miRTarBase - #MIRT005782 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACVR1C   
Synonyms ACVRLK7, ALK7
Description activin A receptor type 1C
Transcript NM_001111031   
Other Transcripts NM_001111032 , NM_001111033 , NM_145259   
Expression
Putative miRNA Targets on ACVR1C
3'UTR of ACVR1C
(miRNA target sites are highlighted)
>ACVR1C|NM_001111031|3'UTR
   1 TGATGATAATTATGTTAAAAAGAAATCTCTCATAGCTTTCTTTTCCATTTTCCCCTTTATGTGAATGTTTTTGCCATTTT
  81 TTTTTTGTTCTACCTCAAAGATAAGACAGTACAGTATTTAAGTGCCCATAAGGCAGCATGAAAAGATAACTCTAAAGTTA
 161 AGCATGGGCAGGAGTTGACTTCATCCAATCTCTATGTTATGTTTAATTTTATTTTGAAAGCAACACCTCAACTCATCTTT
 241 TTATTTAATAAGGAAGAAATATATTACAAAAGTATAAAATAAGCTCTATAAAAATGTTATAGTCATTAAGTTTTTATTTT
 321 ACTTGAACCAAGAGCACATGAATGAACAGGAAAAGATGTAAAAACATTTTTTTCTGAGATGAAAACATATTAATTAAACA
 401 TGCAAATTAGAGCATGCTATCTTTAGGTGATGCAATCTATGTTTCCCCCTTTTTAAGTTAGCAGGACTTTTTAAAAATAA
 481 ATATTGCTCTAAACTTTAATATATCGAACGTGAGAGTGGAGCTGCTTAGTGGAAGATGTAAGTGAGGTGGGTGTCCCATG
 561 TGCTTGGTCTCCCCTTCTGCTGTTCTCCTGTTCTTCATAATCCACTACTGCAGCAGTCCCTGAACCACTAAACTTGTTCC
 641 TTTCATTTACAAAAGAGATACCTGACATCCTGAGACACTGAGAAATGTCCTGAAGTCACACAGCTAATGGCAGAACTGGC
 721 ACTAGGTCCAAATCTTGTGATAATGAACACCGTAAGGTTAGCTAGCTTCCTACTTTCCCTTGAATAGTGCTTTTCTCCCT
 801 ATGTAATATCTTTTATTATGATATTTGTGGTTTAGAAGGCATATTGAGTTATTTTGCAGAATCATAATGGACCCGCACAA
 881 AATCTCAGAACCATATCTGTTGACATTTTTTCTCATAGAAATATCATGGTTACCCCATTTGTTAATGAGCATTAATGTTT
 961 TCTGAACACTTCCAAAGATTAATCAAACATAAATATTCATTGTCTGAAAATGTCTTTAAGATACAATTCAGAGGTCCCTA
1041 TTTCCTTTGTACATACACACTTAGAAAGAAAAGACAGAAAAGGAAGAGGAAGGAAGGAAATATTTTGAGAATATATTGAG
1121 AAGAATTAAGAAAACTCTTCAATGAAGTGTTAACAACCAAACCCTACAGACGGTATCAGAAACAGCAAATAGATATTCCT
1201 CTACCCTTTCACAGTGAGTGAGTGAGTACAGAAGAATGCTCATGATAGTTTTGCCTTCATTCTACTTTCTGTGGACACAG
1281 AGTAATGAATATTTAATGGGACATTAAATATGCCCTTCAAATCTATAATTTTACTTTGGTAAACGAGATTTAACATGATG
1361 TCTTTTATGCTCCTAAAACATCTTTTTTCAAACTCCATTCCTTAGAACATTCTTCTACTGAGATGATCCAAGACCAAAAG
1441 TGTTCTTTGGTACTTGCTTATAAAGTGATAGTACATGTTAGCATATAATGTATTTTGAAGAGTGAAGTAAATGCTATTGA
1521 TAACAGTAAAAAAAAAAAAAAAAACTAATAACAGTAAAGAAATGCTACTTGATTTTTTTTTAAACTGGATTGCTCAGATT
1601 ACCTGATCGTGGTGGAACCCTTTTATTAAGAGGAGGGGAAACTTTTTACTATCCCATATTTAACTGTTCTATAAAGCAAA
1681 GCACAGCTTGGGTAATAGCGTTCTGAAGGATATACTTCTGTATTTTCTCATAGAGTACAATTTAGTGATTATGCTTCATT
1761 TCACTATGGAAATATGTTACTGAATCTATCTTCATTTTACTGAGTTGAAATAAGGAAGGCAAAAAACTGACAGCTATGGA
1841 GTTTGCGTGTACTTCCATACTCGTTAATGCTCTCATCCACTTATTAAATAATCATAGAGCACCCATATCTTGCTTGCCAC
1921 AATATCGGGTACAAGAGGGAATACAAAGATAGATAGGTCCTGCCCTCAGGGATTTTAAAGTCTAATTTGGGAATGGGAAT
2001 AGGGATGTGAGTGTGTGGGGGAAGAGATTAAATTGACAGATAAAATACGAAGTGGGATGTCTTGAGTTCTGCATGACAGT
2081 GGGTTTCTAGGATAGGTCTGAAAATTGCTTTCATTTGCAACACATTTAGAAAGTAGCTTTATTTGGATATTACAGACAAT
2161 CTAAATATATCATCAGTTTTTAAAAGTGCCTATGTGAAGTGATTTTTAAAAAGAGCCTATGTGAAGGGGTAATCTTGCTT
2241 GTTCTTGTTACTAATTTCTCATAGATTGTTTTTCTGCATATATAAGAACGAAATTATTTATTTACTATGGTTGTACGTGC
2321 CTCAAATAAACAAGAATGATATTTCCTGTTTTATTTACTTATGTTGGGTAAATATGCTTATTGAATTTTTAAGAGAGGAT
2401 TTTTTACCATCTCCATTTTTCTTGTCATTATGTTTTGTAGCTTATTTGAGGGTGTCTAAATATAATTTCATATTTTATTG
2481 GTTCAACTTTCACTCTGAAGAAATCCGTATGTTAGTACATTTTGAGGTATTTTTCTTGTTCTTGTGTTGTTTAACTATGA
2561 CTCCTAACTGAGTAGTCTTATATTTCAATTACAAAATACATTTTTTAAGAAAGGGAATAGAGCAGCAAAAATGATAAGGA
2641 AAATGTTAAAAGTTGTAATATTTCCTTTACTCTTAACAGGATTATATATAGAACATGCTCACTTACAAAAATAGGATGAT
2721 GAAGTTTAGAGCATAAGGCAGGCTTCTTGTATATACTTATGCTGTCAAATGTTATATTGTTTTTAATGGAGTCCCATTGT
2801 GTAATATTTATTTCTTTTACATTTTGTTATAAGCAAAAAAAAAAAAAATTCTCCTTAGGTTATGTTCAGAGTATCAGTGT
2881 TCTTTACTCCTTACAGATATTTTGGCTTTGGGGTATAATACAAGACTTGGGAAAACACTATTATGAATTTTCAGTACTGT
2961 ATAAAGTGGTGATGGGATTTAAATGCAGCATCACTTTCTGAAAATAAGAGAAACATTATTTGTTGTCAGTATTTCAGCAT
3041 GAACTTGTTGCCTTGTAAATTTTGCCTTTAAGTTTGTAATTGGTACAGATTCTGTTGTATGCTTTCTTCTATGTCTAAAA
3121 TATTTGGCATGTCACATCTAGAATTCTTAATTTATGTTCTGACTTGAGAGTTAAGTGAAACATGACTGTCGTGCACTATT
3201 TTAGGCATAGCACTTGCTTTTCATCTTTATACTTTCAATTAACTTTGCATTTTAAATTTCCATGATTGTATGAAAATAGT
3281 AACCTGGTTGCAGTATCTGAAAAAATTAAAATTAGCTTTTATTTAAAAATGAAAATCTACAATAGATTCATTAGGTTAGA
3361 AGTTCCAGAATAATTTATTATTTTATTACACCTACTATTGTAGAATTACTAATAAAACAAAACAAAACTACTCCTATTTT
3441 CCTGGAATTTTGCCACCATGTGACTTATTGGGGCAGAGAAAACTCAGGGTTGTCTTTGAGTCTGCACAAAAGCACCAGGG
3521 AACCTGCTTAGCAAATCGTCTGAAAACAGGGAGCTGATGTTTGCCATTATACAAAGTTTGAGTAAACAACTTAAAATTGC
3601 TTGTTAGGGCATAGTCTTTGATTGAAATAAGTATGAGAATGTATTTGGCTAAATAAATGTATTTAAAATATACAAATTTT
3681 ATTTCCCACTGGAAAATTAAGAAAGTAGCAGTACCAAATGAATAAAAGCTGGCAGTTGATGTCTTCAATAATCATTCCTT
3761 TAAAATAAATTCACAAACACATCATTACAAGCTACTTAGAAATGTTTAGTATTCGTATCTTAAAATGGCACCATTGTGGT
3841 TTTCAAAGATATTTTAAACATCTTTTGTGAAACATACTATTTCTGTTTGACAATGCTTTGTTCTAGCTCTGTGTGCTGAT
3921 ACCTACATGGAGTTTTTCTGCTATTTTAGTGAAAACAGTAATTCTTTTATCTTGAGAGCTGCTTCTAAATAACAAAAAAG
4001 TTAATTGGAATGTAAGTTTTTAAAAAATGTTAATATTAAATAGAATTTTTATAATATGGGCATTTTTCAAAACATTTTAA
4081 TGAAAATATATAGATATTTGACTTTCTTTTTTTCATCTAGCCTTGCTTTATATTTCATTATTTTTCTCACTTTTTTTCTT
4161 AATATTCCCTCACTATCTTTCAACATTATCATTAGTTCCTAATTTTAAAAATAACTCTTATTTAACTTAACCGTCTGGAA
4241 TTTAGCCTTCTAATGAAAGAGAATCCCTTAGTACTCTCAGAGATTATATAAAGTTATTCCAATTTTGTGTAGATGACGAA
4321 ACCAAGGATCAGAGATTAAATGACTACTAGTTACTAGCAGAACTCTTATGAAAGCCTGGTGGTGACACCCAGCACTGTTC
4401 CCTGCCATATCCCCAACTTTTACTGATTAAAAATTAATTCGCATGCATCTAAACCTACCTTGAATGCACACTAACGTAAT
4481 GTGCCATTCAATGATGATGATAAAATCCCACTTTTCTTTGGGTTTCTACTAAAATAATTTACTCACTCAGAGTGAGGTCA
4561 ATGAGAAAAACTAAACTAGGCTAAGAAAGAGTTGTAGAATGGTTGTTGAGCTAAGTAGGCAACCACTGGGGTGCTGATAA
4641 AATTAATGGATAAAATTTAGGAACTGTGAGAGTATAGAATTTCTTAGTGCAAGTAATGATTAGAGAAGCTTCCTGACATC
4721 CCCCACCCTTTCTGTAAGGACTGTTCTTTCTCTTTGTACCTTGGAATGGGGGTGAAAGGTGATTTGATAGCTGAATTTGG
4801 GACTATGTCCAGTGGGATATTATCTAACTTTTCTCTCTTTCTCTTTTTTTTCCCCTCAGTTTCTCATTAGTTTGTCTTTG
4881 GCATTCATCTTCTTTTAGTGCATTAAAAAATGTTTGGCAGATCTCATCAATCCCAAGTCACTCTATAATTCCTGTATTTC
4961 TTTAGTTGTCGTTTAACCTGTCCAAACTTCTACACAATGAACTTCTTAACAAGATTTTAAGTTCTCTGTATAAGAGGTTT
5041 CACCTCATAACTTCTCCAGTAATCCTTCATTTGGCACTATAGAGTATTTGTTAATGGCAGAGATGATTTTTCTTTTAAAA
5121 CCTAAAAAGACTAGCTGTTATTTGTATTCTAGCTTTTAGCTAACATATAAAGAATGTCTACTTTTGCTTTAATGCTAAAT
5201 TCCGCTTGAGAAATAGTAACTGGGAAAGACAATTTGAAATATATGCCCCATAATGTGATTGTTAAATTTATTTCTGCTGT
5281 TCCATACCATTGCTTTGTTTTGCTTTTGACAAACTAAGCCATTATGCTATTAGTTTGGAATATAATACTACAGCAAAATT
5361 AGGTAACAATCCCTATTTTAAAATTCCCCTAACAATAATAGAACTGCCAGCATACTTTTCTCTTTCAGTTGTAGATGAAT
5441 ACATTCGAGAGAATATGAGCTGTATTTCATCCTAGATTTTAATATTTTCAGATGTGACTGTATTTCCTGATCATTGGTCC
5521 AAGTTGTCCTAAAAGAAATTTTTCTCTCCAGACCTAACAGTTTTAACTGCAAGAGTTTACTGTGGGTTATGTTAATCTGA
5601 ATTTTAATAGGGCCACTAAGAATCTGAGTGCCTTAGGAGATTACCCTTATACCCACTGCCATCACATCCAGTCAGGCCTG
5681 TTGTGCTCTATATAAATCTTCCCAGCTGAGGGGCAGGTGCGGGCTAAAATCCAACTGCAATTGGCTCCCAGACATAATTT
5761 TATATTTTACAGAGAAGCATCTTATTGGCTTATATGTGTTTAAAGAATGGTCTGGCTTATACATCTTCAGAAAATGAGAA
5841 TTAAAAAGTCAAAATAATTCTTGACATCTACAGATTGAACAAAGAACTTAGAAGAAATAATACTTTATCTTTTCATCCTG
5921 GCATTCCTGAGAGAAGAGAAATTGATTGTTTATCATGTTGGTTTAATTTTTCAACCCAGACAATCTGCAGCAAGGCACAT
6001 GGACCCCAATTTTGATATCGTCCATACAGTTTTCATTCTATGCATGGAGCTAATTACTGACTTTGCCTGTAAAGAGAGGA
6081 TTGTGTGCCTAAATTTTGTCTAACAAATGCAAGCGTAGAATGACATTTACTAATATTTCTATTTCTTCCATAGGCTAAAT
6161 AATAGTAACTAAGTATTTTTAAGGACACAGCCCTTTTTTTCTCTTTATACAAAATGAGAGTATCTGAGCCAAAATATTAA
6241 ATTCTAGTTCTTTTCCGCAATGACTAGTGTCAAGCTCATGTACTCTTCTGATTCTAGACTGGAGAAGATTATTCAAACTT
6321 GATCTGTGTTTCAGGTTTTTAAATGTCCTAAAAACAGAAAATTAGATTCAGATCTCAAAAAAGGAATTTTGGATTGACTT
6401 TCAAAGTACTAATACTAATTATACTTTTCTTTTGGTAGCGTGACTCTTCTTATACCTAAGAACATATTACAAATGTCAAA
6481 ACCATTGCATTTTGACATTGCAAAACATGCCTTGAACTCTTGAACTACTGTGAAAAGAATCACCGTTGTAAAGACTTTTT
6561 GTAAGCTAGCTGATACTCTTAAGTATGTAAAAAGATTGTCTTTCAGCCGACAGGCCCAAAGGAATGTATATAAGGAAGGA
6641 ATATGAAAAAATAAATTAGGTTTTAAAATAGGAATTGGGCAATAAACTGTATCAAAAATATGTAGATGGATTTTAGTAGT
6721 TGTAATTTAAATGTGGAAGGTGAAGAGAATTTCAAACTCCAAAGAGAAATGAATGATATTCAGATGTTTCATTAATTTCT
6801 AGTCTGTGAAAATATGCATTTTATAGTAATATGTATAGACTTATTTTATTTAGAAATAATAGTGTTTTAGAATTTATTAA
6881 AAACTCAGTGATAGCCTTTATACCAAAATGTTTAACTTTACCAACAGCAAGTCATAAAAGTATTTATTTTAAAGCTTTTT
6961 AATATTATCGTGTAACTTTCATCTGTCTTCAGATGTAAATAATTATCTGCCTAAATGTTATATTTTTATGTATGCATTTT
7041 CTGAAAATGTATTGTTTTGTAAAGTGGGAAAGATAATAAATCAAGCACTTCTTGCACTTGTTTCTGTGAAGCATATAGAA
7121 CTCTATTTTAAATAAAGGAAGATGTGTCGTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAG------UGUGAGGu 5'
            |:||::| |||:      |||||:| 
Target 5' tgAGCATTAATGTTTTCTGAACACTTCc 3'
946 - 973 142.00 -13.50
2
miRNA  3' guUUGU-GGUAACAGUGUGAGGu 5'
            |||| |: || ||| ||||| 
Target 5' aaAACATCTTTTTTCAAACTCCa 3'
1375 - 1397 140.00 -16.40
3
miRNA  3' guUUGUGGUA---ACAGUGUGAGGu 5'
            ||||: ||   | |:|::|||| 
Target 5' ttAACATGATGTCTTTTATGCTCCt 3'
1350 - 1374 132.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31590743 2 COSMIC
COSN30505485 7 COSMIC
COSN30525345 22 COSMIC
COSN31516989 22 COSMIC
COSN30477212 27 COSMIC
COSN30498011 32 COSMIC
COSN30188304 40 COSMIC
COSN31509641 40 COSMIC
COSN30480649 54 COSMIC
COSN23360167 77 COSMIC
COSN30160343 96 COSMIC
COSN31572827 136 COSMIC
COSN22388869 223 COSMIC
COSN31582729 251 COSMIC
COSN8607766 288 COSMIC
COSN28808415 346 COSMIC
COSN31482778 376 COSMIC
COSN31583897 472 COSMIC
COSN32057406 521 COSMIC
COSN32062834 640 COSMIC
COSN1227154 754 COSMIC
COSN43541 778 COSMIC
COSN9071704 914 COSMIC
COSN16348143 949 COSMIC
COSN26769958 1169 COSMIC
COSN27873425 1426 COSMIC
COSN29752892 1524 COSMIC
COSN27463566 1528 COSMIC
COSN25684977 1547 COSMIC
COSN25677426 1556 COSMIC
COSN21674167 1839 COSMIC
COSN216770 1949 COSMIC
COSN17832169 2181 COSMIC
COSN1801222 2290 COSMIC
COSN27771724 2356 COSMIC
COSN15661771 2454 COSMIC
COSN22006932 2795 COSMIC
COSN27450721 2835 COSMIC
COSN14496430 2864 COSMIC
COSN20090665 2927 COSMIC
COSN26813639 2995 COSMIC
COSN1227153 3190 COSMIC
COSN1801221 3235 COSMIC
COSN1801220 3253 COSMIC
COSN23426032 3487 COSMIC
COSN9071703 3689 COSMIC
COSN7111733 3734 COSMIC
COSN9071702 3873 COSMIC
COSN24574893 3887 COSMIC
COSN29474952 3993 COSMIC
COSN9071701 4006 COSMIC
COSN8272034 4318 COSMIC
COSN21055868 4434 COSMIC
COSN17076491 4745 COSMIC
COSN23270674 4851 COSMIC
COSN5486878 5079 COSMIC
COSN20090664 5204 COSMIC
COSN24569416 5530 COSMIC
COSN22533106 5741 COSMIC
COSN32057405 5841 COSMIC
COSN22144214 6035 COSMIC
COSN1801219 6077 COSMIC
COSN23855200 6218 COSMIC
COSN21815409 6250 COSMIC
COSN29821562 6500 COSMIC
COSN15928225 6969 COSMIC
COSN24371477 7149 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1465620958 4 dbSNP
rs542244481 6 dbSNP
rs1262921693 7 dbSNP
rs1219971855 11 dbSNP
rs560112309 13 dbSNP
rs544652071 17 dbSNP
rs374742083 25 dbSNP
rs771138569 28 dbSNP
rs1359923556 30 dbSNP
rs916955022 32 dbSNP
rs562233704 33 dbSNP
rs571782837 36 dbSNP
rs1362368840 37 dbSNP
rs756457145 47 dbSNP
rs543654333 51 dbSNP
rs188472783 56 dbSNP
rs988878167 62 dbSNP
rs955664711 68 dbSNP
rs936404880 72 dbSNP
rs113263635 74 dbSNP
rs757498287 76 dbSNP
rs1441420189 77 dbSNP
rs953906682 82 dbSNP
rs1192825256 87 dbSNP
rs572091635 87 dbSNP
rs996310252 87 dbSNP
rs1260814405 88 dbSNP
rs1485898160 90 dbSNP
rs1478904889 93 dbSNP
rs1172897741 94 dbSNP
rs543320424 100 dbSNP
rs1171929663 102 dbSNP
rs1362532087 116 dbSNP
rs1018992035 117 dbSNP
rs1298148452 122 dbSNP
rs1005300890 136 dbSNP
rs1341029642 146 dbSNP
rs1275753971 159 dbSNP
rs146400658 160 dbSNP
rs1343929435 164 dbSNP
rs1251473748 179 dbSNP
rs752548033 185 dbSNP
rs985757622 188 dbSNP
rs932488254 190 dbSNP
rs1282102282 196 dbSNP
rs919746767 196 dbSNP
rs1453186356 205 dbSNP
rs553628051 207 dbSNP
rs1199320048 211 dbSNP
rs1245896809 215 dbSNP
rs1338154518 220 dbSNP
rs554137771 232 dbSNP
rs1312687006 236 dbSNP
rs1415915571 238 dbSNP
rs886410242 248 dbSNP
rs538992627 262 dbSNP
rs1383459021 263 dbSNP
rs1407564307 272 dbSNP
rs1324701410 275 dbSNP
rs1330854565 281 dbSNP
rs1438322112 288 dbSNP
rs1311027749 297 dbSNP
rs1377130064 299 dbSNP
rs538825166 300 dbSNP
rs571810646 306 dbSNP
rs183785182 307 dbSNP
rs1288925180 310 dbSNP
rs1466950725 313 dbSNP
rs754969652 314 dbSNP
rs1200264370 328 dbSNP
rs1240271347 330 dbSNP
rs983472696 338 dbSNP
rs1181259173 344 dbSNP
rs1371415960 346 dbSNP
rs191510167 350 dbSNP
rs1044948432 353 dbSNP
rs1460233659 355 dbSNP
rs949867123 355 dbSNP
rs143885010 358 dbSNP
rs988543451 360 dbSNP
rs934348508 371 dbSNP
rs925604398 373 dbSNP
rs36014372 374 dbSNP
rs1475484744 385 dbSNP
rs1341705806 386 dbSNP
rs1245489400 388 dbSNP
rs1332511522 391 dbSNP
rs768753484 391 dbSNP
rs1220255867 397 dbSNP
rs1259429245 398 dbSNP
rs1179767920 406 dbSNP
rs1195414527 410 dbSNP
rs548873614 411 dbSNP
rs895342188 416 dbSNP
rs1032468708 419 dbSNP
rs953958910 439 dbSNP
rs376580711 440 dbSNP
rs144730609 447 dbSNP
rs1042491308 448 dbSNP
rs1197152373 450 dbSNP
rs1417779539 455 dbSNP
rs779150945 455 dbSNP
rs1173346379 465 dbSNP
rs1424777965 466 dbSNP
rs1264336693 472 dbSNP
rs1464812620 483 dbSNP
rs550973917 496 dbSNP
rs890760673 500 dbSNP
rs1296067343 503 dbSNP
rs768792803 505 dbSNP
rs932539037 506 dbSNP
rs919798822 509 dbSNP
rs1353554214 510 dbSNP
rs755633343 510 dbSNP
rs1278653919 532 dbSNP
rs1317049828 535 dbSNP
rs1409622397 536 dbSNP
rs1249864314 538 dbSNP
rs1347312239 542 dbSNP
rs1201120667 545 dbSNP
rs1256880169 546 dbSNP
rs973908445 547 dbSNP
rs1196428529 551 dbSNP
rs1336685811 559 dbSNP
rs1331171474 562 dbSNP
rs950717610 569 dbSNP
rs1390179400 575 dbSNP
rs548663940 587 dbSNP
rs1168722925 607 dbSNP
rs1027643642 615 dbSNP
rs1163903673 622 dbSNP
rs1466222947 625 dbSNP
rs907969048 631 dbSNP
rs187633049 633 dbSNP
rs906110003 634 dbSNP
rs1401822613 639 dbSNP
rs983910826 649 dbSNP
rs1044610557 651 dbSNP
rs1303063895 656 dbSNP
rs970781359 657 dbSNP
rs917892807 667 dbSNP
rs1234229496 677 dbSNP
rs991070393 681 dbSNP
rs1014843225 699 dbSNP
rs1156814885 700 dbSNP
rs1345784637 704 dbSNP
rs1472167357 708 dbSNP
rs895954605 709 dbSNP
rs1485796493 715 dbSNP
rs959607101 720 dbSNP
rs1183608777 725 dbSNP
rs1185208986 735 dbSNP
rs1269910678 737 dbSNP
rs1032523702 740 dbSNP
rs1192595361 748 dbSNP
rs1449511491 749 dbSNP
rs1421020817 751 dbSNP
rs1266150164 752 dbSNP
rs532760471 761 dbSNP
rs1295136028 772 dbSNP
rs1368001717 774 dbSNP
rs967257243 776 dbSNP
rs1302975812 777 dbSNP
rs1368994050 782 dbSNP
rs1242407078 785 dbSNP
rs1310068115 786 dbSNP
rs1020716322 794 dbSNP
rs1266816034 798 dbSNP
rs934399407 799 dbSNP
rs1008382904 801 dbSNP
rs925658205 820 dbSNP
rs1213416964 822 dbSNP
rs200203351 823 dbSNP
rs890823125 826 dbSNP
rs1049422463 827 dbSNP
rs1441096441 830 dbSNP
rs1228286414 839 dbSNP
rs749875050 844 dbSNP
rs371678220 848 dbSNP
rs1406601983 860 dbSNP
rs1417283488 864 dbSNP
rs996802178 865 dbSNP
rs1350347218 871 dbSNP
rs1460753292 873 dbSNP
rs898416363 874 dbSNP
rs1449279084 875 dbSNP
rs1298863169 884 dbSNP
rs1042702809 887 dbSNP
rs1038268961 891 dbSNP
rs921189200 894 dbSNP
rs1330742373 897 dbSNP
rs375358786 899 dbSNP
rs1271644219 912 dbSNP
rs6751595 912 dbSNP
rs796741390 914 dbSNP
rs1047830680 924 dbSNP
rs375855463 928 dbSNP
rs1231859293 929 dbSNP
rs1479383034 933 dbSNP
rs908351591 935 dbSNP
rs1414447230 938 dbSNP
rs983564019 941 dbSNP
rs1162614374 947 dbSNP
rs950770042 954 dbSNP
rs1386509170 955 dbSNP
rs1027694307 962 dbSNP
rs146121930 967 dbSNP
rs1440120681 972 dbSNP
rs1304601898 976 dbSNP
rs149589060 981 dbSNP
rs556459130 982 dbSNP
rs990787469 984 dbSNP
rs550243529 994 dbSNP
rs1408526755 996 dbSNP
rs1023650767 1000 dbSNP
rs1014492559 1005 dbSNP
rs959327586 1009 dbSNP
rs1215471736 1019 dbSNP
rs896003173 1033 dbSNP
rs1476886214 1034 dbSNP
rs528945616 1049 dbSNP
rs1376737877 1054 dbSNP
rs1193834392 1055 dbSNP
rs113596424 1059 dbSNP
rs1245639862 1072 dbSNP
rs1208710399 1073 dbSNP
rs1185686544 1089 dbSNP
rs1265189962 1091 dbSNP
rs1478044585 1099 dbSNP
rs979626483 1115 dbSNP
rs966934645 1120 dbSNP
rs1419090537 1122 dbSNP
rs1021525327 1132 dbSNP
rs1008017902 1143 dbSNP
rs998603104 1148 dbSNP
rs955294075 1149 dbSNP
rs1376113037 1153 dbSNP
rs904284374 1155 dbSNP
rs1199119966 1156 dbSNP
rs181908068 1162 dbSNP
rs1311615450 1164 dbSNP
rs932333852 1166 dbSNP
rs996532024 1171 dbSNP
rs898131876 1172 dbSNP
rs1363189110 1177 dbSNP
rs943955528 1183 dbSNP
rs1280487764 1185 dbSNP
rs1296961210 1186 dbSNP
rs150829087 1192 dbSNP
rs1208052623 1203 dbSNP
rs982609408 1211 dbSNP
rs952483286 1228 dbSNP
rs560615342 1230 dbSNP
rs866164724 1241 dbSNP
rs780479388 1262 dbSNP
rs973454169 1269 dbSNP
rs756379224 1277 dbSNP
rs1193112670 1284 dbSNP
rs1453903286 1300 dbSNP
rs1171767121 1301 dbSNP
rs1320148012 1308 dbSNP
rs949880106 1313 dbSNP
rs970479804 1325 dbSNP
rs1401777963 1333 dbSNP
rs918005036 1344 dbSNP
rs1055111752 1345 dbSNP
rs545466524 1346 dbSNP
rs1438997723 1351 dbSNP
rs141399963 1355 dbSNP
rs1369705684 1361 dbSNP
rs925274545 1362 dbSNP
rs1231456940 1363 dbSNP
rs1310799309 1368 dbSNP
rs979679122 1373 dbSNP
rs556730200 1374 dbSNP
rs139013886 1380 dbSNP
rs1281943430 1388 dbSNP
rs1031845442 1389 dbSNP
rs531112140 1393 dbSNP
rs998987336 1397 dbSNP
rs202017033 1405 dbSNP
rs914110025 1412 dbSNP
rs147019802 1413 dbSNP
rs1021348442 1428 dbSNP
rs1382239893 1429 dbSNP
rs1470828504 1432 dbSNP
rs1158521155 1437 dbSNP
rs1211064299 1442 dbSNP
rs1406377417 1443 dbSNP
rs761413398 1444 dbSNP
rs955542235 1447 dbSNP
rs899525003 1465 dbSNP
rs1438258448 1467 dbSNP
rs1475421581 1469 dbSNP
rs56283818 1471 dbSNP
rs879251325 1476 dbSNP
rs1237642574 1481 dbSNP
rs887030767 1488 dbSNP
rs1244368826 1489 dbSNP
rs1028087557 1493 dbSNP
rs1358296534 1500 dbSNP
rs1233684288 1503 dbSNP
rs1272294614 1504 dbSNP
rs1186011611 1507 dbSNP
rs1468255831 1516 dbSNP
rs1442260927 1519 dbSNP
rs1281482795 1520 dbSNP
rs1213375189 1521 dbSNP
rs1340307745 1524 dbSNP
rs80165414 1527 dbSNP
rs1046978853 1528 dbSNP
rs1215265241 1531 dbSNP
rs1364121096 1537 dbSNP
rs555542376 1538 dbSNP
rs1166190563 1539 dbSNP
rs1476465917 1539 dbSNP
rs931146848 1540 dbSNP
rs1271897320 1541 dbSNP
rs919733358 1542 dbSNP
rs1396721736 1543 dbSNP
rs1415315495 1545 dbSNP
rs1491069056 1545 dbSNP
rs551572419 1545 dbSNP
rs771690308 1545 dbSNP
rs962391401 1546 dbSNP
rs1220197997 1548 dbSNP
rs973514667 1553 dbSNP
rs1354645398 1561 dbSNP
rs948825299 1567 dbSNP
rs915939480 1569 dbSNP
rs1248504155 1581 dbSNP
rs960280068 1582 dbSNP
rs992848204 1582 dbSNP
rs1257370662 1588 dbSNP
rs1436277966 1595 dbSNP
rs1195697512 1596 dbSNP
rs1016606483 1598 dbSNP
rs1368325644 1604 dbSNP
rs1004167255 1605 dbSNP
rs750835957 1607 dbSNP
rs977620904 1608 dbSNP
rs1024185258 1609 dbSNP
rs781371937 1618 dbSNP
rs141432152 1622 dbSNP
rs1401635423 1626 dbSNP
rs1296011804 1629 dbSNP
rs1327316009 1630 dbSNP
rs1253689700 1632 dbSNP
rs1180687269 1639 dbSNP
rs12993800 1651 dbSNP
rs763597061 1655 dbSNP
rs938081193 1658 dbSNP
rs1190531447 1667 dbSNP
rs1019742518 1670 dbSNP
rs1484943339 1671 dbSNP
rs903905571 1687 dbSNP
rs762510055 1692 dbSNP
rs1262856976 1695 dbSNP
rs1251399656 1699 dbSNP
rs1205445779 1700 dbSNP
rs1044110153 1708 dbSNP
rs752181972 1712 dbSNP
rs879542539 1715 dbSNP
rs1373625096 1720 dbSNP
rs1226598249 1727 dbSNP
rs1334071560 1731 dbSNP
rs1455280298 1738 dbSNP
rs914155315 1740 dbSNP
rs1383945884 1741 dbSNP
rs1380264801 1753 dbSNP
rs115290748 1786 dbSNP
rs1373383242 1788 dbSNP
rs898367334 1795 dbSNP
rs1302746843 1798 dbSNP
rs539078206 1804 dbSNP
rs138875769 1805 dbSNP
rs1218518311 1816 dbSNP
rs1261726990 1825 dbSNP
rs1485757282 1834 dbSNP
rs1297305245 1837 dbSNP
rs921412363 1847 dbSNP
rs1192536413 1849 dbSNP
rs550131518 1854 dbSNP
rs1392690243 1859 dbSNP
rs975198772 1861 dbSNP
rs77290358 1862 dbSNP
rs759070781 1863 dbSNP
rs1451363486 1869 dbSNP
rs1016658631 1874 dbSNP
rs1167684332 1876 dbSNP
rs1325349610 1887 dbSNP
rs1471836961 1888 dbSNP
rs968933760 1891 dbSNP
rs982857323 1893 dbSNP
rs951057479 1900 dbSNP
rs1316788611 1902 dbSNP
rs1178054390 1905 dbSNP
rs1481738333 1908 dbSNP
rs1024656733 1909 dbSNP
rs1213155574 1916 dbSNP
rs533977854 1917 dbSNP
rs879901913 1920 dbSNP
rs189858558 1925 dbSNP
rs376226981 1926 dbSNP
rs1250700831 1931 dbSNP
rs1177208696 1949 dbSNP
rs1034145885 1952 dbSNP
rs1008366819 1953 dbSNP
rs951049123 1957 dbSNP
rs1326887107 1961 dbSNP
rs1025308918 1980 dbSNP
rs1002280774 1991 dbSNP
rs995463917 1993 dbSNP
rs776516497 2006 dbSNP
rs143596047 2011 dbSNP
rs1291382598 2015 dbSNP
rs945381684 2017 dbSNP
rs770576987 2022 dbSNP
rs1298809000 2037 dbSNP
rs1373336702 2048 dbSNP
rs1045354862 2049 dbSNP
rs143107960 2056 dbSNP
rs896285241 2057 dbSNP
rs1233015169 2067 dbSNP
rs1270886853 2069 dbSNP
rs1051804843 2071 dbSNP
rs1308834006 2072 dbSNP
rs1456099695 2078 dbSNP
rs1345037774 2086 dbSNP
rs527878753 2092 dbSNP
rs1479638037 2095 dbSNP
rs938756407 2096 dbSNP
rs1258074988 2107 dbSNP
rs1474774623 2119 dbSNP
rs1185462122 2120 dbSNP
rs924648331 2122 dbSNP
rs1041697248 2123 dbSNP
rs934225750 2124 dbSNP
rs1427848443 2125 dbSNP
rs369139113 2125 dbSNP
rs74625683 2128 dbSNP
rs1356590048 2135 dbSNP
rs1423347652 2137 dbSNP
rs1414562865 2139 dbSNP
rs111289781 2153 dbSNP
rs578241504 2157 dbSNP
rs562894218 2159 dbSNP
rs1294285009 2165 dbSNP
rs1215560542 2168 dbSNP
rs1484857874 2171 dbSNP
rs982524789 2173 dbSNP
rs1212352285 2174 dbSNP
rs1280957122 2188 dbSNP
rs1208550250 2191 dbSNP
rs1485298086 2191 dbSNP
rs1260014538 2208 dbSNP
rs1216264783 2216 dbSNP
rs1187353033 2217 dbSNP
rs951151219 2219 dbSNP
rs986595448 2232 dbSNP
rs916904001 2241 dbSNP
rs951110531 2245 dbSNP
rs185148399 2249 dbSNP
rs1233080778 2251 dbSNP
rs574091091 2252 dbSNP
rs1304984129 2263 dbSNP
rs1347293591 2273 dbSNP
rs995181030 2280 dbSNP
rs555572488 2289 dbSNP
rs1034196824 2290 dbSNP
rs750817090 2305 dbSNP
rs749425419 2307 dbSNP
rs368535747 2308 dbSNP
rs1217389757 2312 dbSNP
rs181325750 2316 dbSNP
rs557492456 2317 dbSNP
rs1214728349 2325 dbSNP
rs1397052702 2331 dbSNP
rs1241761380 2341 dbSNP
rs1186770301 2357 dbSNP
rs892498825 2362 dbSNP
rs1002951853 2366 dbSNP
rs1395729996 2367 dbSNP
rs1454257144 2397 dbSNP
rs1171361855 2399 dbSNP
rs1410748063 2400 dbSNP
rs1318001632 2406 dbSNP
rs1401654992 2406 dbSNP
rs1386087603 2407 dbSNP
rs903277953 2408 dbSNP
rs1041749320 2409 dbSNP
rs1187005837 2419 dbSNP
rs1369640004 2424 dbSNP
rs879182095 2425 dbSNP
rs1433630538 2432 dbSNP
rs1281220611 2433 dbSNP
rs1351243035 2433 dbSNP
rs1223058361 2434 dbSNP
rs1265998618 2444 dbSNP
rs1486751977 2453 dbSNP
rs1051093929 2462 dbSNP
rs947401732 2464 dbSNP
rs1277906161 2466 dbSNP
rs998152345 2473 dbSNP
rs1451140632 2476 dbSNP
rs746028759 2477 dbSNP
rs1235115095 2481 dbSNP
rs1470797388 2484 dbSNP
rs539368445 2486 dbSNP
rs941523779 2506 dbSNP
rs878909023 2507 dbSNP
rs912771698 2510 dbSNP
rs1281942772 2514 dbSNP
rs533527847 2517 dbSNP
rs1224635259 2527 dbSNP
rs930096484 2535 dbSNP
rs986970412 2535 dbSNP
rs568764002 2539 dbSNP
rs1217157346 2543 dbSNP
rs147664586 2545 dbSNP
rs1377527504 2551 dbSNP
rs1233632582 2553 dbSNP
rs973795413 2553 dbSNP
rs962394532 2554 dbSNP
rs1208195766 2557 dbSNP
rs1312662889 2570 dbSNP
rs929740300 2572 dbSNP
rs990787727 2588 dbSNP
rs960904616 2590 dbSNP
rs916938404 2592 dbSNP
rs1250198763 2595 dbSNP
rs781629416 2596 dbSNP
rs1189027294 2598 dbSNP
rs1367593484 2599 dbSNP
rs530133624 2600 dbSNP
rs1169182630 2603 dbSNP
rs1396558261 2607 dbSNP
rs1408806635 2610 dbSNP
rs1306140840 2613 dbSNP
rs1415725029 2617 dbSNP
rs958329086 2619 dbSNP
rs535094895 2620 dbSNP
rs927234043 2631 dbSNP
rs978634347 2632 dbSNP
rs1377525395 2643 dbSNP
rs112534833 2644 dbSNP
rs968978161 2652 dbSNP
rs1461582090 2662 dbSNP
rs1292432395 2668 dbSNP
rs1034903833 2670 dbSNP
rs1242855933 2671 dbSNP
rs1272098202 2672 dbSNP
rs1340189758 2676 dbSNP
rs189727378 2689 dbSNP
rs1020112594 2691 dbSNP
rs999322152 2697 dbSNP
rs374207117 2698 dbSNP
rs902326518 2700 dbSNP
rs1430232863 2711 dbSNP
rs757496512 2716 dbSNP
rs1020342143 2731 dbSNP
rs1448353705 2735 dbSNP
rs1010098237 2739 dbSNP
rs1166111597 2742 dbSNP
rs1396873924 2743 dbSNP
rs1186975564 2750 dbSNP
rs1485845983 2759 dbSNP
rs562758089 2760 dbSNP
rs866862084 2762 dbSNP
rs1312106280 2769 dbSNP
rs1399826616 2774 dbSNP
rs1383665419 2788 dbSNP
rs1011596524 2792 dbSNP
rs1259216301 2797 dbSNP
rs751915544 2803 dbSNP
rs893163877 2821 dbSNP
rs1030119097 2822 dbSNP
rs1338252280 2826 dbSNP
rs1251381148 2828 dbSNP
rs1228892642 2830 dbSNP
rs1235632660 2833 dbSNP
rs942679509 2834 dbSNP
rs1293162419 2835 dbSNP
rs76113211 2835 dbSNP
rs549838401 2849 dbSNP
rs74978103 2849 dbSNP
rs796304969 2849 dbSNP
rs899804606 2849 dbSNP
rs1415816059 2850 dbSNP
rs1051321806 2851 dbSNP
rs1040008507 2868 dbSNP
rs1455168359 2871 dbSNP
rs1158920321 2878 dbSNP
rs1389751846 2897 dbSNP
rs1434611267 2910 dbSNP
rs1318674010 2914 dbSNP
rs1400174245 2923 dbSNP
rs1005789085 2927 dbSNP
rs546358380 2942 dbSNP
rs1301187326 2944 dbSNP
rs1397386267 2960 dbSNP
rs1310897283 2967 dbSNP
rs1241697004 2969 dbSNP
rs1261672437 2975 dbSNP
rs1302286290 2983 dbSNP
rs527920243 2984 dbSNP
rs1047221071 2988 dbSNP
rs973847944 3020 dbSNP
rs757811083 3021 dbSNP
rs567086651 3039 dbSNP
rs941100900 3041 dbSNP
rs1299972574 3045 dbSNP
rs1468542703 3055 dbSNP
rs916286171 3059 dbSNP
rs990893449 3064 dbSNP
rs1420806591 3065 dbSNP
rs895571917 3068 dbSNP
rs1056787179 3069 dbSNP
rs551978585 3099 dbSNP
rs1182310130 3100 dbSNP
rs1410920285 3104 dbSNP
rs1455398267 3106 dbSNP
rs796384187 3111 dbSNP
rs1415604924 3112 dbSNP
rs1164076060 3117 dbSNP
rs1034913114 3127 dbSNP
rs1458486582 3130 dbSNP
rs937035617 3141 dbSNP
rs1293001923 3156 dbSNP
rs926941558 3170 dbSNP
rs1475434147 3190 dbSNP
rs1366194634 3192 dbSNP
rs978686812 3194 dbSNP
rs977952614 3207 dbSNP
rs947315251 3208 dbSNP
rs966537429 3210 dbSNP
rs1226873037 3217 dbSNP
rs1274680130 3223 dbSNP
rs1335064843 3227 dbSNP
rs1179307688 3231 dbSNP
rs1022069120 3238 dbSNP
rs1436869079 3241 dbSNP
rs1481606563 3249 dbSNP
rs1177732048 3250 dbSNP
rs1250721834 3254 dbSNP
rs1471487755 3255 dbSNP
rs550834846 3259 dbSNP
rs1420367378 3260 dbSNP
rs1424610941 3261 dbSNP
rs988663158 3267 dbSNP
rs893214085 3268 dbSNP
rs954677170 3269 dbSNP
rs186299595 3271 dbSNP
rs1309179595 3278 dbSNP
rs116743549 3280 dbSNP
rs1408447640 3283 dbSNP
rs1295500065 3286 dbSNP
rs1379499529 3298 dbSNP
rs1227364288 3306 dbSNP
rs964063866 3313 dbSNP
rs1308779010 3320 dbSNP
rs1204522971 3342 dbSNP
rs182155851 3350 dbSNP
rs1018287231 3363 dbSNP
rs1278140670 3365 dbSNP
rs1238693384 3366 dbSNP
rs1006252780 3385 dbSNP
rs930199334 3409 dbSNP
rs1483728568 3416 dbSNP
rs1181530853 3419 dbSNP
rs1309354236 3424 dbSNP
rs1411816608 3431 dbSNP
rs1430396232 3437 dbSNP
rs888714607 3438 dbSNP
rs897363428 3442 dbSNP
rs1169287312 3451 dbSNP
rs1390178467 3453 dbSNP
rs1438842780 3456 dbSNP
rs529248580 3468 dbSNP
rs1360136427 3469 dbSNP
rs994367127 3471 dbSNP
rs529522471 3474 dbSNP
rs916322608 3476 dbSNP
rs1228571586 3482 dbSNP
rs4664229 3492 dbSNP
rs1340020352 3496 dbSNP
rs1236376341 3513 dbSNP
rs1279179578 3524 dbSNP
rs939029860 3526 dbSNP
rs867002749 3533 dbSNP
rs1207691755 3537 dbSNP
rs79478972 3538 dbSNP
rs905569388 3539 dbSNP
rs978008038 3542 dbSNP
rs1189345925 3563 dbSNP
rs1247471737 3565 dbSNP
rs572971520 3566 dbSNP
rs1447684004 3567 dbSNP
rs753368533 3570 dbSNP
rs557531354 3579 dbSNP
rs1426404786 3588 dbSNP
rs1469394185 3592 dbSNP
rs1414268626 3600 dbSNP
rs1174376836 3602 dbSNP
rs1346664121 3605 dbSNP
rs766053900 3608 dbSNP
rs545551792 3614 dbSNP
rs189976880 3616 dbSNP
rs913165966 3622 dbSNP
rs1362427734 3627 dbSNP
rs571995271 3635 dbSNP
rs1183501914 3647 dbSNP
rs184723892 3654 dbSNP
rs1217331167 3670 dbSNP
rs760448559 3672 dbSNP
rs989728150 3673 dbSNP
rs923082051 3674 dbSNP
rs1209626251 3679 dbSNP
rs1251823893 3690 dbSNP
rs1267703454 3691 dbSNP
rs201918969 3692 dbSNP
rs1195511618 3697 dbSNP
rs552900085 3702 dbSNP
rs1282695737 3706 dbSNP
rs1189880180 3711 dbSNP
rs964549196 3720 dbSNP
rs1458050026 3722 dbSNP
rs1158003395 3728 dbSNP
rs1385916311 3730 dbSNP
rs1204936895 3743 dbSNP
rs1018794049 3744 dbSNP
rs192346685 3747 dbSNP
rs377518751 3764 dbSNP
rs1029662992 3765 dbSNP
rs1281165005 3775 dbSNP
rs1350921111 3783 dbSNP
rs1227488924 3804 dbSNP
rs114746894 3814 dbSNP
rs897412702 3815 dbSNP
rs984142589 3828 dbSNP
rs1038595891 3849 dbSNP
rs1290642201 3854 dbSNP
rs1443121517 3860 dbSNP
rs373340434 3861 dbSNP
rs552015251 3863 dbSNP
rs1220031276 3865 dbSNP
rs773117384 3874 dbSNP
rs1254542639 3876 dbSNP
rs952801509 3880 dbSNP
rs1181894214 3883 dbSNP
rs1409397548 3888 dbSNP
rs1332784034 3893 dbSNP
rs1006144864 3916 dbSNP
rs895290747 3917 dbSNP
rs1025910378 3922 dbSNP
rs1330821841 3924 dbSNP
rs1371024040 3925 dbSNP
rs994806743 3931 dbSNP
rs747182332 3937 dbSNP
rs960233658 3941 dbSNP
rs374520851 3943 dbSNP
rs1001622882 3948 dbSNP
rs1160149615 3952 dbSNP
rs1247229630 3954 dbSNP
rs905621495 3963 dbSNP
rs1355770518 3979 dbSNP
rs1226609760 3989 dbSNP
rs1422571203 3990 dbSNP
rs1042762109 4010 dbSNP
rs1011253934 4013 dbSNP
rs1432477975 4016 dbSNP
rs891442749 4022 dbSNP
rs927667228 4027 dbSNP
rs1204947762 4057 dbSNP
rs1042032403 4058 dbSNP
rs1444444294 4066 dbSNP
rs1187856772 4068 dbSNP
rs945010893 4071 dbSNP
rs1471533646 4073 dbSNP
rs1169919227 4093 dbSNP
rs1390778049 4104 dbSNP
rs1428990533 4108 dbSNP
rs1306006057 4109 dbSNP
rs1377067945 4111 dbSNP
rs1193723810 4113 dbSNP
rs1455154798 4114 dbSNP
rs1335109508 4134 dbSNP
rs1240893905 4142 dbSNP
rs1340084131 4148 dbSNP
rs1053067301 4149 dbSNP
rs933230200 4150 dbSNP
rs923134469 4151 dbSNP
rs1038894474 4157 dbSNP
rs532928589 4158 dbSNP
rs964926085 4160 dbSNP
rs1228345603 4171 dbSNP
rs778122750 4172 dbSNP
rs911328730 4180 dbSNP
rs1286764971 4181 dbSNP
rs1209076735 4194 dbSNP
rs767599425 4216 dbSNP
rs867099534 4232 dbSNP
rs569620255 4233 dbSNP
rs985984617 4234 dbSNP
rs1448298680 4236 dbSNP
rs1166672445 4246 dbSNP
rs952773792 4249 dbSNP
rs955440771 4257 dbSNP
rs550973505 4261 dbSNP
rs1171779804 4271 dbSNP
rs529553501 4272 dbSNP
rs1029715062 4278 dbSNP
rs918578452 4287 dbSNP
rs1337500654 4288 dbSNP
rs1322753704 4301 dbSNP
rs973040629 4302 dbSNP
rs10167207 4309 dbSNP
rs1035862872 4312 dbSNP
rs1333323568 4315 dbSNP
rs540572004 4317 dbSNP
rs970170840 4318 dbSNP
rs1342497595 4326 dbSNP
rs1210232669 4327 dbSNP
rs1299808804 4331 dbSNP
rs1021403481 4336 dbSNP
rs528572688 4340 dbSNP
rs1011723318 4341 dbSNP
rs746105868 4343 dbSNP
rs1269457519 4346 dbSNP
rs1433670387 4348 dbSNP
rs1197968118 4350 dbSNP
rs1375744699 4364 dbSNP
rs1458584298 4369 dbSNP
rs564229833 4370 dbSNP
rs1173826967 4381 dbSNP
rs895332857 4383 dbSNP
rs771164041 4384 dbSNP
rs1287182029 4401 dbSNP
rs1167903224 4402 dbSNP
rs1393562258 4409 dbSNP
rs1387832740 4414 dbSNP
rs1476023779 4416 dbSNP
rs545639683 4422 dbSNP
rs1301126324 4427 dbSNP
rs575075107 4440 dbSNP
rs188224653 4441 dbSNP
rs901765129 4444 dbSNP
rs1328033741 4446 dbSNP
rs1206326392 4450 dbSNP
rs1003742694 4458 dbSNP
rs747415653 4461 dbSNP
rs1209201260 4466 dbSNP
rs906294065 4471 dbSNP
rs943198565 4475 dbSNP
rs778072188 4476 dbSNP
rs1182618918 4483 dbSNP
rs1048509890 4487 dbSNP
rs1413068191 4498 dbSNP
rs1213266146 4500 dbSNP
rs749092665 4506 dbSNP
rs1157069484 4508 dbSNP
rs1305900150 4518 dbSNP
rs183531497 4520 dbSNP
rs931378119 4521 dbSNP
rs1293462479 4528 dbSNP
rs1215172655 4529 dbSNP
rs918643488 4532 dbSNP
rs1279958363 4540 dbSNP
rs1364189049 4544 dbSNP
rs1412129860 4546 dbSNP
rs1308985055 4550 dbSNP
rs574649486 4550 dbSNP
rs1349548543 4553 dbSNP
rs1226215276 4556 dbSNP
rs1231257347 4558 dbSNP
rs1314387128 4558 dbSNP
rs945063618 4561 dbSNP
rs1243364337 4564 dbSNP
rs1263675804 4566 dbSNP
rs1354545806 4571 dbSNP
rs192240850 4584 dbSNP
rs1483994996 4589 dbSNP
rs1205653485 4591 dbSNP
rs1481273172 4592 dbSNP
rs1449749636 4606 dbSNP
rs1481921086 4620 dbSNP
rs1175730145 4623 dbSNP
rs1352329115 4625 dbSNP
rs1327607615 4626 dbSNP
rs1424486804 4630 dbSNP
rs1409993805 4634 dbSNP
rs376091513 4637 dbSNP
rs1164155329 4645 dbSNP
rs1383997893 4653 dbSNP
rs1260532775 4662 dbSNP
rs1426449620 4689 dbSNP
rs1169730365 4692 dbSNP
rs1163364701 4701 dbSNP
rs893455568 4703 dbSNP
rs973145886 4705 dbSNP
rs116566076 4719 dbSNP
rs928902198 4724 dbSNP
rs36021102 4725 dbSNP
rs577056742 4727 dbSNP
rs980309240 4736 dbSNP
rs544788493 4752 dbSNP
rs149062861 4755 dbSNP
rs10166720 4771 dbSNP
rs987325764 4791 dbSNP
rs1344286768 4800 dbSNP
rs778494099 4801 dbSNP
rs933107161 4805 dbSNP
rs1273772760 4807 dbSNP
rs989950167 4809 dbSNP
rs1239489657 4810 dbSNP
rs1483698459 4812 dbSNP
rs1205334218 4816 dbSNP
rs1439590406 4822 dbSNP
rs961390323 4828 dbSNP
rs955992171 4835 dbSNP
rs1016923185 4838 dbSNP
rs1211718526 4841 dbSNP
rs1359425766 4843 dbSNP
rs75751003 4846 dbSNP
rs1031381762 4847 dbSNP
rs575393737 4851 dbSNP
rs34018534 4857 dbSNP
rs1293673325 4863 dbSNP
rs1435103316 4865 dbSNP
rs377663077 4869 dbSNP
rs959645886 4883 dbSNP
rs901482141 4887 dbSNP
rs1034307353 4893 dbSNP
rs1278552041 4895 dbSNP
rs1442351878 4900 dbSNP
rs1003681762 4910 dbSNP
rs1311344636 4911 dbSNP
rs906687358 4911 dbSNP
rs766543619 4916 dbSNP
rs551124244 4921 dbSNP
rs1017563500 4922 dbSNP
rs1189284466 4930 dbSNP
rs1009257932 4931 dbSNP
rs754514695 4937 dbSNP
rs1193339364 4939 dbSNP
rs1007466510 4945 dbSNP
rs887649167 4951 dbSNP
rs564677422 4957 dbSNP
rs1432922109 4971 dbSNP
rs1049373552 4995 dbSNP
rs1417649559 5004 dbSNP
rs1457363645 5005 dbSNP
rs535774441 5013 dbSNP
rs1294227411 5026 dbSNP
rs929113829 5030 dbSNP
rs897248659 5032 dbSNP
rs1037089078 5033 dbSNP
rs942992019 5047 dbSNP
rs1177963080 5057 dbSNP
rs372952160 5063 dbSNP
rs1441673981 5074 dbSNP
rs1251201499 5075 dbSNP
rs1275331197 5078 dbSNP
rs1191742503 5080 dbSNP
rs938712319 5085 dbSNP
rs1281678376 5089 dbSNP
rs1265896562 5091 dbSNP
rs1052085970 5092 dbSNP
rs1283617879 5095 dbSNP
rs1223536791 5103 dbSNP
rs1314879420 5107 dbSNP
rs933157584 5112 dbSNP
rs1247736701 5115 dbSNP
rs928620685 5121 dbSNP
rs1197698891 5123 dbSNP
rs980359687 5137 dbSNP
rs1472697240 5139 dbSNP
rs948965187 5140 dbSNP
rs1223983952 5141 dbSNP
rs1405204032 5144 dbSNP
rs753377241 5148 dbSNP
rs1406536009 5154 dbSNP
rs1324140186 5168 dbSNP
rs1349214237 5171 dbSNP
rs1402940334 5178 dbSNP
rs1309584052 5180 dbSNP
rs1352609704 5197 dbSNP
rs1229263813 5202 dbSNP
rs188394378 5203 dbSNP
rs573971048 5204 dbSNP
rs1230047232 5208 dbSNP
rs956210219 5214 dbSNP
rs1291299686 5223 dbSNP
rs1031852711 5224 dbSNP
rs1490329008 5231 dbSNP
rs149815868 5233 dbSNP
rs1295759548 5236 dbSNP
rs965727913 5250 dbSNP
rs1254390212 5252 dbSNP
rs1017270670 5257 dbSNP
rs564268559 5264 dbSNP
rs1007196474 5265 dbSNP
rs1160182844 5287 dbSNP
rs79444717 5288 dbSNP
rs1393426571 5292 dbSNP
rs1413027912 5314 dbSNP
rs1422639489 5315 dbSNP
rs1027547638 5316 dbSNP
rs1193099583 5320 dbSNP
rs766963130 5336 dbSNP
rs1033955301 5339 dbSNP
rs1408926070 5341 dbSNP
rs1268022963 5349 dbSNP
rs530879285 5353 dbSNP
rs982312773 5359 dbSNP
rs1284824450 5364 dbSNP
rs1359420944 5369 dbSNP
rs1244451287 5370 dbSNP
rs1277309267 5370 dbSNP
rs1343334810 5374 dbSNP
rs558512459 5378 dbSNP
rs897643539 5383 dbSNP
rs755757408 5388 dbSNP
rs563361055 5392 dbSNP
rs1484804716 5396 dbSNP
rs1037100176 5398 dbSNP
rs1242008566 5403 dbSNP
rs938765240 5410 dbSNP
rs193198552 5411 dbSNP
rs1355428233 5415 dbSNP
rs566759448 5417 dbSNP
rs1044384063 5421 dbSNP
rs1032474651 5426 dbSNP
rs750270786 5428 dbSNP
rs1347927706 5429 dbSNP
rs375115214 5432 dbSNP
rs1381005290 5433 dbSNP
rs1361778661 5439 dbSNP
rs888754268 5442 dbSNP
rs1382167010 5443 dbSNP
rs1051703713 5444 dbSNP
rs574655380 5446 dbSNP
rs934854763 5447 dbSNP
rs1249950154 5451 dbSNP
rs1347513266 5459 dbSNP
rs767368117 5462 dbSNP
rs975871344 5464 dbSNP
rs1262053696 5468 dbSNP
rs941802835 5474 dbSNP
rs1173215604 5475 dbSNP
rs1248643149 5494 dbSNP
rs1427821962 5496 dbSNP
rs1190823333 5499 dbSNP
rs761855072 5512 dbSNP
rs1435470949 5535 dbSNP
rs1177438026 5539 dbSNP
rs756737691 5544 dbSNP
rs559590952 5551 dbSNP
rs909975439 5553 dbSNP
rs1379431911 5558 dbSNP
rs910262477 5560 dbSNP
rs1048935580 5569 dbSNP
rs938050763 5586 dbSNP
rs926604211 5589 dbSNP
rs1382175484 5590 dbSNP
rs982363377 5596 dbSNP
rs1333190269 5602 dbSNP
rs1234353885 5606 dbSNP
rs558196481 5608 dbSNP
rs914119034 5616 dbSNP
rs1255006973 5624 dbSNP
rs1268185738 5628 dbSNP
rs988277804 5630 dbSNP
rs985810590 5631 dbSNP
rs6734630 5632 dbSNP
rs1452023787 5640 dbSNP
rs1198415774 5642 dbSNP
rs1428906664 5644 dbSNP
rs1479564899 5651 dbSNP
rs1028011735 5652 dbSNP
rs1483322413 5653 dbSNP
rs1007701340 5667 dbSNP
rs1364486176 5674 dbSNP
rs576889194 5679 dbSNP
rs1453059451 5685 dbSNP
rs1287648692 5692 dbSNP
rs953099462 5695 dbSNP
rs993408829 5697 dbSNP
rs1307437223 5710 dbSNP
rs962224950 5712 dbSNP
rs1034808440 5715 dbSNP
rs386466391 5720 dbSNP
rs1312561435 5721 dbSNP
rs907299625 5722 dbSNP
rs1236236380 5734 dbSNP
rs1404537554 5737 dbSNP
rs1356922119 5738 dbSNP
rs1006065961 5740 dbSNP
rs1044436671 5742 dbSNP
rs1013347825 5747 dbSNP
rs187348865 5754 dbSNP
rs1483889455 5756 dbSNP
rs1184613713 5758 dbSNP
rs1251437215 5764 dbSNP
rs1048503687 5772 dbSNP
rs1157012716 5775 dbSNP
rs938087239 5777 dbSNP
rs1425824995 5786 dbSNP
rs1163453214 5795 dbSNP
rs764086312 5808 dbSNP
rs1055141336 5813 dbSNP
rs149898312 5816 dbSNP
rs1046386499 5819 dbSNP
rs949355822 5824 dbSNP
rs1314218976 5825 dbSNP
rs569037370 5836 dbSNP
rs1245188017 5844 dbSNP
rs183402275 5847 dbSNP
rs1040564114 5848 dbSNP
rs1252179045 5848 dbSNP
rs1480413976 5850 dbSNP
rs944831306 5866 dbSNP
rs1258381870 5867 dbSNP
rs1445274323 5870 dbSNP
rs75358811 5871 dbSNP
rs1424033200 5886 dbSNP
rs958252435 5890 dbSNP
rs1171526447 5895 dbSNP
rs985884073 5896 dbSNP
rs1353609467 5903 dbSNP
rs759590402 5908 dbSNP
rs985931185 5909 dbSNP
rs1382890447 5922 dbSNP
rs1451201331 5931 dbSNP
rs920270257 5937 dbSNP
rs972424602 5938 dbSNP
rs961995480 5948 dbSNP
rs1305505078 5953 dbSNP
rs114233629 5956 dbSNP
rs1461838459 5959 dbSNP
rs866513388 5960 dbSNP
rs1006539287 5961 dbSNP
rs190893961 5962 dbSNP
rs1187562604 5974 dbSNP
rs1419287164 5975 dbSNP
rs1023035202 5987 dbSNP
rs1012986264 6000 dbSNP
rs534730019 6001 dbSNP
rs185395577 6019 dbSNP
rs747186207 6020 dbSNP
rs140125527 6024 dbSNP
rs1390811635 6025 dbSNP
rs999220824 6028 dbSNP
rs530915364 6035 dbSNP
rs1046437905 6037 dbSNP
rs1359613346 6041 dbSNP
rs566855350 6043 dbSNP
rs1390930058 6044 dbSNP
rs1220683514 6045 dbSNP
rs1285495471 6049 dbSNP
rs772360479 6064 dbSNP
rs1324501628 6067 dbSNP
rs1401091947 6071 dbSNP
rs1261362918 6072 dbSNP
rs1448769248 6073 dbSNP
rs1217135904 6085 dbSNP
rs1241984268 6090 dbSNP
rs1485128469 6104 dbSNP
rs563763460 6107 dbSNP
rs1429610179 6109 dbSNP
rs1479895615 6113 dbSNP
rs146662597 6114 dbSNP
rs369948018 6115 dbSNP
rs1400718389 6119 dbSNP
rs143949837 6124 dbSNP
rs1343354118 6130 dbSNP
rs930401945 6133 dbSNP
rs1438429130 6139 dbSNP
rs1303508937 6149 dbSNP
rs1344581893 6150 dbSNP
rs775866860 6154 dbSNP
rs1186295854 6166 dbSNP
rs1404601533 6171 dbSNP
rs1281536757 6173 dbSNP
rs541350707 6185 dbSNP
rs1369869573 6190 dbSNP
rs1224393238 6191 dbSNP
rs1284256554 6194 dbSNP
rs1419147267 6196 dbSNP
rs748511861 6199 dbSNP
rs1179199194 6201 dbSNP
rs1418062018 6202 dbSNP
rs1238248906 6203 dbSNP
rs971758824 6204 dbSNP
rs568411975 6207 dbSNP
rs940337415 6208 dbSNP
rs1467539663 6209 dbSNP
rs1273054579 6217 dbSNP
rs925511785 6220 dbSNP
rs1253455521 6221 dbSNP
rs1470252618 6227 dbSNP
rs1157480092 6228 dbSNP
rs1405761541 6230 dbSNP
rs927899587 6231 dbSNP
rs1164088029 6242 dbSNP
rs1364738471 6252 dbSNP
rs981982893 6256 dbSNP
rs1301582649 6257 dbSNP
rs755491130 6262 dbSNP
rs1279014024 6278 dbSNP
rs923027859 6279 dbSNP
rs1259229635 6285 dbSNP
rs1238580321 6289 dbSNP
rs1377826652 6297 dbSNP
rs564875200 6318 dbSNP
rs182390497 6321 dbSNP
rs1014592658 6323 dbSNP
rs1180586358 6337 dbSNP
rs140156662 6343 dbSNP
rs952059821 6350 dbSNP
rs1322767835 6355 dbSNP
rs1405778874 6359 dbSNP
rs957487102 6362 dbSNP
rs1384516449 6368 dbSNP
rs1442613650 6371 dbSNP
rs146125833 6373 dbSNP
rs1398973408 6374 dbSNP
rs1410768030 6383 dbSNP
rs1452613860 6402 dbSNP
rs760082418 6403 dbSNP
rs1328394180 6405 dbSNP
rs1380471305 6407 dbSNP
rs34001792 6411 dbSNP
rs542085629 6417 dbSNP
rs907023033 6422 dbSNP
rs998878307 6431 dbSNP
rs1382693327 6437 dbSNP
rs1244287826 6439 dbSNP
rs903170454 6440 dbSNP
rs1340443517 6443 dbSNP
rs1019230726 6453 dbSNP
rs1451990860 6456 dbSNP
rs1462308953 6464 dbSNP
rs1013608932 6466 dbSNP
rs892500042 6467 dbSNP
rs1009149518 6475 dbSNP
rs1442672518 6497 dbSNP
rs889321126 6502 dbSNP
rs1050623692 6510 dbSNP
rs1195182838 6524 dbSNP
rs930767801 6528 dbSNP
rs1373467190 6530 dbSNP
rs553377308 6544 dbSNP
rs115626335 6545 dbSNP
rs1417623254 6558 dbSNP
rs1471035584 6560 dbSNP
rs936646065 6561 dbSNP
rs1406058238 6563 dbSNP
rs1451134238 6565 dbSNP
rs553117097 6566 dbSNP
rs1260077667 6570 dbSNP
rs142906176 6576 dbSNP
rs1354706341 6583 dbSNP
rs1288366113 6585 dbSNP
rs927619683 6586 dbSNP
rs1325201672 6594 dbSNP
rs1050669264 6596 dbSNP
rs1261993456 6600 dbSNP
rs982027088 6609 dbSNP
rs947968110 6613 dbSNP
rs1274244415 6615 dbSNP
rs1446271949 6616 dbSNP
rs1437104087 6619 dbSNP
rs190749950 6625 dbSNP
rs923422100 6626 dbSNP
rs1399116244 6627 dbSNP
rs1428685726 6631 dbSNP
rs1360806422 6632 dbSNP
rs1464557976 6634 dbSNP
rs975864792 6635 dbSNP
rs940419158 6642 dbSNP
rs989345085 6643 dbSNP
rs1432386566 6650 dbSNP
rs1423835526 6664 dbSNP
rs186756393 6671 dbSNP
rs767423424 6674 dbSNP
rs1320823859 6675 dbSNP
rs951719305 6683 dbSNP
rs1261309756 6693 dbSNP
rs927222942 6703 dbSNP
rs1203215103 6705 dbSNP
rs980026887 6706 dbSNP
rs1490432703 6720 dbSNP
rs1200429334 6731 dbSNP
rs1192946769 6732 dbSNP
rs1268429183 6735 dbSNP
rs1431579410 6736 dbSNP
rs372664427 6737 dbSNP
rs971231426 6740 dbSNP
rs1364925257 6745 dbSNP
rs1265666387 6748 dbSNP
rs181102767 6749 dbSNP
rs1024082978 6754 dbSNP
rs1013661085 6755 dbSNP
rs1425630915 6770 dbSNP
rs1302215329 6771 dbSNP
rs977491369 6773 dbSNP
rs956787752 6777 dbSNP
rs532622207 6782 dbSNP
rs1031050888 6784 dbSNP
rs1236796286 6791 dbSNP
rs1293779444 6806 dbSNP
rs1347068699 6807 dbSNP
rs1268308213 6813 dbSNP
rs1221456038 6826 dbSNP
rs1291363502 6835 dbSNP
rs190276805 6836 dbSNP
rs1340877550 6838 dbSNP
rs1018955147 6848 dbSNP
rs757183893 6851 dbSNP
rs1418514129 6859 dbSNP
rs1412530446 6860 dbSNP
rs1051140780 6861 dbSNP
rs1358144577 6866 dbSNP
rs548643999 6868 dbSNP
rs1445692223 6884 dbSNP
rs889379525 6890 dbSNP
rs1415635297 6891 dbSNP
rs1463222929 6922 dbSNP
rs902053152 6925 dbSNP
rs545062826 6928 dbSNP
rs751355406 6930 dbSNP
rs529884512 6935 dbSNP
rs1317156414 6937 dbSNP
rs899309444 6945 dbSNP
rs940805871 6958 dbSNP
rs142974021 6970 dbSNP
rs1245031800 6974 dbSNP
rs1312669469 6985 dbSNP
rs547565581 7008 dbSNP
rs1308992563 7014 dbSNP
rs1478380936 7032 dbSNP
rs1206890746 7035 dbSNP
rs1048783504 7036 dbSNP
rs1480383936 7044 dbSNP
rs1196829617 7052 dbSNP
rs1245553898 7071 dbSNP
rs930330937 7072 dbSNP
rs940434716 7073 dbSNP
rs1412119994 7074 dbSNP
rs906245257 7082 dbSNP
rs1046046899 7093 dbSNP
rs1430602703 7094 dbSNP
rs1170777307 7096 dbSNP
rs1238220369 7097 dbSNP
rs1372139628 7106 dbSNP
rs762910573 7110 dbSNP
rs947687813 7115 dbSNP
rs1406109278 7120 dbSNP
rs971283900 7123 dbSNP
rs1300940032 7124 dbSNP
rs141643468 7129 dbSNP
rs917122487 7137 dbSNP
rs1270861384 7148 dbSNP
rs532455547 7149 dbSNP
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
     
Conditions OV2008 , A2780s
Location of target site 3'UTR
Tools used in this research FindTar
Original Description (Extracted from the article) ... Western blot analyses revealed that miR-376c, but not miR-22, decreased ALK7 protein levels.//Several miRNAs, including miR-22, miR-122a, miR-147, miR-368, miR-376a, miR-376b and miR-412 were identified to have the potential target sites at the ALK7 3'UTR (supplementary material Fig. S1A). A reporter construct containing ALK7 3'UTR downstream of the luciferase coding sequence was then generated and luciferase assays were performed to determine the effect of these miRNAs. Among all miRNAs tested, only miR- 368 was found to have an inhibitory effect (supplementary material Fig. S1B). ...

- Ye G; Fu G; Cui S; Zhao S; Bernaudo S; Bai et al., 2011, Journal of cell science.

Article - Ye G; Fu G; Cui S; Zhao S; Bernaudo S; Bai et al.
- Journal of cell science, 2011
MicroRNAs (miRNAs) are small noncoding RNAs that have important roles in gene regulation. We have previously reported that activin receptor-like kinase 7 (ALK7) and its ligand, Nodal, induce apoptosis in human epithelial ovarian cancer cells. In this study, we examined the regulation of ALK7 by miRNAs and demonstrate that miR-376c targets ALK7. Ectopic expression of miR-376c significantly increased cell proliferation and survival, enhanced spheroid formation and blocked Nodal-induced apoptosis. Interestingly, overexpression of miR-376c blocked cisplatin-induced cell death, whereas anti-miR-376c enhanced the effect of cisplatin. These effects of miR-376c were partially compensated by the overexpression of ALK7. Moreover, in serous carcinoma samples taken from ovarian cancer patients who responded well to chemotherapy, strong ALK7 staining and low miR-376c expression was detected. By contrast, ALK7 expression was weak and miR-376c levels were high in samples from patients who responded poorly to chemotherapy. Finally, treatment with cisplatin led to an increase in expression of mRNA encoding Nodal and ALK7 but a decrease in miR-376c levels. Taken together, these results demonstrate that the Nodal-ALK7 pathway is involved in cisplatin-induced cell death in ovarian cancer cells and that miR-376c enhances proliferation, survival and chemoresistance by targeting, at least in part, ALK7.
LinkOut: [PMID: 21224400]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 </