miRTarBase - #MIRT005763 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TP53   
Synonyms BCC7, LFS1, P53, TRP53
Description tumor protein p53
Transcript NM_001126114   
Other Transcripts NM_001126112 , NM_000546 , NM_001126113 , NM_001126115 , NM_001126116 , NM_001126117   
Expression
Putative miRNA Targets on TP53
3'UTR of TP53
(miRNA target sites are highlighted)
>TP53|NM_001126114|3'UTR
   1 AGAGAGCATGAAAATGGTTCTATGACTTTGCCTGATACAGATGCTACTTGACTTACGATGGTGTTACTTCCTGATAAACT
  81 CGTCGTAAGTTGAAAATATTATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAG
 161 GATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTC
 241 CCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCCACTTCTTGTTCCCCACTGACAGC
 321 CTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGA
 401 AGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGCTCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGG
 481 AGGATGGGGAGTAGGACATACCAGCTTAGATTTTAAGGTTTTTACTGTGAGGGATGTTTGGGAGATGTAAGAAATGTTCT
 561 TGCAGTTAAGGGTTAGTTTACAATCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCT
 641 CACTGTTGAATTTTCTCTAACTTCAAGGCCCATATCTGTGAAATGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTG
 721 AGGGTTAATGAAATAATGTACATCTGGCCTTGAAACCACCTTTTATTACATGGGGTCTAGAACTTGACCCCCTTGAGGGT
 801 GCTTGTTCCCTCTCCCTGTTGGTCGGTGGGTTGGTAGTTTCTACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAG
 881 TCTCTGCTGGCCCAGCCAAACCCTGTCTGACAACCTCTTGGTGAACCTTAGTACCTAAAAGGAAATCTCACCCCATCCCA
 961 CACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATTTCTTTT
1041 TTCTTTTTTTTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATC
1121 TTGGCTTACTGCAGCCTTTGCCTCCCCGGCTCGAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATG
1201 CCACCATGGCCAGCCAACTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTTGCCCAGGCTGGTCTCAAACTCCTGG
1281 GCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACAATTGTGAGCCACCACGTCCAGCTGGAAGGGTCA
1361 ACATCTTTTACATTCTGCAAGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTA
1441 TATCGATCTCTTATTTTACAATAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAU---ACACGACGau 5'
               || || |   | ||||||  
Target 5' attttACAATAAAACTTTGCTGCca 3'
1453 - 1477 129.00 -8.50
2
miRNA  3' guGUUU--GGUA---AUAC---ACGACgau 5'
            |||:  ||||   |:||   |||||   
Target 5' ttCAAGGCCCATATCTGTGAAATGCTGgca 3'
662 - 691 118.00 -12.90
3
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            |||::|    | |||||   
Target 5' gtCAAGTC----TCTGCTGgcc 3'
875 - 892 110.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
630888 4 ClinVar
371962 6 ClinVar
920442 12 ClinVar
371863 16 ClinVar
492640 16 ClinVar
492641 17 ClinVar
492642 20 ClinVar
803306 30 ClinVar
926994 39 ClinVar
920392 49 ClinVar
492643 56 ClinVar
492644 57 ClinVar
924881 58 ClinVar
492645 59 ClinVar
630847 61 ClinVar
492646 62 ClinVar
920212 67 ClinVar
927925 71 ClinVar
584920 75 ClinVar
492647 79 ClinVar
492648 81 ClinVar
492649 82 ClinVar
629929 82 ClinVar
492650 84 ClinVar
492651 85 ClinVar
548873 87 ClinVar
627874 87 ClinVar
627761 89 ClinVar
631028 90 ClinVar
628372 103 ClinVar
927924 103 ClinVar
182950 114 ClinVar
182951 2575 ClinVar
385783 2580 ClinVar
1105087 2582 ClinVar
1122992 2584 ClinVar
1079313 2586 ClinVar
458582 2586 ClinVar
458581 2587 ClinVar
1177440 2590 ClinVar
487000 2590 ClinVar
142161 2591 ClinVar
232659 2591 ClinVar
458583 2594 ClinVar
798976 2594 ClinVar
184745 2595 ClinVar
142273 2596 ClinVar
634781 2596 ClinVar
182969 2598 ClinVar
186086 2598 ClinVar
428876 2598 ClinVar
951578 2599 ClinVar
187180 2600 ClinVar
141159 2601 ClinVar
480738 2602 ClinVar
634780 2602 ClinVar
840626 2602 ClinVar
1086350 2603 ClinVar
482236 2606 ClinVar
1019612 2607 ClinVar
142536 2607 ClinVar
237938 2607 ClinVar
12379 2608 ClinVar
142828 2608 ClinVar
177879 2608 ClinVar
512946 2609 ClinVar
633018 2609 ClinVar
428906 2610 ClinVar
423398 2611 ClinVar
628432 2611 ClinVar
182952 2612 ClinVar
482226 2612 ClinVar
1072958 2613 ClinVar
141893 2613 ClinVar
142846 2613 ClinVar
438708 2613 ClinVar
634676 2613 ClinVar
822016 2614 ClinVar
959616 2614 ClinVar
428861 2617 ClinVar
818264 2617 ClinVar
1020154 2618 ClinVar
971781 2619 ClinVar
220073 2621 ClinVar
182970 2622 ClinVar
1055894 2623 ClinVar
215996 2623 ClinVar
233136 2623 ClinVar
428885 2623 ClinVar
822031 2623 ClinVar
1158153 2624 ClinVar
1015453 2625 ClinVar
818260 2627 ClinVar
818289 2628 ClinVar
956897 2628 ClinVar
12375 2629 ClinVar
220903 2630 ClinVar
458512 2630 ClinVar
634751 2633 ClinVar
634697 2634 ClinVar
646925 2634 ClinVar
634693 2635 ClinVar
480755 2636 ClinVar
482222 2636 ClinVar
662690 2637 ClinVar
422725 2638 ClinVar
43587 2638 ClinVar
1116648 2639 ClinVar
486998 2639 ClinVar
406571 2640 ClinVar
1066930 2642 ClinVar
634695 2643 ClinVar
657729 2643 ClinVar
839717 2643 ClinVar
481022 2646 ClinVar
854234 2646 ClinVar
428864 2649 ClinVar
576681 2649 ClinVar
72340 2649 ClinVar
377386 2650 ClinVar
458513 2650 ClinVar
1066207 2651 ClinVar
822085 2651 ClinVar
481148 2652 ClinVar
1061283 2658 ClinVar
231485 2658 ClinVar
458514 2658 ClinVar
629928 2659 ClinVar
482215 2660 ClinVar
1046623 2662 ClinVar
528241 2662 ClinVar
389554 2663 ClinVar
234059 2664 ClinVar
584919 2667 ClinVar
142105 2670 ClinVar
230534 2671 ClinVar
1171953 2674 ClinVar
492570 2675 ClinVar
186887 2676 ClinVar
480753 2676 ClinVar
549855 2676 ClinVar
142003 2677 ClinVar
142552 2677 ClinVar
230306 2677 ClinVar
480761 2679 ClinVar
141331 2680 ClinVar
256601 2681 ClinVar
1205464 2682 ClinVar
458515 2682 ClinVar
549856 2682 ClinVar
458516 2683 ClinVar
485048 2683 ClinVar
188151 2685 ClinVar
233244 2686 ClinVar
818357 2687 ClinVar
945439 2687 ClinVar
848951 2688 ClinVar
568955 2689 ClinVar
80708 2691 ClinVar
1121868 2693 ClinVar
135360 2694 ClinVar
528252 2694 ClinVar
927316 2695 ClinVar
231953 2697 ClinVar
858737 2698 ClinVar
1046409 2701 ClinVar
382777 2701 ClinVar
418518 2703 ClinVar
659571 2703 ClinVar
528274 2705 ClinVar
237939 2706 ClinVar
1120854 2707 ClinVar
414032 2708 ClinVar
458517 2708 ClinVar
631104 2710 ClinVar
142381 2711 ClinVar
492571 2713 ClinVar
387112 2714 ClinVar
924682 2718 ClinVar
514156 2719 ClinVar
810938 2728 ClinVar
1171172 3604 ClinVar
918307 3604 ClinVar
1121207 3609 ClinVar
1116590 3610 ClinVar
764087 3610 ClinVar
381768 3614 ClinVar
141332 3615 ClinVar
635383 3615 ClinVar
231146 3616 ClinVar
188342 3618 ClinVar
919211 3618 ClinVar
485038 3620 ClinVar
485042 3620 ClinVar
657014 3620 ClinVar
1138543 3623 ClinVar
822173 3623 ClinVar
628982 3626 ClinVar
919471 3629 ClinVar
1059222 3630 ClinVar
230970 3631 ClinVar
439315 3631 ClinVar
1059527 3634 ClinVar
577458 3634 ClinVar
1052297 3635 ClinVar
628429 3635 ClinVar
839498 3635 ClinVar
141583 3636 ClinVar
230269 3636 ClinVar
665996 3636 ClinVar
237940 3638 ClinVar
480739 3639 ClinVar
629927 3641 ClinVar
182956 3642 ClinVar
492573 3643 ClinVar
569094 3645 ClinVar
975959 3645 ClinVar
822222 3646 ClinVar
511854 3647 ClinVar
745265 3647 ClinVar
480749 3649 ClinVar
414033 3650 ClinVar
186611 3651 ClinVar
186762 3651 ClinVar
1023676 3652 ClinVar
216463 3652 ClinVar
246221 3652 ClinVar
185679 3653 ClinVar
428872 3656 ClinVar
458520 3657 ClinVar
619732 3657 ClinVar
976475 3657 ClinVar
860528 3661 ClinVar
569582 3662 ClinVar
619733 3663 ClinVar
183740 3665 ClinVar
482224 3665 ClinVar
182939 3666 ClinVar
406575 3667 ClinVar
458521 3667 ClinVar
639734 3668 ClinVar
418519 3669 ClinVar
485029 3669 ClinVar
818446 3673 ClinVar
485050 3676 ClinVar
428878 3677 ClinVar
663754 3677 ClinVar
141425 3679 ClinVar
156517 3681 ClinVar
458522 3681 ClinVar
762432 3683 ClinVar
818485 3684 ClinVar
629063 3689 ClinVar
1002444 3693 ClinVar
492574 3693 ClinVar
818502 3693 ClinVar
458523 3694 ClinVar
1026463 3695 ClinVar
428888 3696 ClinVar
485043 3696 ClinVar
639571 3696 ClinVar
458524 3698 ClinVar
385946 3704 ClinVar
380960 3711 ClinVar
384516 3713 ClinVar
245980 3714 ClinVar
1174011 3720 ClinVar
325643 3797 ClinVar
891780 3842 ClinVar
891535 3866 ClinVar
325642 3903 ClinVar
325641 4025 ClinVar
891534 4026 ClinVar
325640 4044 ClinVar
325639 4045 ClinVar
891533 4055 ClinVar
325638 4080 ClinVar
891532 4107 ClinVar
325637 4183 ClinVar
325636 4246 ClinVar
325635 4263 ClinVar
325634 4269 ClinVar
325633 4311 ClinVar
325632 4324 ClinVar
325631 4433 ClinVar
325630 4445 ClinVar
325629 4452 ClinVar
889968 4458 ClinVar
889967 4459 ClinVar
325627 4471 ClinVar
325628 4471 ClinVar
325626 4478 ClinVar
325625 4488 ClinVar
325624 4504 ClinVar
325623 4524 ClinVar
325622 4634 ClinVar
325621 4675 ClinVar
325620 4768 ClinVar
889286 4830 ClinVar
325619 4858 ClinVar
35555 4873 ClinVar
COSN31491002 10 COSMIC
COSN30656658 15 COSMIC
COSN8603844 23 COSMIC
COSN15659984 24 COSMIC
COSM7345028 53 COSMIC
COSM1610827 55 COSMIC
COSM5009278 81 COSMIC
COSM6899675 82 COSMIC
COSM1731910 83 COSMIC
COSM5760987 84 COSMIC
COSM5948481 84 COSMIC
COSM5548292 86 COSMIC
COSM6206391 86 COSMIC
COSN30765150 89 COSMIC
COSN26958070 90 COSMIC
COSN31770143 90 COSMIC
COSN30538339 91 COSMIC
COSN504279 100 COSMIC
COSN22328707 225 COSMIC
COSN23714689 349 COSMIC
COSN6549382 754 COSMIC
COSN21463599 1002 COSMIC
COSN20874862 1195 COSMIC
COSN6661035 1689 COSMIC
COSN28834353 1789 COSMIC
COSN6661034 1850 COSMIC
COSN29926087 1866 COSMIC
COSN32152495 2176 COSMIC
COSN9323318 2308 COSMIC
COSN20863086 2323 COSMIC
COSN4770637 2492 COSMIC
COSM3773294 2584 COSMIC
COSM3970337 2590 COSMIC
COSM43791 2590 COSMIC
COSM87027 2590 COSMIC
COSM13745 2591 COSMIC
COSM49007 2591 COSMIC
COSM69404 2591 COSMIC
COSM8393388 2592 COSMIC
COSM69084 2594 COSMIC
COSM4384911 2595 COSMIC
COSM5752850 2595 COSMIC
COSM4749449 2596 COSMIC
COSM9612861 2596 COSMIC
COSM6806499 2597 COSMIC
COSM8495138 2597 COSMIC
COSM48816 2598 COSMIC
COSM5752303 2598 COSMIC
COSM11514 2599 COSMIC
COSM330687 2599 COSMIC
COSM7116744 2600 COSMIC
COSM8763940 2600 COSMIC
COSM288629 2601 COSMIC
COSM5752261 2601 COSMIC
COSM1268340 2602 COSMIC
COSM295248 2602 COSMIC
COSM6853656 2603 COSMIC
COSM11291 2604 COSMIC
COSM3733842 2604 COSMIC
COSM6444465 2604 COSMIC
COSM5573808 2605 COSMIC
COSM4426601 2606 COSMIC
COSM11071 2607 COSMIC
COSM111628 2607 COSMIC
COSM1563605 2607 COSMIC
COSM11411 2608 COSMIC
COSM378685 2608 COSMIC
COSM43882 2608 COSMIC
COSM4745947 2608 COSMIC
COSM45767 2610 COSMIC
COSM9497691 2610 COSMIC
COSM4422058 2612 COSMIC
COSM45126 2612 COSMIC
COSM4749447 2612 COSMIC
COSM6562338 2612 COSMIC
COSM6574495 2612 COSMIC
COSM11286 2613 COSMIC
COSM5230441 2613 COSMIC
COSM5442033 2613 COSMIC
COSM9854012 2613 COSMIC
COSM4765570 2614 COSMIC
COSM7505378 2614 COSMIC
COSM7565790 2615 COSMIC
COSM84370 2616 COSMIC
COSM7817983 2617 COSMIC
COSM6853254 2618 COSMIC
COSM8407778 2619 COSMIC
COSM1386561 2620 COSMIC
COSM5003760 2620 COSMIC
COSM9613853 2620 COSMIC
COSM18597 2621 COSMIC
COSM306101 2621 COSMIC
COSM44906 2621 COSMIC
COSM8330996 2621 COSMIC
COSM11073 2622 COSMIC
COSM4776577 2622 COSMIC
COSM45276 2623 COSMIC
COSM46149 2623 COSMIC
COSM11078 2625 COSMIC
COSM44070 2629 COSMIC
COSM46303 2629 COSMIC
COSM6953698 2629 COSMIC
COSM5702490 2630 COSMIC
COSM69016 2630 COSMIC
COSM4070032 2631 COSMIC
COSM1169349 2632 COSMIC
COSM44083 2634 COSMIC
COSM69193 2634 COSMIC
COSM45717 2637 COSMIC
COSM46015 2641 COSMIC
COSM5013841 2641 COSMIC
COSM8363420 2641 COSMIC
COSM46056 2642 COSMIC
COSM46348 2642 COSMIC
COSM10770 2643 COSMIC
COSM307337 2648 COSMIC
COSM107991 2649 COSMIC
COSM1522202 2649 COSMIC
COSM3362446 2651 COSMIC
COSM6081948 2658 COSMIC
COSM9926510 2660 COSMIC
COSM6903969 2661 COSMIC
COSM13159 2676 COSMIC
COSM1709726 2680 COSMIC
COSM5028205 2681 COSMIC
COSM46151 2699 COSMIC
COSN22116997 2778 COSMIC
COSN6112478 2926 COSMIC
COSN25367237 3099 COSMIC
COSN6661033 3396 COSMIC
COSN22875264 3397 COSMIC
COSN4770636 3452 COSMIC
COSM1191161 3615 COSMIC
COSM12663 3615 COSMIC
COSM45409 3615 COSMIC
COSM6806501 3630 COSMIC
COSM9523656 3634 COSMIC
COSM4984777 3636 COSMIC
COSM307348 3639 COSMIC
COSM3403253 3639 COSMIC
COSM4820570 3643 COSMIC
COSM1658763 3645 COSMIC
COSM5352218 3649 COSMIC
COSM13747 3657 COSMIC
COSM1167962 3659 COSMIC
COSM7652999 3671 COSMIC
COSM5028203 3674 COSMIC
COSM7346174 3679 COSMIC
COSM9612863 3685 COSMIC
COSM371784 3687 COSMIC
COSM8599359 3693 COSMIC
COSM9545860 3693 COSMIC
COSN30460568 3732 COSMIC
COSN26999411 3746 COSMIC
COSN30480199 3747 COSMIC
COSN30463584 3764 COSMIC
COSN30166158 3796 COSMIC
COSN30146960 3797 COSMIC
COSN31770142 3835 COSMIC
COSN30500011 3839 COSMIC
COSN31554676 3866 COSMIC
COSN30528032 3885 COSMIC
COSN20093202 4085 COSMIC
COSN6661031 4107 COSMIC
COSN23343006 4146 COSMIC
COSN28835013 4242 COSMIC
COSN4770634 4591 COSMIC
COSN31770141 4854 COSMIC
COSN64739 4857 COSMIC
rs1641548 1846 GWAS
rs1641549 1850 GWAS
rs78378222 4873 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1470589675 4 dbSNP
rs17883348 6 dbSNP
rs772425309 7 dbSNP
rs1392806365 12 dbSNP
rs768929781 14 dbSNP
rs576532147 16 dbSNP
rs978869607 17 dbSNP
rs1472524313 22 dbSNP
rs944920583 25 dbSNP
rs1373684374 30 dbSNP
rs970528656 30 dbSNP
rs1195682045 31 dbSNP
rs1476954259 34 dbSNP
rs1262669916 37 dbSNP
rs1223693877 44 dbSNP
rs1412438685 46 dbSNP
rs1490931437 47 dbSNP
rs1288373809 52 dbSNP
rs554738122 56 dbSNP
rs771319678 57 dbSNP
rs1270269782 58 dbSNP
rs749361930 59 dbSNP
rs1337983762 61 dbSNP
rs1642789 62 dbSNP
rs993079710 63 dbSNP
rs1351357911 67 dbSNP
rs770028766 71 dbSNP
rs1404688767 72 dbSNP
rs1397372864 78 dbSNP
rs200274944 79 dbSNP
rs758194998 81 dbSNP
rs201293647 82 dbSNP
rs756952434 84 dbSNP
rs372821099 85 dbSNP
rs1242967622 88 dbSNP
rs1245315319 89 dbSNP
rs1198863423 95 dbSNP
rs1438885967 103 dbSNP
rs772238542 103 dbSNP
rs1486986872 111 dbSNP
rs763552838 113 dbSNP
rs730882013 114 dbSNP
rs1481041086 116 dbSNP
rs1315489278 120 dbSNP
rs1257059459 122 dbSNP
rs77697176 124 dbSNP
rs1369543455 126 dbSNP
rs1186381858 131 dbSNP
rs866197292 136 dbSNP
rs1400540221 143 dbSNP
rs1160317626 145 dbSNP
rs1433858614 147 dbSNP
rs1301928393 149 dbSNP
rs1345660490 149 dbSNP
rs1343996983 155 dbSNP
rs888144984 159 dbSNP
rs1026591822 161 dbSNP
rs1375871549 162 dbSNP
rs1327113020 163 dbSNP
rs559350878 163 dbSNP
rs1319889701 165 dbSNP
rs1328202162 167 dbSNP
rs1224087142 175 dbSNP
rs1286128845 179 dbSNP
rs1432980729 180 dbSNP
rs1219712788 182 dbSNP
rs1268261518 182 dbSNP
rs1334090742 182 dbSNP
rs1491079143 182 dbSNP
rs34308401 182 dbSNP
rs71928208 182 dbSNP
rs772614038 182 dbSNP
rs866365189 182 dbSNP
rs1307443747 183 dbSNP
rs1441262609 183 dbSNP
rs1305668300 184 dbSNP
rs1409013463 187 dbSNP
rs1177758629 190 dbSNP
rs1335058776 192 dbSNP
rs1442850022 195 dbSNP
rs1642790 202 dbSNP
rs1642791 203 dbSNP
rs1281053110 212 dbSNP
rs1469645374 218 dbSNP
rs908366761 222 dbSNP
rs996646379 225 dbSNP
rs1291375794 226 dbSNP
rs899570924 227 dbSNP
rs1170462604 229 dbSNP
rs571468420 233 dbSNP
rs1224763573 234 dbSNP
rs1272576861 240 dbSNP
rs1437699954 241 dbSNP
rs944871095 243 dbSNP
rs890605124 248 dbSNP
rs1242334473 249 dbSNP
rs563904209 250 dbSNP
rs1182576368 251 dbSNP
rs1385420854 256 dbSNP
rs1463145941 257 dbSNP
rs1244941410 258 dbSNP
rs1012922465 260 dbSNP
rs958933242 264 dbSNP
rs1033108728 265 dbSNP
rs934886887 267 dbSNP
rs139290680 268 dbSNP
rs567516831 276 dbSNP
rs75732100 277 dbSNP
rs576323612 281 dbSNP
rs755642178 289 dbSNP
rs1383717267 295 dbSNP
rs1248460725 309 dbSNP
rs1297121548 311 dbSNP
rs1338901328 314 dbSNP
rs992903925 318 dbSNP
rs1051095570 319 dbSNP
rs1275784835 319 dbSNP
rs960159828 321 dbSNP
rs932350037 322 dbSNP
rs920915692 327 dbSNP
rs1038108730 331 dbSNP
rs142074865 336 dbSNP
rs1357790769 338 dbSNP
rs1331375592 340 dbSNP
rs1422924821 341 dbSNP
rs1410866264 342 dbSNP
rs908417865 343 dbSNP
rs982690235 345 dbSNP
rs1167540982 346 dbSNP
rs982585850 347 dbSNP
rs1386511092 348 dbSNP
rs60699444 349 dbSNP
rs781465240 350 dbSNP
rs1235657677 351 dbSNP
rs1272035081 352 dbSNP
rs181226769 353 dbSNP
rs1478779853 361 dbSNP
rs796129859 361 dbSNP
rs796188484 361 dbSNP
rs1438159757 362 dbSNP
rs1274240606 367 dbSNP
rs1203234386 373 dbSNP
rs532898697 379 dbSNP
rs1315740412 380 dbSNP
rs1194613086 388 dbSNP
rs899457593 395 dbSNP
rs1019799701 401 dbSNP
rs565441023 404 dbSNP
rs1177150797 411 dbSNP
rs890655611 415 dbSNP
rs1000319509 418 dbSNP
rs1455490080 428 dbSNP
rs1053262010 430 dbSNP
rs999146944 431 dbSNP
rs1384481534 458 dbSNP
rs762189959 459 dbSNP
rs1281759905 461 dbSNP
rs1343786872 463 dbSNP
rs1404842444 464 dbSNP
rs1284536663 465 dbSNP
rs904784938 468 dbSNP
rs1237282312 470 dbSNP
rs1043274567 471 dbSNP
rs1260509034 472 dbSNP
rs948749443 473 dbSNP
rs1642792 474 dbSNP
rs867033084 475 dbSNP
rs377562831 479 dbSNP
rs576653882 481 dbSNP
rs1200033770 486 dbSNP
rs908424379 499 dbSNP
rs982569390 510 dbSNP
rs561180123 514 dbSNP
rs919844102 521 dbSNP
rs1364180915 544 dbSNP
rs1454494855 548 dbSNP
rs975331278 552 dbSNP
rs1160550401 564 dbSNP
rs964061389 568 dbSNP
rs1363761831 574 dbSNP
rs1019262765 582 dbSNP
rs996813215 590 dbSNP
rs1366894428 592 dbSNP
rs1008417266 602 dbSNP
rs1422712080 607 dbSNP
rs956440365 609 dbSNP
rs1037994047 610 dbSNP
rs1336792712 613 dbSNP
rs1240705535 622 dbSNP
rs1030723604 623 dbSNP
rs999027361 624 dbSNP
rs1312527857 626 dbSNP
rs904668946 637 dbSNP
rs1043716141 642 dbSNP
rs1013157554 644 dbSNP
rs1293328810 649 dbSNP
rs1479586637 652 dbSNP
rs908300783 658 dbSNP
rs1250928640 666 dbSNP
rs1046775161 669 dbSNP
rs1470407752 671 dbSNP
rs542790794 673 dbSNP
rs1250735058 677 dbSNP
rs1180306365 680 dbSNP
rs1491584236 681 dbSNP
rs1292765694 682 dbSNP
rs1491453018 682 dbSNP
rs949927188 683 dbSNP
rs1367591465 685 dbSNP
rs894492701 689 dbSNP
rs1319972336 697 dbSNP
rs1286997473 704 dbSNP
rs1397632262 706 dbSNP
rs572228741 708 dbSNP
rs991443687 710 dbSNP
rs868101909 737 dbSNP
rs938804301 739 dbSNP
rs925975317 745 dbSNP
rs1286778852 750 dbSNP
rs1407138210 751 dbSNP
rs1305331201 753 dbSNP
rs1226569238 755 dbSNP
rs908639591 756 dbSNP
rs967350128 760 dbSNP
rs1293727403 762 dbSNP
rs1201467542 767 dbSNP
rs1242314767 775 dbSNP
rs1047094358 777 dbSNP
rs1184510612 779 dbSNP
rs1457002233 781 dbSNP
rs1347570935 787 dbSNP
rs1161229398 790 dbSNP
rs1426866153 791 dbSNP
rs1457647661 794 dbSNP
rs1020396556 800 dbSNP
rs1169856584 803 dbSNP
rs1411142847 804 dbSNP
rs754685194 805 dbSNP
rs919739313 808 dbSNP
rs1335076876 822 dbSNP
rs1405888202 832 dbSNP
rs1452917077 833 dbSNP
rs1338347996 836 dbSNP
rs975763736 838 dbSNP
rs1269921104 854 dbSNP
rs1359450551 856 dbSNP
rs1381101112 857 dbSNP
rs963974377 864 dbSNP
rs1029573601 872 dbSNP
rs12949655 892 dbSNP
rs1221665188 894 dbSNP
rs986474682 895 dbSNP
rs1016430249 902 dbSNP
rs1204532509 910 dbSNP
rs1243864810 911 dbSNP
rs111537395 912 dbSNP
rs1262541352 915 dbSNP
rs1329145259 915 dbSNP
rs1479074318 917 dbSNP
rs1174952696 925 dbSNP
rs1030774658 926 dbSNP
rs1470476861 935 dbSNP
rs1000589618 938 dbSNP
rs1178699473 938 dbSNP
rs1046825893 939 dbSNP
rs766131158 946 dbSNP
rs949818771 961 dbSNP
rs968905519 968 dbSNP
rs1403024352 969 dbSNP
rs1282628246 975 dbSNP
rs34833072 979 dbSNP
rs1346086651 983 dbSNP
rs577924025 992 dbSNP
rs1013627336 998 dbSNP
rs35821533 998 dbSNP
rs1315300678 1012 dbSNP
rs937153152 1023 dbSNP
rs894721400 1024 dbSNP
rs1301579073 1025 dbSNP
rs1036316448 1031 dbSNP
rs925880221 1035 dbSNP
rs1385825827 1040 dbSNP
rs1193238515 1044 dbSNP
rs978648759 1045 dbSNP
rs1399727182 1056 dbSNP
rs1364893745 1057 dbSNP
rs1422152778 1060 dbSNP
rs1642793 1061 dbSNP
rs1642794 1070 dbSNP
rs1366069006 1072 dbSNP
rs913217804 1080 dbSNP
rs1277532238 1082 dbSNP
rs1372397274 1089 dbSNP
rs1223423167 1092 dbSNP
rs987612761 1097 dbSNP
rs887084396 1099 dbSNP
rs954951957 1101 dbSNP
rs1220304818 1106 dbSNP
rs1291164373 1107 dbSNP
rs1047146110 1110 dbSNP
rs146137066 1111 dbSNP
rs898344989 1119 dbSNP
rs1016483984 1120 dbSNP
rs1377941772 1133 dbSNP
rs1039535418 1140 dbSNP
rs35184400 1141 dbSNP
rs942645819 1141 dbSNP
rs34937086 1145 dbSNP
rs912483879 1145 dbSNP
rs986692613 1146 dbSNP
rs1189356598 1148 dbSNP
rs934998565 1149 dbSNP
rs1246767693 1150 dbSNP
rs1206075593 1153 dbSNP
rs1462062506 1161 dbSNP
rs567554024 1164 dbSNP
rs549217778 1175 dbSNP
rs979200579 1189 dbSNP
rs967789461 1191 dbSNP
rs1022246562 1193 dbSNP
rs186939279 1194 dbSNP
rs773048474 1210 dbSNP
rs1271432300 1216 dbSNP
rs1014037486 1218 dbSNP
rs560899639 1226 dbSNP
rs1055527872 1230 dbSNP
rs1363780764 1232 dbSNP
rs1318490159 1236 dbSNP
rs1454456838 1238 dbSNP
rs1208611830 1248 dbSNP
rs1385304894 1251 dbSNP
rs1473524571 1252 dbSNP
rs959085352 1253 dbSNP
rs763453185 1255 dbSNP
rs1402655368 1256 dbSNP
rs867768041 1257 dbSNP
rs1172530854 1262 dbSNP
rs1302119251 1266 dbSNP
rs761985831 1270 dbSNP
rs887136627 1280 dbSNP
rs1025580577 1281 dbSNP
rs995587181 1293 dbSNP
rs566578950 1301 dbSNP
rs1040158636 1302 dbSNP
rs551407356 1304 dbSNP
rs1219835674 1318 dbSNP
rs865814048 1319 dbSNP
rs1321936235 1321 dbSNP
rs1185977105 1333 dbSNP
rs945944177 1335 dbSNP
rs1424837247 1337 dbSNP
rs913270146 1338 dbSNP
rs776792368 1343 dbSNP
rs1052207494 1346 dbSNP
rs532881941 1347 dbSNP
rs1475684739 1348 dbSNP
rs372884119 1351 dbSNP
rs1256062146 1363 dbSNP
rs1426929133 1369 dbSNP
rs1199147833 1371 dbSNP
rs1469048605 1381 dbSNP
rs1441672346 1383 dbSNP
rs768839725 1384 dbSNP
rs1416402499 1390 dbSNP
rs935218580 1399 dbSNP
rs1276375979 1415 dbSNP
rs1205368447 1419 dbSNP
rs922028288 1426 dbSNP
rs974825023 1427 dbSNP
rs1280712066 1433 dbSNP
rs1340864209 1434 dbSNP
rs1344183059 1435 dbSNP
rs1223206831 1438 dbSNP
rs923643026 1441 dbSNP
rs963541766 1453 dbSNP
rs1346663528 1454 dbSNP
rs1203052629 1455 dbSNP
rs909367179 1466 dbSNP
rs979087404 1471 dbSNP
rs1447135928 1472 dbSNP
rs1195232144 1481 dbSNP
rs78339449 1489 dbSNP
rs747298573 1490 dbSNP
rs983705805 1491 dbSNP
rs946343795 1497 dbSNP
rs1479110464 1501 dbSNP
rs542931290 1502 dbSNP
rs550289831 1507 dbSNP
rs990950535 1511 dbSNP
rs1420319859 1516 dbSNP
rs531910508 1522 dbSNP
rs1364205254 1523 dbSNP
rs1404936804 1531 dbSNP
rs1025190253 1535 dbSNP
rs1333261826 1536 dbSNP
rs1236417274 1543 dbSNP
rs1035805736 1544 dbSNP
rs1014356602 1546 dbSNP
rs1402075766 1555 dbSNP
rs1218117501 1557 dbSNP
rs959706243 1570 dbSNP
rs1341057537 1586 dbSNP
rs981681909 1591 dbSNP
rs1269195672 1601 dbSNP
rs1311887742 1605 dbSNP
rs2543549 1608 dbSNP
rs1394109816 1609 dbSNP
rs1180835680 1611 dbSNP
rs2856753 1620 dbSNP
rs1398309451 1622 dbSNP
rs1363369160 1626 dbSNP
rs1440579349 1627 dbSNP
rs181893255 1628 dbSNP
rs1383517502 1629 dbSNP
rs1001269361 1632 dbSNP
rs1294692164 1633 dbSNP
rs1393535328 1638 dbSNP
rs1389965146 1639 dbSNP
rs1328640406 1644 dbSNP
rs1377120569 1654 dbSNP
rs1241932538 1655 dbSNP
rs772371360 1661 dbSNP
rs904397437 1662 dbSNP
rs542829475 1672 dbSNP
rs1042903853 1673 dbSNP
rs189071925 1681 dbSNP
rs963010233 1682 dbSNP
rs891710839 1687 dbSNP
rs867984283 1688 dbSNP
rs858528 1689 dbSNP
rs386795046 1690 dbSNP
rs1180822903 1692 dbSNP
rs545532442 1696 dbSNP
rs1423261543 1702 dbSNP
rs921942744 1710 dbSNP
rs890986164 1715 dbSNP
rs578029160 1716 dbSNP
rs184744474 1719 dbSNP
rs1167677058 1720 dbSNP
rs1401533098 1727 dbSNP
rs17879148 1728 dbSNP
rs770550088 1732 dbSNP
rs902440724 1732 dbSNP
rs1381598607 1747 dbSNP
rs1482564623 1752 dbSNP
rs1314281823 1755 dbSNP
rs942114489 1756 dbSNP
rs1043627558 1760 dbSNP
rs9891744 1761 dbSNP
rs1037987440 1764 dbSNP
rs1211159979 1777 dbSNP
rs17880467 1784 dbSNP
rs1261424628 1787 dbSNP
rs950846090 1801 dbSNP
rs916201125 1804 dbSNP
rs1258412696 1806 dbSNP
rs573996273 1809 dbSNP
rs1427227110 1811 dbSNP
rs1054909441 1815 dbSNP
rs1356394811 1816 dbSNP
rs918178208 1817 dbSNP
rs1264823674 1820 dbSNP
rs1467456937 1832 dbSNP
rs772531785 1845 dbSNP
rs1641548 1846 dbSNP
rs748029403 1847 dbSNP
rs1466249370 1849 dbSNP
rs1641549 1850 dbSNP
rs1359341618 1853 dbSNP
rs1381570138 1855 dbSNP
rs1278703686 1859 dbSNP
rs1342299459 1860 dbSNP
rs1221422367 1861 dbSNP
rs1262305436 1864 dbSNP
rs1311806792 1866 dbSNP
rs951515291 1881 dbSNP
rs918841579 1882 dbSNP
rs1406058451 1887 dbSNP
rs1484967453 1896 dbSNP
rs1216002653 1903 dbSNP
rs17879377 1904 dbSNP
rs1479104417 1909 dbSNP
rs754455533 1912 dbSNP
rs1424963838 1919 dbSNP
rs751223217 1920 dbSNP
rs766011905 1931 dbSNP
rs1343091073 1937 dbSNP
rs1418493044 1938 dbSNP
rs36118870 1941 dbSNP
rs997424133 1942 dbSNP
rs181967587 1944 dbSNP
rs188174141 1945 dbSNP
rs374036485 1948 dbSNP
rs1282365408 1949 dbSNP
rs1471804249 1952 dbSNP
rs1368120655 1954 dbSNP
rs1220020672 1961 dbSNP
rs568844938 1966 dbSNP
rs1315353844 1967 dbSNP
rs1239462202 1969 dbSNP
rs1249211995 1979 dbSNP
rs941999852 1981 dbSNP
rs1200495680 1982 dbSNP
rs371516690 1983 dbSNP
rs1488979443 1990 dbSNP
rs1193294683 1991 dbSNP
rs887863723 1998 dbSNP
rs999364309 1998 dbSNP
rs902321266 2002 dbSNP
rs1047776996 2003 dbSNP
rs137965105 2007 dbSNP
rs534826791 2008 dbSNP
rs758161546 2018 dbSNP
rs1227609829 2019 dbSNP
rs1438263280 2020 dbSNP
rs894832839 2034 dbSNP
rs1055195195 2040 dbSNP
rs528829894 2042 dbSNP
rs939147992 2057 dbSNP
rs1371390817 2062 dbSNP
rs918075811 2066 dbSNP
rs184454769 2076 dbSNP
rs17884322 2077 dbSNP
rs1356022590 2085 dbSNP
rs1243890907 2087 dbSNP
rs1437387103 2090 dbSNP
rs1322889909 2093 dbSNP
rs1047430290 2107 dbSNP
rs1330605883 2110 dbSNP
rs1321748376 2111 dbSNP
rs549224203 2120 dbSNP
rs12946538 2129 dbSNP
rs1390088939 2130 dbSNP
rs17884559 2131 dbSNP
rs560783470 2139 dbSNP
rs963288216 2140 dbSNP
rs1162133906 2144 dbSNP
rs1414390465 2147 dbSNP
rs1407033403 2153 dbSNP
rs1168026895 2160 dbSNP
rs545247733 2167 dbSNP
rs12938753 2182 dbSNP
rs1173980770 2183 dbSNP
rs985875147 2187 dbSNP
rs1332233351 2191 dbSNP
rs1379403671 2191 dbSNP
rs1478112158 2193 dbSNP
rs988546065 2195 dbSNP
rs955321115 2197 dbSNP
rs1230571778 2199 dbSNP
rs750169071 2202 dbSNP
rs533498896 2204 dbSNP
rs966561730 2205 dbSNP
rs1459725742 2227 dbSNP
rs1022527988 2230 dbSNP
rs1010861579 2239 dbSNP
rs895046352 2243 dbSNP
rs765276270 2247 dbSNP
rs1003623315 2253 dbSNP
rs1184776619 2254 dbSNP
rs1422850703 2258 dbSNP
rs1465887371 2261 dbSNP
rs906184667 2279 dbSNP
rs1402670546 2290 dbSNP
rs1006194541 2291 dbSNP
rs1047498548 2298 dbSNP
rs1463389044 2302 dbSNP
rs1276791920 2304 dbSNP
rs17883852 2310 dbSNP
rs897369585 2311 dbSNP
rs1047827819 2318 dbSNP
rs1219583181 2323 dbSNP
rs1199559459 2324 dbSNP
rs1278705532 2325 dbSNP
rs1443696024 2326 dbSNP
rs1213044466 2333 dbSNP
rs1038937607 2340 dbSNP
rs941506255 2341 dbSNP
rs761897890 2349 dbSNP
rs985709543 2350 dbSNP
rs1230760888 2355 dbSNP
rs1426991081 2360 dbSNP
rs896682837 2367 dbSNP
rs933989754 2371 dbSNP
rs1433452453 2379 dbSNP
rs1056643588 2380 dbSNP
rs1408759637 2386 dbSNP
rs938139296 2388 dbSNP
rs1401192984 2389 dbSNP
rs922582915 2394 dbSNP
rs1300399815 2397 dbSNP
rs1329776009 2401 dbSNP
rs1232058204 2403 dbSNP
rs926881615 2407 dbSNP
rs567314083 2409 dbSNP
rs869163611 2422 dbSNP
rs1346725804 2425 dbSNP
rs1237267897 2434 dbSNP
rs979653485 2436 dbSNP
rs978197220 2441 dbSNP
rs1218789639 2444 dbSNP
rs1266494408 2456 dbSNP
rs947064083 2458 dbSNP
rs966784240 2461 dbSNP
rs914222430 2464 dbSNP
rs1479141005 2469 dbSNP
rs1022164301 2470 dbSNP
rs1379801206 2471 dbSNP
rs776700854 2473 dbSNP
rs1415827832 2476 dbSNP
rs959197743 2489 dbSNP
rs869146348 2498 dbSNP
rs2543550 2500 dbSNP
rs555389091 2502 dbSNP
rs760814284 2503 dbSNP
rs544624015 2506 dbSNP
rs574044660 2510 dbSNP
rs1324646902 2512 dbSNP
rs1187860344 2516 dbSNP
rs1382417803 2526 dbSNP
rs1444181010 2527 dbSNP
rs1003401871 2530 dbSNP
rs753236134 2544 dbSNP
rs868745759 2549 dbSNP
rs555791463 2551 dbSNP
rs759914394 2553 dbSNP
rs1355593035 2555 dbSNP
rs2856754 2556 dbSNP
rs1210162353 2557 dbSNP
rs774628036 2560 dbSNP
rs1399611338 2561 dbSNP
rs1177470839 2562 dbSNP
rs1416379939 2563 dbSNP
rs1423583244 2566 dbSNP
rs1025932575 2571 dbSNP
rs1172375940 2573 dbSNP
rs371831907 2574 dbSNP
rs368691910 2575 dbSNP
rs1057522329 2580 dbSNP
rs778896272 2581 dbSNP
rs375273756 2587 dbSNP
rs867389695 2590 dbSNP
rs587782272 2591 dbSNP
rs769934890 2595 dbSNP
rs573154688 2596 dbSNP
rs730882028 2598 dbSNP
rs1286563734 2599 dbSNP
rs786203531 2600 dbSNP
rs375444154 2601 dbSNP
rs771939956 2602 dbSNP
rs587782529 2607 dbSNP
rs121912664 2608 dbSNP
rs1218459955 2609 dbSNP
rs1131691040 2610 dbSNP
rs1064796401 2611 dbSNP
rs150293825 2612 dbSNP
rs17882252 2613 dbSNP
rs1237829645 2614 dbSNP
rs1131691005 2617 dbSNP
rs1463722976 2618 dbSNP
rs864622369 2621 dbSNP
rs730882029 2622 dbSNP
rs1131691022 2623 dbSNP
rs1321845532 2623 dbSNP
rs375338359 2623 dbSNP
rs375573770 2625 dbSNP
rs121912662 2629 dbSNP
rs752189180 2630 dbSNP
rs397516434 2638 dbSNP
rs1450229137 2639 dbSNP
rs1060501193 2640 dbSNP
rs768046010 2646 dbSNP
rs1131691008 2649 dbSNP
rs141402957 2649 dbSNP
rs1057519625 2650 dbSNP
rs755394212 2658 dbSNP
rs752142489 2659 dbSNP
rs1382535379 2660 dbSNP
rs1157427821 2661 dbSNP
rs1057523467 2663 dbSNP
rs766786605 2664 dbSNP
rs763426446 2668 dbSNP
rs587782237 2670 dbSNP
rs773553186 2671 dbSNP
rs1483922249 2674 dbSNP
rs539224556 2675 dbSNP
rs786203298 2676 dbSNP
rs35993958 2677 dbSNP
rs587781663 2680 dbSNP
rs886038349 2681 dbSNP
rs1287887419 2682 dbSNP
rs768803947 2683 dbSNP
rs745751553 2685 dbSNP
rs876660285 2686 dbSNP
rs267605075 2691 dbSNP
rs17881470 2694 dbSNP
rs876659459 2697 dbSNP
rs749150541 2698 dbSNP
rs1057521454 2701 dbSNP
rs1064793280 2703 dbSNP
rs889930337 2703 dbSNP
rs777374791 2705 dbSNP
rs878854062 2706 dbSNP
rs1431720273 2707 dbSNP
rs374041625 2708 dbSNP
rs77881630 2711 dbSNP
rs1056928992 2714 dbSNP
rs2856755 2719 dbSNP
rs747858937 2721 dbSNP
rs1419404994 2723 dbSNP
rs780532950 2724 dbSNP
rs17880847 2728 dbSNP
rs1370718204 2733 dbSNP
rs752057841 2738 dbSNP
rs905346274 2742 dbSNP
rs1477008944 2744 dbSNP
rs375905156 2758 dbSNP
rs1042405302 2761 dbSNP
rs1466906222 2774 dbSNP
rs1300534425 2776 dbSNP
rs1472661353 2778 dbSNP
rs1400947039 2779 dbSNP
rs1396519461 2797 dbSNP
rs1314703927 2798 dbSNP
rs1338339552 2800 dbSNP
rs914274879 2808 dbSNP
rs1431184484 2812 dbSNP
rs945326591 2815 dbSNP
rs1370785291 2816 dbSNP
rs866334697 2818 dbSNP
rs1206976421 2819 dbSNP
rs915314758 2830 dbSNP
rs546183010 2831 dbSNP
rs989557396 2832 dbSNP
rs934279838 2835 dbSNP
rs1427239968 2843 dbSNP
rs113532093 2846 dbSNP
rs1482934750 2849 dbSNP
rs1201114274 2851 dbSNP
rs45599946 2852 dbSNP
rs926459330 2853 dbSNP
rs373232559 2854 dbSNP
rs1472354257 2862 dbSNP
rs1193367289 2865 dbSNP
rs970609571 2872 dbSNP
rs910384618 2873 dbSNP
rs1026153616 2884 dbSNP
rs750659817 2886 dbSNP
rs984707200 2887 dbSNP
rs993124613 2890 dbSNP
rs951972108 2891 dbSNP
rs1358524414 2892 dbSNP
rs1274172210 2896 dbSNP
rs1203169013 2899 dbSNP
rs749835622 2900 dbSNP
rs1298578535 2903 dbSNP
rs1342206302 2904 dbSNP
rs778233808 2907 dbSNP
rs963051145 2909 dbSNP
rs1026612689 2911 dbSNP
rs767450897 2915 dbSNP
rs1016438615 2916 dbSNP
rs1487574448 2920 dbSNP
rs1216600995 2925 dbSNP
rs993533369 2928 dbSNP
rs200833833 2937 dbSNP
rs889976878 2943 dbSNP
rs1049920308 2944 dbSNP
rs34481829 2946 dbSNP
rs1410816427 2951 dbSNP
rs34071557 2953 dbSNP
rs551963476 2962 dbSNP
rs998474515 2976 dbSNP
rs1174940825 2981 dbSNP
rs901433374 2983 dbSNP
rs1042624234 2996 dbSNP
rs1346904695 3021 dbSNP
rs945378870 3024 dbSNP
rs541043048 3028 dbSNP
rs533320504 3029 dbSNP
rs1035140789 3033 dbSNP
rs1367141953 3039 dbSNP
rs1387601198 3042 dbSNP
rs1351668464 3046 dbSNP
rs1002680117 3050 dbSNP
rs1351062027 3052 dbSNP
rs1319283379 3055 dbSNP
rs938106473 3057 dbSNP
rs926483071 3058 dbSNP
rs1488601461 3070 dbSNP
rs981917409 3084 dbSNP
rs892724535 3092 dbSNP
rs774814657 3096 dbSNP
rs373630656 3098 dbSNP
rs1178753756 3099 dbSNP
rs867330035 3101 dbSNP
rs1053091570 3103 dbSNP
rs563011559 3108 dbSNP
rs919193094 3113 dbSNP
rs1251411792 3114 dbSNP
rs971925113 3117 dbSNP
rs544759991 3118 dbSNP
rs184902382 3125 dbSNP
rs562093509 3129 dbSNP
rs953149748 3130 dbSNP
rs746489943 3156 dbSNP
rs540616984 3157 dbSNP
rs901318793 3163 dbSNP
rs1255721410 3165 dbSNP
rs573108091 3168 dbSNP
rs1229443094 3175 dbSNP
rs17881097 3176 dbSNP
rs1471765183 3178 dbSNP
rs1287353501 3179 dbSNP
rs1002320899 3188 dbSNP
rs1476026787 3197 dbSNP
rs1168309748 3202 dbSNP
rs1398316686 3204 dbSNP
rs1009809210 3206 dbSNP
rs1465345092 3217 dbSNP
rs112847074 3241 dbSNP
rs59098034 3242 dbSNP
rs1445931473 3245 dbSNP
rs557108944 3246 dbSNP
rs905288023 3252 dbSNP
rs1322423794 3253 dbSNP
rs1276758917 3254 dbSNP
rs17878510 3255 dbSNP
rs757409408 3258 dbSNP
rs919076942 3259 dbSNP
rs1435197338 3261 dbSNP
rs1208822586 3273 dbSNP
rs1426116959 3276 dbSNP
rs1486623320 3277 dbSNP
rs1040453342 3281 dbSNP
rs971975999 3282 dbSNP
rs535217969 3293 dbSNP
rs1421922643 3295 dbSNP
rs1412798249 3297 dbSNP
rs567792812 3302 dbSNP
rs1376573649 3303 dbSNP
rs1417207555 3304 dbSNP
rs1048772457 3305 dbSNP
rs985822710 3311 dbSNP
rs1209848617 3313 dbSNP
rs1228626208 3314 dbSNP
rs953123140 3322 dbSNP
rs1464742723 3329 dbSNP
rs1266557615 3330 dbSNP
rs930508964 3335 dbSNP
rs1349925314 3340 dbSNP
rs552581224 3344 dbSNP
rs919068365 3349 dbSNP
rs1262405165 3350 dbSNP
rs1488456544 3353 dbSNP
rs527453856 3357 dbSNP
rs1030105351 3370 dbSNP
rs534282314 3372 dbSNP
rs1477193386 3377 dbSNP
rs1218173733 3384 dbSNP
rs567172278 3385 dbSNP
rs6503048 3396 dbSNP
rs17886820 3403 dbSNP
rs1435641065 3404 dbSNP
rs116597433 3414 dbSNP
rs1286959363 3416 dbSNP
rs576983083 3417 dbSNP
rs1320717621 3421 dbSNP
rs989550560 3430 dbSNP
rs1002226479 3431 dbSNP
rs1435359391 3451 dbSNP
rs148924516 3457 dbSNP
rs1372470233 3463 dbSNP
rs1285172785 3469 dbSNP
rs1351345906 3471 dbSNP
rs1046492286 3480 dbSNP
rs1189785226 3482 dbSNP
rs1287520317 3489 dbSNP
rs1450082372 3496 dbSNP
rs1198493259 3505 dbSNP
rs1449465080 3512 dbSNP
rs562130162 3513 dbSNP
rs145723145 3529 dbSNP
rs1380171930 3535 dbSNP
rs897704706 3538 dbSNP
rs778913915 3540 dbSNP
rs17883043 3544 dbSNP
rs1405155486 3545 dbSNP
rs1326086669 3549 dbSNP
rs1372763110 3551 dbSNP
rs1443876426 3552 dbSNP
rs1208928359 3559 dbSNP
rs767047551 3566 dbSNP
rs17881850 3568 dbSNP
rs986431055 3571 dbSNP
rs1477936971 3573 dbSNP
rs750853458 3574 dbSNP
rs1214186545 3591 dbSNP
rs1487817629 3593 dbSNP
rs1214098149 3596 dbSNP
rs897689379 3604 dbSNP
rs1265988018 3606 dbSNP
rs1223648956 3613 dbSNP
rs1057521167 3614 dbSNP
rs587781664 3615 dbSNP
rs876658982 3616 dbSNP
rs786204227 3618 dbSNP
rs1289241865 3620 dbSNP
rs765530090 3629 dbSNP
rs876658876 3631 dbSNP
rs1342613419 3635 dbSNP
rs587781858 3636 dbSNP
rs878854063 3638 dbSNP
rs764011631 3641 dbSNP
rs730882017 3642 dbSNP
rs760820708 3644 dbSNP
rs774269719 3645 dbSNP
rs770970987 3646 dbSNP
rs1456836660 3647 dbSNP
rs80184930 3648 dbSNP
rs1060504165 3650 dbSNP
rs749061599 3651 dbSNP
rs863224682 3652 dbSNP
rs786202368 3653 dbSNP
rs1131691012 3656 dbSNP
rs150842067 3663 dbSNP
rs373710656 3665 dbSNP
rs730882009 3666 dbSNP
rs1060501196 3667 dbSNP
rs1064793281 3670 dbSNP
rs927888647 3676 dbSNP
rs1131691017 3677 dbSNP
rs587781736 3679 dbSNP
rs587783064 3681 dbSNP
rs749817236 3684 dbSNP
rs769664911 3691 dbSNP
rs1192921623 3693 dbSNP
rs1131691024 3696 dbSNP
rs369567704 3704 dbSNP
rs8065799 3707 dbSNP
rs1199379236 3708 dbSNP
rs1057520915 3711 dbSNP
rs374294340 3713 dbSNP
rs879254030 3714 dbSNP
rs931650342 3719 dbSNP
rs1396668926 3721 dbSNP
rs1392636908 3724 dbSNP
rs746581308 3728 dbSNP
rs1313220839 3729 dbSNP
rs1303843723 3730 dbSNP
rs545818827 3732 dbSNP
rs1042526 3735 dbSNP
rs759018180 3736 dbSNP
rs948064327 3737 dbSNP
rs915225600 3738 dbSNP
rs1337185656 3739 dbSNP
rs1299204877 3740 dbSNP
rs1272331020 3743 dbSNP
rs1446917019 3746 dbSNP
rs1401818114 3747 dbSNP
rs760698953 3749 dbSNP
rs1197664400 3751 dbSNP
rs1190175072 3766 dbSNP
rs922919883 3772 dbSNP
rs1254630661 3776 dbSNP
rs1485659622 3783 dbSNP
rs1424782182 3784 dbSNP
rs1420564028 3791 dbSNP
rs1255839276 3792 dbSNP
rs886053513 3797 dbSNP
rs35919705 3803 dbSNP
rs375913211 3804 dbSNP
rs1463033550 3806 dbSNP
rs1031046075 3818 dbSNP
rs1401378909 3824 dbSNP
rs1380447822 3825 dbSNP
rs1415365392 3839 dbSNP
rs771458013 3840 dbSNP
rs371002418 3842 dbSNP
rs958423177 3843 dbSNP
rs1032606977 3849 dbSNP
rs1399170624 3857 dbSNP
rs1295076873 3865 dbSNP
rs1308324318 3867 dbSNP
rs977343345 3870 dbSNP
rs1205301431 3872 dbSNP
rs1347789628 3885 dbSNP
rs1002854255 3888 dbSNP
rs560862596 3892 dbSNP
rs140346117 3894 dbSNP
rs1018513029 3897 dbSNP
rs16956880 3903 dbSNP
rs1429978847 3908 dbSNP
rs1173302022 3910 dbSNP
rs1024927068 3933 dbSNP
rs1249564857 3936 dbSNP
rs1013659649 3938 dbSNP
rs1286465562 3949 dbSNP
rs1175373184 3956 dbSNP
rs1322103519 3960 dbSNP
rs1311829674 3965 dbSNP
rs953090502 3968 dbSNP
rs897923545 3971 dbSNP
rs1027267843 3973 dbSNP
rs771579509 3974 dbSNP
rs1362885674 3980 dbSNP
rs1384205016 3981 dbSNP
rs994478116 3993 dbSNP
rs1370268055 4000 dbSNP
rs1036818198 4005 dbSNP
rs79516338 4007 dbSNP
rs1235125556 4008 dbSNP
rs34486624 4012 dbSNP
rs1352173425 4022 dbSNP
rs886053512 4025 dbSNP
rs17881366 4026 dbSNP
rs1050394503 4027 dbSNP
rs1189154509 4031 dbSNP
rs1252006383 4041 dbSNP
rs1454302922 4043 dbSNP
rs886053511 4044 dbSNP
rs886053510 4045 dbSNP
rs534624315 4055 dbSNP
rs1378383118 4061 dbSNP
rs922965738 4070 dbSNP
rs886053509 4080 dbSNP
rs1159563222 4081 dbSNP
rs1346811328 4083 dbSNP
rs558662880 4085 dbSNP
rs1324060465 4092 dbSNP
rs1394062714 4100 dbSNP
rs1441660085 4104 dbSNP
rs191918079 4107 dbSNP
rs1388335761 4110 dbSNP
rs1308140413 4121 dbSNP
rs1319044571 4124 dbSNP
rs774263885 4125 dbSNP
rs915128612 4131 dbSNP
rs1053790264 4132 dbSNP
rs1368386731 4138 dbSNP
rs377621596 4165 dbSNP
rs990275479 4176 dbSNP
rs546208790 4179 dbSNP
rs1410080802 4181 dbSNP
rs4968187 4183 dbSNP
rs924036573 4184 dbSNP
rs925422950 4186 dbSNP
rs916131 4189 dbSNP
rs1182388055 4195 dbSNP
rs1327997213 4198 dbSNP
rs569519287 4200 dbSNP
rs1441579361 4206 dbSNP
rs1436734102 4207 dbSNP
rs965954503 4211 dbSNP
rs916132 4212 dbSNP
rs1376194811 4214 dbSNP
rs969607558 4217 dbSNP
rs1293105084 4223 dbSNP
rs1025150059 4224 dbSNP
rs551213894 4227 dbSNP
rs961997337 4229 dbSNP
rs1811095 4232 dbSNP
rs1015022908 4233 dbSNP
rs1457406147 4234 dbSNP
rs35944977 4234 dbSNP
rs1234483568 4235 dbSNP
rs1482261276 4236 dbSNP
rs1006705345 4239 dbSNP
rs985708896 4243 dbSNP
rs886053508 4246 dbSNP
rs1417642170 4254 dbSNP
rs1409410164 4255 dbSNP
rs886053507 4263 dbSNP
rs200962122 4268 dbSNP
rs1356756443 4285 dbSNP
rs1413549723 4291 dbSNP
rs1312640452 4292 dbSNP
rs34607064 4294 dbSNP
rs554283011 4305 dbSNP
rs1231274199 4307 dbSNP
rs869037098 4310 dbSNP
rs17879353 4311 dbSNP
rs1289244155 4314 dbSNP
rs886053506 4324 dbSNP
rs1227954982 4327 dbSNP
rs1042535 4332 dbSNP
rs371242826 4333 dbSNP
rs1334062012 4346 dbSNP
rs1338374047 4356 dbSNP
rs1214619539 4359 dbSNP
rs773742778 4363 dbSNP
rs1015116276 4373 dbSNP
rs34182553 4375 dbSNP
rs1387402501 4376 dbSNP
rs1003276089 4392 dbSNP
rs568571322 4394 dbSNP
rs901763609 4395 dbSNP
rs563401383 4396 dbSNP
rs1390692643 4399 dbSNP
rs1486491024 4400 dbSNP
rs1191276803 4420 dbSNP
rs1240525402 4430 dbSNP
rs886053505 4433 dbSNP
rs1475231738 4434 dbSNP
rs1040289960 4436 dbSNP
rs945707298 4437 dbSNP
rs886053504 4445 dbSNP
rs912875438 4449 dbSNP
rs199729221 4452 dbSNP
rs368059785 4453 dbSNP
rs778421206 4453 dbSNP
rs1436922639 4455 dbSNP
rs1316738543 4456 dbSNP
rs1413082653 4456 dbSNP
rs1054233271 4457 dbSNP
rs935743951 4458 dbSNP
rs925506797 4459 dbSNP
rs1280906755 4460 dbSNP
rs547075078 4461 dbSNP
rs1200439318 4462 dbSNP
rs1349989642 4464 dbSNP
rs376415575 4470 dbSNP
rs1193115308 4471 dbSNP
rs1194100189 4471 dbSNP
rs1214139916 4471 dbSNP
rs1283379855 4471 dbSNP
rs1414526840 4471 dbSNP
rs1446624891 4471 dbSNP
rs200378797 4471 dbSNP
rs200757381 4471 dbSNP
rs1433235317 4472 dbSNP
rs1007476737 4477 dbSNP
rs886053503 4478 dbSNP
rs564370767 4480 dbSNP
rs1466099096 4481 dbSNP
rs1391874109 4486 dbSNP
rs886053502 4488 dbSNP
rs1268453041 4491 dbSNP
rs980915477 4493 dbSNP
rs969490976 4494 dbSNP
rs1348869330 4495 dbSNP
rs35940853 4499 dbSNP
rs886053501 4504 dbSNP
rs918189739 4509 dbSNP
rs1276797744 4515 dbSNP
rs1373091952 4517 dbSNP
rs552520476 4523 dbSNP
rs17884306 4524 dbSNP
rs1278904307 4526 dbSNP
rs1351046942 4544 dbSNP
rs1370271876 4550 dbSNP
rs865783999 4551 dbSNP
rs17884586 4553 dbSNP
rs935360914 4556 dbSNP
rs923949343 4557 dbSNP
rs541641686 4561 dbSNP
rs1006345809 4562 dbSNP
rs1363732209 4576 dbSNP
rs1160676874 4583 dbSNP
rs35659787 4584 dbSNP
rs1320377306 4588 dbSNP
rs1325981206 4590 dbSNP
rs985594408 4603 dbSNP
rs1029038761 4608 dbSNP
rs1382378893 4618 dbSNP
rs1328057205 4628 dbSNP
rs55817367 4634 dbSNP
rs952855993 4635 dbSNP
rs901647509 4648 dbSNP
rs1232957968 4650 dbSNP
rs1274051710 4651 dbSNP
rs972996228 4653 dbSNP
rs1393899747 4658 dbSNP
rs1250370110 4660 dbSNP
rs1438948476 4662 dbSNP
rs746517601 4671 dbSNP
rs886053500 4675 dbSNP
rs1018901054 4688 dbSNP
rs540817365 4689 dbSNP
rs962037332 4690 dbSNP
rs373069673 4694 dbSNP
rs1166865249 4697 dbSNP
rs1451327764 4698 dbSNP
rs1248544522 4725 dbSNP
rs1192254511 4734 dbSNP
rs1010138332 4737 dbSNP
rs891497989 4751 dbSNP
rs1054518345 4752 dbSNP
rs970469393 4754 dbSNP
rs34734132 4756 dbSNP
rs576851964 4761 dbSNP
rs1023367155 4765 dbSNP
rs114831472 4768 dbSNP
rs779644413 4771 dbSNP
rs1278366198 4772 dbSNP
rs1032700326 4792 dbSNP