATTCCCCGGGACCTTTA
2081 GCCAAGAGGAGCTGCAGGGACCATGGCCAGGTTACCAAAATGCCCTGCTCTGAAGCCTTGACACCTGGGTGGAAAGAGAG
2161 GCTGTTTTCTGAAAGGGTAAAGGGCTTGGTCTGGATTCCCAGAAGCATAGCTTAGATGGGACCACAGTGGGCAATTTTGA
2241 CCTGTCCTGCCCTTCTTAGCTTGAAGGGAAACCCCAGAGACTCTTCTGTCAGGGAAAACTAGGGACTCTCTTCTAGAGCC
2321 ATATAGTTCCTTGGGATTAGCTCTTGGCCAAGAAGGCTGAGTATGGTTCCCAATTTTTAAATCCATTTCATTTTTTAAAA
2401 AATAAGGGAAATAAATGTAATTGCCATTTTTCAAAGATTAAGTAGGAGGAGAGGGGTTTCTTGCTCTCCAGAGCCCAAAG
2481 GGACAAATAGGGACTTTGTTTAGGCCAAGGAAGGAGCGGAAGTAGGGCAACTCGGTCCTGCGATTATTAATCCCACTCCC
2561 CACTTATTCTAGGGCACACAAACACTATTTTACTTTTTTAAAATCATAAAACGGCAGAACAGATTTGGTTAGTTTAGAAG
2641 AAAAGAAAGCTCTATAAATATAAATCTATATTCCTGTATTTTTATTTAATAATTTATAAATACCAAGTTCATTTGACTTT
2721 TATTTTTGTGTAATATGTAATGATCGTATTAAAAACAATAAATAAAGCCCAGAAGTTTAATGAGAAGGACTGAAAAAAAA
2801 AAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugGUAAC-AGUGUGAGGu 5'
                 :|| |  |||||||: 
Target 5' ccccaggTATGGAGCACACTCTt 3'
2002 - 2024 131.00 -14.90
2
miRNA  3' guuugUGGUAA-CAGUGUGAGGu 5'
               |::|||  || |||||| 
Target 5' ctgcgATTATTAATCCCACTCCc 3'
2538 - 2560 129.00 -11.60
3
miRNA  3' guUUGUG-GUA---ACAG-UGUGAGGu 5'
            :|||| :||   |||: :||:||| 
Target 5' agGACACATATCCCTGTTAGCATTCCc 3'
2043 - 2069 128.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30131768 13 COSMIC
COSN18738165 25 COSMIC
COSN26967776 28 COSMIC
COSN30477181 72 COSMIC
COSN30104830 107 COSMIC
COSN30131412 107 COSMIC
COSN26967775 115 COSMIC
COSN24377545 195 COSMIC
COSN23364052 455 COSMIC
COSN7431820 507 COSMIC
COSN15718342 1180 COSMIC
COSN24592182 1247 COSMIC
COSN31584453 1276 COSMIC
COSN26603490 1319 COSMIC
COSN31571876 1323 COSMIC
COSN31559499 1395 COSMIC
COSN31588854 1535 COSMIC
COSN31595196 1566 COSMIC
COSN22815191 1719 COSMIC
COSN6243083 1747 COSMIC
COSN5746874 1822 COSMIC
COSN30712777 1932 COSMIC
COSN30687748 1948 COSMIC
COSN26669503 1965 COSMIC
COSN31565722 1974 COSMIC
COSN30677155 1995 COSMIC
COSN29977539 2031 COSMIC
COSN6243084 2243 COSMIC
COSN1640422 2248 COSMIC
COSN19386032 2715 COSMIC
rs3210043 1704 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776117079 6 dbSNP
rs374244495 16 dbSNP
rs2231302 25 dbSNP
rs780543579 28 dbSNP
rs747642731 31 dbSNP
rs1419564738 34 dbSNP
rs1179644795 41 dbSNP
rs546037899 42 dbSNP
rs772782567 43 dbSNP
rs1310323429 45 dbSNP
rs200109175 51 dbSNP
rs180861464 61 dbSNP
rs1335087692 83 dbSNP
rs1233406528 84 dbSNP
rs879080604 89 dbSNP
rs1456290658 91 dbSNP
rs1257255278 92 dbSNP
rs1214094360 98 dbSNP
rs1337277891 105 dbSNP
rs1335467503 115 dbSNP
rs1227833706 116 dbSNP
rs1281787291 125 dbSNP
rs1440086723 126 dbSNP
rs1440572631 126 dbSNP
rs948633359 129 dbSNP
rs548255345 133 dbSNP
rs561881112 138 dbSNP
rs1376791688 142 dbSNP
rs566120962 151 dbSNP
rs774436930 152 dbSNP
rs1162198974 157 dbSNP
rs934718157 163 dbSNP
rs1404272259 169 dbSNP
rs1223447555 176 dbSNP
rs1053521993 180 dbSNP
rs527675437 181 dbSNP
rs756604897 186 dbSNP
rs890548268 188 dbSNP
rs944763563 199 dbSNP
rs1194084421 201 dbSNP
rs1347566719 209 dbSNP
rs1245235570 210 dbSNP
rs1221024716 212 dbSNP
rs1317608579 216 dbSNP
rs890602792 219 dbSNP
rs1039190370 221 dbSNP
rs114093099 222 dbSNP
rs1256380272 223 dbSNP
rs28727519 235 dbSNP
rs538940530 236 dbSNP
rs552372736 237 dbSNP
rs1369180277 242 dbSNP
rs1472838219 242 dbSNP
rs1345418329 244 dbSNP
rs1198617299 247 dbSNP
rs1053060381 253 dbSNP
rs1379641354 253 dbSNP
rs1427186393 256 dbSNP
rs1455425700 260 dbSNP
rs1422727746 268 dbSNP
rs891824602 268 dbSNP
rs186099381 269 dbSNP
rs1244028845 278 dbSNP
rs538075801 293 dbSNP
rs1024432051 294 dbSNP
rs970286802 298 dbSNP
rs1237054156 300 dbSNP
rs1001383421 303 dbSNP
rs1027899777 310 dbSNP
rs554698533 312 dbSNP
rs1408464605 314 dbSNP
rs1362286408 318 dbSNP
rs1290220781 322 dbSNP
rs1309858962 325 dbSNP
rs1003889174 326 dbSNP
rs1017224059 341 dbSNP
rs962637719 343 dbSNP
rs1404476554 359 dbSNP
rs1428870476 366 dbSNP
rs1015638374 377 dbSNP
rs959837661 378 dbSNP
rs1333377201 381 dbSNP
rs1477537695 384 dbSNP
rs1234389600 388 dbSNP
rs1213087912 389 dbSNP
rs1251124107 390 dbSNP
rs992550845 391 dbSNP
rs190956287 409 dbSNP
rs1022709995 411 dbSNP
rs1309592690 413 dbSNP
rs1279707395 414 dbSNP
rs1216348848 425 dbSNP
rs533509687 431 dbSNP
rs762033941 435 dbSNP
rs978589984 436 dbSNP
rs986954316 444 dbSNP
rs866745983 455 dbSNP
rs571106034 458 dbSNP
rs1302142626 462 dbSNP
rs767528752 464 dbSNP
rs988846268 465 dbSNP
rs911852507 466 dbSNP
rs1465351241 467 dbSNP
rs577430250 469 dbSNP
rs944710539 475 dbSNP
rs1039219387 480 dbSNP
rs546495900 481 dbSNP
rs936242738 485 dbSNP
rs1256111692 489 dbSNP
rs59528193 491 dbSNP
rs1256625044 497 dbSNP
rs1265144974 510 dbSNP
rs1198407353 511 dbSNP
rs1053322584 515 dbSNP
rs1273401238 519 dbSNP
rs1950252 525 dbSNP
rs1014243041 533 dbSNP
rs1199257964 536 dbSNP
rs1046197592 543 dbSNP
rs111480091 548 dbSNP
rs905949506 551 dbSNP
rs542057727 559 dbSNP
rs1329126986 565 dbSNP
rs930844571 573 dbSNP
rs1464891625 587 dbSNP
rs1395525089 590 dbSNP
rs1049183854 594 dbSNP
rs1474517609 596 dbSNP
rs1367909820 601 dbSNP
rs1159909277 602 dbSNP
rs1421466484 605 dbSNP
rs368751711 618 dbSNP
rs1005524830 619 dbSNP
rs768295943 624 dbSNP
rs1469146835 628 dbSNP
rs1170705840 631 dbSNP
rs1036714510 634 dbSNP
rs369662743 635 dbSNP
rs117138993 638 dbSNP
rs1353656895 645 dbSNP
rs1301432381 653 dbSNP
rs1013911004 655 dbSNP
rs1348532918 657 dbSNP
rs1306933004 660 dbSNP
rs1022760703 665 dbSNP
rs969788394 666 dbSNP
rs1295224616 669 dbSNP
rs766365468 679 dbSNP
rs1025607345 681 dbSNP
rs1000038650 694 dbSNP
rs955019383 695 dbSNP
rs1033235171 697 dbSNP
rs986492684 700 dbSNP
rs1231150984 712 dbSNP
rs1289563337 718 dbSNP
rs1299358991 720 dbSNP
rs910925424 721 dbSNP
rs1379025237 723 dbSNP
rs1158528357 726 dbSNP
rs1454985186 734 dbSNP
rs1221024141 737 dbSNP
rs1197179794 740 dbSNP
rs550318232 744 dbSNP
rs979618659 749 dbSNP
rs1489383565 751 dbSNP
rs926103698 755 dbSNP
rs753772043 763 dbSNP
rs59634591 767 dbSNP
rs1463372036 768 dbSNP
rs1190314500 772 dbSNP
rs541033918 775 dbSNP
rs966054654 780 dbSNP
rs1319169752 781 dbSNP
rs564528146 788 dbSNP
rs147292152 792 dbSNP
rs1358630016 794 dbSNP
rs922025827 795 dbSNP
rs937429265 807 dbSNP
rs1038488887 812 dbSNP
rs930687441 813 dbSNP
rs1404975514 826 dbSNP
rs898329863 833 dbSNP
rs994036970 837 dbSNP
rs1383519356 847 dbSNP
rs1049239318 848 dbSNP
rs1193375944 849 dbSNP
rs1478526547 860 dbSNP
rs1025535169 865 dbSNP
rs1365422727 876 dbSNP
rs1244796528 881 dbSNP
rs891053399 884 dbSNP
rs754736616 902 dbSNP
rs940857236 904 dbSNP
rs1343978797 912 dbSNP
rs1057143750 913 dbSNP
rs778711150 922 dbSNP
rs1220631953 925 dbSNP
rs1017924827 927 dbSNP
rs1260039283 931 dbSNP
rs141040681 932 dbSNP
rs569218458 944 dbSNP
rs979201122 951 dbSNP
rs1332730443 965 dbSNP
rs1032084872 968 dbSNP
rs149848377 974 dbSNP
rs1013964302 975 dbSNP
rs1173256472 979 dbSNP
rs1466923237 981 dbSNP
rs1460990571 986 dbSNP
rs1420984624 989 dbSNP
rs1044051610 1021 dbSNP
rs905614398 1028 dbSNP
rs999918197 1029 dbSNP
rs1185241881 1039 dbSNP
rs950343343 1040 dbSNP
rs1273515535 1043 dbSNP
rs1032749818 1046 dbSNP
rs752315636 1054 dbSNP
rs1257635898 1065 dbSNP
rs1234014314 1070 dbSNP
rs1424471454 1075 dbSNP
rs1158528908 1077 dbSNP
rs956090602 1078 dbSNP
rs1010067451 1092 dbSNP
rs1019311393 1099 dbSNP
rs1282962531 1101 dbSNP
rs531533973 1107 dbSNP
rs937379088 1111 dbSNP
rs974716518 1134 dbSNP
rs548409833 1135 dbSNP
rs777260445 1137 dbSNP
rs1415261653 1140 dbSNP
rs1160936348 1143 dbSNP
rs952146123 1147 dbSNP
rs890980643 1151 dbSNP
rs985312567 1153 dbSNP
rs1237809784 1155 dbSNP
rs1222515080 1158 dbSNP
rs1008125730 1161 dbSNP
rs1287905675 1164 dbSNP
rs576374293 1169 dbSNP
rs543708304 1189 dbSNP
rs1312038436 1205 dbSNP
rs1305695418 1212 dbSNP
rs1000946613 1213 dbSNP
rs1238468154 1213 dbSNP
rs1330281510 1215 dbSNP
rs1056627755 1216 dbSNP
rs1351250176 1217 dbSNP
rs780769841 1223 dbSNP
rs1404216735 1224 dbSNP
rs1326948298 1233 dbSNP
rs1160320058 1238 dbSNP
rs918173101 1248 dbSNP
rs1230159360 1254 dbSNP
rs1437611528 1257 dbSNP
rs1268467267 1275 dbSNP
rs183322615 1276 dbSNP
rs1489612441 1278 dbSNP
rs1245179301 1297 dbSNP
rs1044096498 1302 dbSNP
rs2076680 1313 dbSNP
rs144693557 1329 dbSNP
rs1488636161 1336 dbSNP
rs1054652667 1342 dbSNP
rs988910136 1359 dbSNP
rs891534227 1363 dbSNP
rs750469919 1379 dbSNP
rs1249719469 1380 dbSNP
rs1473824369 1393 dbSNP
rs1267960350 1400 dbSNP
rs1010489958 1403 dbSNP
rs1369340104 1404 dbSNP
rs1272664324 1410 dbSNP
rs539080434 1412 dbSNP
rs1435165482 1415 dbSNP
rs1018740132 1420 dbSNP
rs1183514746 1421 dbSNP
rs1417861907 1422 dbSNP
rs971996489 1425 dbSNP
rs1176585657 1432 dbSNP
rs1434640071 1444 dbSNP
rs556430242 1447 dbSNP
rs1429284255 1452 dbSNP
rs1190758885 1455 dbSNP
rs1535094 1461 dbSNP
rs1028855155 1466 dbSNP
rs952073355 1476 dbSNP
rs1178749249 1483 dbSNP
rs1360481515 1485 dbSNP
rs188775826 1494 dbSNP
rs919977864 1496 dbSNP
rs1222588946 1500 dbSNP
rs1340742890 1516 dbSNP
rs1279591322 1521 dbSNP
rs1306805286 1522 dbSNP
rs555944041 1523 dbSNP
rs1303320334 1526 dbSNP
rs79730308 1532 dbSNP
rs772390564 1534 dbSNP
rs1288907242 1535 dbSNP
rs918066934 1542 dbSNP
rs948188148 1543 dbSNP
rs1426012734 1556 dbSNP
rs1217243550 1558 dbSNP
rs1280500054 1566 dbSNP
rs1191653729 1568 dbSNP
rs981043289 1570 dbSNP
rs1312924470 1571 dbSNP
rs1257518336 1574 dbSNP
rs925523517 1578 dbSNP
rs773411996 1580 dbSNP
rs1054090483 1581 dbSNP
rs1237338433 1596 dbSNP
rs1199634200 1597 dbSNP
rs1272823086 1611 dbSNP
rs1484073473 1612 dbSNP
rs1318222829 1613 dbSNP
rs1259535542 1621 dbSNP
rs1216291326 1622 dbSNP
rs1306347986 1625 dbSNP
rs1206003190 1630 dbSNP
rs1313359101 1636 dbSNP
rs1311702268 1637 dbSNP
rs1268768503 1638 dbSNP
rs1397773171 1641 dbSNP
rs1376880219 1645 dbSNP
rs912391296 1647 dbSNP
rs1447212687 1654 dbSNP
rs1402756008 1670 dbSNP
rs891539470 1675 dbSNP
rs1465170223 1685 dbSNP
rs191138928 1699 dbSNP
rs3210043 1704 dbSNP
rs899756009 1706 dbSNP
rs1256046171 1711 dbSNP
rs1426323279 1713 dbSNP
rs1459339150 1714 dbSNP
rs1433355447 1716 dbSNP
rs1040625755 1717 dbSNP
rs559834241 1724 dbSNP
rs995949896 1726 dbSNP
rs1319905924 1732 dbSNP
rs527487933 1733 dbSNP
rs1314228156 1740 dbSNP
rs542856490 1745 dbSNP
rs1329575035 1751 dbSNP
rs1378747519 1751 dbSNP
rs78478800 1767 dbSNP
rs1391688537 1776 dbSNP
rs1025178448 1778 dbSNP
rs753786499 1781 dbSNP
rs1380607448 1785 dbSNP
rs1014888578 1793 dbSNP
rs1159712150 1796 dbSNP
rs1003454773 1798 dbSNP
rs112933062 1800 dbSNP
rs1276334647 1801 dbSNP
rs1418188690 1804 dbSNP
rs959224263 1808 dbSNP
rs974044053 1811 dbSNP
rs1217171311 1813 dbSNP
rs749607151 1821 dbSNP
rs1306863463 1833 dbSNP
rs764971735 1839 dbSNP
rs1295636323 1841 dbSNP
rs1331927789 1848 dbSNP
rs982864099 1851 dbSNP
rs183445900 1858 dbSNP
rs755229529 1867 dbSNP
rs562728241 1875 dbSNP
rs1291165959 1879 dbSNP
rs1422132808 1881 dbSNP
rs969584249 1912 dbSNP
rs1359151131 1922 dbSNP
rs1158400808 1928 dbSNP
rs1478532759 1931 dbSNP
rs1377870350 1932 dbSNP
rs1200462459 1935 dbSNP
rs1430960145 1938 dbSNP
rs1450319090 1939 dbSNP
rs1224451859 1941 dbSNP
rs1267623987 1941 dbSNP
rs980927271 1942 dbSNP
rs758104312 1944 dbSNP
rs925531717 1950 dbSNP
rs187184653 1959 dbSNP
rs1204365447 1963 dbSNP
rs1458715832 1969 dbSNP
rs1176311782 1971 dbSNP
rs112390836 1974 dbSNP
rs912866438 1975 dbSNP
rs568264910 1980 dbSNP
rs774993450 1983 dbSNP
rs1278959521 1992 dbSNP
rs1401895650 1993 dbSNP
rs1423535239 1997 dbSNP
rs527518745 2003 dbSNP
rs1433059303 2004 dbSNP
rs759933515 2005 dbSNP
rs1318202441 2006 dbSNP
rs936573375 2011 dbSNP
rs767687695 2020 dbSNP
rs945692694 2033 dbSNP
rs1428139701 2035 dbSNP
rs1330819006 2041 dbSNP
rs1395451277 2046 dbSNP
rs1009226627 2047 dbSNP
rs10149339 2049 dbSNP
rs1276340114 2050 dbSNP
rs570494160 2051 dbSNP
rs1218506067 2057 dbSNP
rs1385969216 2061 dbSNP
rs1296201765 2063 dbSNP
rs540082087 2067 dbSNP
rs1442925302 2068 dbSNP
rs1258093661 2071 dbSNP
rs931852904 2071 dbSNP
rs1166956694 2072 dbSNP
rs1319989876 2076 dbSNP
rs1220572422 2077 dbSNP
rs1196177621 2078 dbSNP
rs1256906659 2084 dbSNP
rs1468604293 2086 dbSNP
rs1223335633 2104 dbSNP
rs1245283214 2107 dbSNP
rs1477905502 2108 dbSNP
rs1187531338 2109 dbSNP
rs1426385923 2110 dbSNP
rs1477149169 2111 dbSNP
rs756829010 2117 dbSNP
rs780786244 2123 dbSNP
rs958881436 2125 dbSNP
rs1407232769 2126 dbSNP
rs1321833489 2129 dbSNP
rs1349584122 2136 dbSNP
rs1435478523 2138 dbSNP
rs995752800 2139 dbSNP
rs1289272759 2142 dbSNP
rs1342253604 2143 dbSNP
rs1216746818 2146 dbSNP
rs1170864624 2155 dbSNP
rs1466748869 2158 dbSNP
rs1276958733 2159 dbSNP
rs1334927274 2160 dbSNP
rs1229605307 2161 dbSNP
rs1006114997 2162 dbSNP
rs142850799 2164 dbSNP
rs754056685 2165 dbSNP
rs374168548 2166 dbSNP
rs1450734435 2171 dbSNP
rs1216911120 2172 dbSNP
rs758326674 2175 dbSNP
rs1036785604 2177 dbSNP
rs951322363 2183 dbSNP
rs897849456 2189 dbSNP
rs1200694310 2190 dbSNP
rs1436090129 2228 dbSNP
rs1283619333 2235 dbSNP
rs749831306 2238 dbSNP
rs1025097969 2243 dbSNP
rs1230167549 2246 dbSNP
rs1228941906 2257 dbSNP
rs965864297 2260 dbSNP
rs1282901698 2261 dbSNP
rs1316894586 2266 dbSNP
rs975548374 2275 dbSNP
rs1378040387 2294 dbSNP
rs571235443 2295 dbSNP
rs921084280 2297 dbSNP
rs1448626584 2307 dbSNP
rs755553188 2309 dbSNP
rs1002373263 2311 dbSNP
rs555742144 2324 dbSNP
rs1465923792 2327 dbSNP
rs958543847 2352 dbSNP
rs988438405 2364 dbSNP
rs1443792841 2366 dbSNP
rs914122872 2373 dbSNP
rs1236604857 2384 dbSNP
rs1180271754 2390 dbSNP
rs550907793 2396 dbSNP
rs1468833108 2397 dbSNP
rs1232470220 2418 dbSNP
rs967112420 2445 dbSNP
rs1453333475 2449 dbSNP
rs1471504396 2454 dbSNP
rs1164543604 2466 dbSNP
rs945007756 2474 dbSNP
rs1222480624 2485 dbSNP
rs569972619 2489 dbSNP
rs45519738 2492 dbSNP
rs937737294 2509 dbSNP
rs1054918364 2510 dbSNP
rs931694160 2514 dbSNP
rs1156596218 2518 dbSNP
rs995678396 2519 dbSNP
rs1300730959 2529 dbSNP
rs1424010444 2531 dbSNP
rs1050241548 2534 dbSNP
rs191254635 2535 dbSNP
rs1160260533 2542 dbSNP
rs572585576 2551 dbSNP
rs909017801 2555 dbSNP
rs1398700573 2556 dbSNP
rs941839759 2560 dbSNP
rs1191931568 2562 dbSNP
rs1479123808 2569 dbSNP
rs1049485 2570 dbSNP
rs1198754332 2575 dbSNP
rs534947062 2580 dbSNP
rs1288716791 2581 dbSNP
rs1214126607 2585 dbSNP
rs1316627687 2597 dbSNP
rs1283130308 2598 dbSNP
rs1004193768 2600 dbSNP
rs897728797 2605 dbSNP
rs183840707 2606 dbSNP
rs1403773311 2607 dbSNP
rs142892590 2613 dbSNP
rs748605592 2614 dbSNP
rs905293776 2616 dbSNP
rs1428401145 2623 dbSNP
rs975896012 2632 dbSNP
rs543801039 2640 dbSNP
rs1350366849 2642 dbSNP
rs1416424536 2646 dbSNP
rs772322328 2648 dbSNP
rs1270638260 2649 dbSNP
rs1175829151 2665 dbSNP
rs773428331 2669 dbSNP
rs1032413356 2675 dbSNP
rs1330236672 2679 dbSNP
rs1200279365 2696 dbSNP
rs745354169 2696 dbSNP
rs957827313 2704 dbSNP
rs1265978707 2712 dbSNP
rs989279999 2716 dbSNP
rs958257025 2746 dbSNP
rs563690626 2747 dbSNP
rs945312240 2749 dbSNP
rs747178640 2752 dbSNP
rs1222381702 2757 dbSNP
rs1317927026 2757 dbSNP
rs1297083632 2759 dbSNP
rs1380528404 2769 dbSNP
rs1440355214 2771 dbSNP
rs576375289 2772 dbSNP
rs1361153439 2775 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEP3B , HepG2
Location of target site 3'UTR
Tools used in this research TargetScan , RNAhybrid , PicTar
Original Description (Extracted from the article) ... This suggests that miR-122 specifically targets to Bcl-w in these cells. ...

- Lin CJ; Gong HY; Tseng HC; Wang WL; Wu JL, 2008, Biochemical and biophysical research communications.

Article - Lin CJ; Gong HY; Tseng HC; Wang WL; Wu JL
- Biochemical and biophysical research communications, 2008
miR-122, a hepato-specific microRNA (miRNA), is frequently down-regulated in human hepatocellular carcinoma (HCC). In an effort to identify novel miR-122 targets, we performed an in silico analysis and detected a putative binding site in the 3'-untranslated region (3'-UTR) of Bcl-w, an anti-apoptotic Bcl-2 family member. In the HCC-derived cell lines, Hep3B and HepG2, we confirmed that miR-122 modulates Bcl-w expression by directly targeting binding site within the 3'-UTR. The cellular mRNA and protein levels of Bcl-w were repressed by elevated levels of miR-122, which subsequently led to reduction of cell viability and activation of caspase-3. Thus, Bcl-w is a direct target of miR-122 that functions as an endogenous apoptosis regulator in these HCC-derived cell lines.
LinkOut: [PMID: 18692484]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions SK-HEP-1 , HEPG2
Disease liver diseases
Tools used in this research previous_study
Original Description (Extracted from the article) ... This was further confirmed by the drastic increase of miR-122 and inhibition of its down-stream target Bcl-w (Fig. 5A and B). We then investigated hepatic delivery of miR-122 by DOTMA–OA LNPs. The result demonstrated that miR-122 could be suc- cessfully delivered to liver by DOTMA–OA LNPs. Compared to in vivo positive control Invivofectamine, DOTMA–OA LNPs mediated miR-122 delivery showed a similar level of miR-122 delivery and down-stream target Bcl-w reduction. ...

- Wang X; Yu B; Ren W; Mo X; Zhou C; He H; et al., 2013, Journal of controlled release : official journal of the Controlled Release Society.

Article - Wang X; Yu B; Ren W; Mo X; Zhou C; He H; et al.
- Journal of controlled release : official journal of the Controlled Release Society, 2013
Many cationic lipids have been developed for lipid-based nanoparticles (LNPs) for delivery of siRNA and microRNA (miRNA). However, less attention has been paid to "helper lipids". Here, we investigated several "helper lipids" and examined their effects on the physicochemical properties such as particle size and zeta potential, as well as cellular uptake and transfection efficiency. We found that inclusion of oleic acid (OA), an unsaturated fatty acid, into the LNP formulation significantly enhanced the delivery efficacy for siRNA and miRNA. For proof-of-concept, miR-122, a liver-specific microRNA associated with many liver diseases, was used as a model agent to demonstrate the hepatic delivery efficacy both in tumor cells and in animals. Compared to Lipofectamine 2000, a commercial transfection agent, LNPs containing OA delivered microRNA-122 in a more efficient manner with a 1.8-fold increase in mature miR-122 expression and a 20% decrease in Bcl-w, a target of microRNA-122. In comparison with Invivofectamine, a commercial transfection agent specifically designed for hepatic delivery, LNPs containing OA showed comparable liver accumulation and in vivo delivery efficiency. These findings demonstrated the importance of "helper lipid" components of the LNP formulation on the cellular uptake and transfection activity of siRNA and miRNA. LNPs containing OA is a promising nanocarrier system for the delivery of RNA-based therapeutics in liver diseases.
LinkOut: [PMID: 24121065]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*