miRTarBase - #MIRT006027 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FGF7   
Synonyms HBGF-7, KGF
Description fibroblast growth factor 7
Transcript NM_002009   
Expression
Putative miRNA Targets on FGF7
3'UTR of FGF7
(miRNA target sites are highlighted)
>FGF7|NM_002009|3'UTR
   1 TTGCATATGGTATATAAAGAACCAGTTCCAGCAGGGAGATTTCTTTAAGTGGACTGTTTTCTTTCTTCTCAAAATTTTCT
  81 TTCCTTTTATTTTTTAGTAATCAAGAAAGGCTGGAAAACTACTGAAAAACTGATCAAGCTGGACTTGTGCATTTATGTTT
 161 GTTTTAAGACACTGCATTAAAGAAAGATTTGAAAAGTATACACAAAAATCAGATTTAGTAACTAAAGGTTGTAAAAAATT
 241 GTAAAACTGGTTGTACAATCATGATGTTAGTAACAGTAATTTTTTTCTTAAATTAATTTACCCTTAAGAGTATGTTAGAT
 321 TTGATTATCTGATAATGATTATTTAAATATTCCTATCTGCTTATAAAATGGCTGCTATAATAATAATAATACAGATGTTG
 401 TTATATAAGGTATATCAGACCTACAGGCTTCTGGCAGGATTTGTCAGATAATCAAGCCACACTAACTATGGAAAATGAGC
 481 AGCATTTTAAATGCTTTCTAGTGAAAAATTATAATCTACTTAAACTCTAATCAGAAAAAAAATTCTCAAAAAAACTATTA
 561 TGAAAGTCAATAAAATAGATAATTTAACAAAAGTACAGGATTAGAACATGCTTATACCTATAAATAAGAACAAAATTTCT
 641 AATGCTGCTCAAGTGGAAAGGGTATTGCTAAAAGGATGTTTCCAAAAATCTTGTATATAAGATAGCAACAGTGATTGATG
 721 ATAATACTGTACTTCATCTTACTTGCCACAAAATAACATTTTATAAATCCTCAAAGTAAAATTGAGAAATCTTTAAGTTT
 801 TTTTCAAGTAACATAATCTATCTTTGTATAATTCATATTTGGGAATATGGCTTTTAATAATGTTCTTCCCACAAATAATC
 881 ATGCTTTTTTCCTATGGTTACAGCATTAAACTCTATTTTAAGTTGTTTTTGAACTTTATTGTTTTGTTATTTAAGTTTAT
 961 GTTATTTATAAAAAAAAAACCTTAATAAGCTGTATCTGTTTCATATGCTTTTAATTTTAAAGGAATAACAAAACTGTCTG
1041 GCTCAACGGCAAGTTTCCCTCCCTTTTCTGACTGACACTAAGTCTAGCACACAGCACTTGGGCCAGCAAATCCTGGAAGG
1121 CAGACAAAAATAAGAGCCTGAAGCAATGCTTACAATAGATGTCTCACACAGAACAATACAAATATGTAAAAAATCTTTCA
1201 CCACATATTCTTGCCAATTAATTGGATCATATAAGTAAAATCATTACAAATATAAGTATTTACAGGATTTTAAAGTTAGA
1281 ATATATTTGAATGCATGGGTAGAAAATATCATATTTTAAAACTATGTATATTTAAATTTAGTAATTTTCTAATCTCTAGA
1361 AATCTCTGCTGTTCAAAAGGTGGCAGCACTGAAAGTTGTTTTCCTGTTAGATGGCAAGAGCACAATGCCCAAAATAGAAG
1441 ATGCAGTTAAGAATAAGGGGCCCTGAATGTCATGAAGGCTTGAGGTCAGCCTACAGATAACAGGATTATTACAAGGATGA
1521 ATTTCCACTTCAAAAGTCTTTCATTGGCAGATCTTGGTAGCACTTTATATGTTCACCAATGGGAGGTCAATATTTATCTA
1601 ATTTAAAAGGTATGCTAACCACTGTGGTTTTAATTTCAAAATATTTGTCATTCAAGTCCCTTTACATAAATAGTATTTGG
1681 TAATACATTTATAGATGAGAGTTATATGAAAAGGCTAGGTCAACAAAAACAATAGATTCATTTAATTTTCCTGTGGTTGA
1761 CCTATACGACCAGGATGTAGAAAACTAGAAAGAACTGCCCTTCCTCAGATATACTCTTGGGAGAGAGCATGAATGGTATT
1841 CTGAACTATCACCTGATTCAAGGACTTTGCTAGCTAGGTTTTGAGGTCAGGCTTCAGTAACTGTAGTCTTGTGAGCATAT
1921 TGAGGGCAGAGGAGGACTTAGTTTTTCATATGTGTTTCCTTAGTGCCTAGCAGACTATCTGTTCATAATCAGTTTTCAGT
2001 GTGAATTCACTGAATGTTTATAGACAAAAGAAAATACACACTAAAACTAATCTTCATTTTAAAAGGGTAAAACATGACTA
2081 TACAGAAATTTAAATAGAAATAGTGTATATACATATAAAATACAAGCTATGTTAGGACCAAATGCTCTTTGTCTATGGAG
2161 TTATACTTCCATCAAATTACATAGCAATGCTGAATTAGGCAAAACCAACATTTAGTGGTAAATCCATTCCTGGTAGTATA
2241 AGTCACCTAAAAAAGACTTCTAGAAATATGTACTTTAATTATTTGTTTTTCTCCTATTTTTAAATTTATTATGCAAATTT
2321 TAGAAAATAAAATTTGCTCTAGTTACACACCTTTAGAATTCTAGAATATTAAAACTGTAAGGGGCCTCCATCCCTCTTAC
2401 TCATTTGTAGTCTAGGAAATTGAGATTTTGATACACCTAAGGTCACGCAGCTGGGTAGATATACAGCTGTCACAAGAGTC
2481 TAGATCAGTTAGCACATGCTTTCTACTCTTCGATTATTAGTATTATTAGCTAATGGTCTTTGGCATGTTTTTGTTTTTTA
2561 TTTCTGTTGAGATATAGCCTTTACATTTGTACACAAATGTGACTATGTCTTGGCAATGCACTTCATACACAATGACTAAT
2641 CTATACTGTGATGATTTGACTCAAAAGGAGAAAAGAAATTATGTAGTTTTCAATTCTGATTCCTATTCACCTTTTGTTTA
2721 TGAATGGAAAGCTTTGTGCAAAATATACATATAAGCAGAGTAAGCCTTTTAAAAATGTTCTTTGAAAGATAAAATTAAAT
2801 ACATGAGTTTCTAACAATTAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUA-CACGACGAu 5'
            |||| : || |  ||||||| 
Target 5' aaCAAAAT-TTCTAATGCTGCTc 3'
629 - 650 151.00 -11.19
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||:|    | |||||:| 
Target 5' tagAAATC----TCTGCTGTTc 3'
1357 - 1374 133.00 -8.90
3
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' tctgcttataaaatgGCTGCTa 3'
356 - 377 120.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN29467370 5 COSMIC
COSN30493660 20 COSMIC
COSN30115289 56 COSMIC
COSN30107728 95 COSMIC
COSN30540148 114 COSMIC
COSN31541461 228 COSMIC
COSN31552677 264 COSMIC
COSN31528183 286 COSMIC
COSN31527870 288 COSMIC
COSN19658063 353 COSMIC
COSN7047292 661 COSMIC
COSN31486413 773 COSMIC
COSN1678337 824 COSMIC
COSN26664989 962 COSMIC
COSN20112011 980 COSMIC
COSN26555226 990 COSMIC
COSN23113748 1038 COSMIC
COSN30160424 1049 COSMIC
COSN26567955 1133 COSMIC
COSN7047293 1173 COSMIC
COSN26667845 1184 COSMIC
COSN28687906 1214 COSMIC
COSN27777721 1285 COSMIC
COSN16760325 1324 COSMIC
COSN32057970 1679 COSMIC
COSN1678338 2298 COSMIC
COSN25047488 2961 COSMIC
COSN5398239 3153 COSMIC
COSN8745908 3556 COSMIC
COSN22302916 3572 COSMIC
COSN24991850 3647 COSMIC
COSN25960118 3737 COSMIC
COSN28430401 4112 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1283710089 6 dbSNP
rs781259549 7 dbSNP
rs748042155 8 dbSNP
rs770942278 12 dbSNP
rs1448757628 14 dbSNP
rs965013311 26 dbSNP
rs774439584 28 dbSNP
rs746054252 33 dbSNP
rs1477142422 35 dbSNP
rs1202284159 36 dbSNP
rs1378540461 37 dbSNP
rs920458465 39 dbSNP
rs1396091692 44 dbSNP
rs1170427456 47 dbSNP
rs547919507 55 dbSNP
rs559835965 56 dbSNP
rs1364088518 58 dbSNP
rs908513751 64 dbSNP
rs1167861389 66 dbSNP
rs940021016 71 dbSNP
rs1057178213 73 dbSNP
rs896056849 85 dbSNP
rs1395186066 95 dbSNP
rs530140911 96 dbSNP
rs1330207256 103 dbSNP
rs1356629873 110 dbSNP
rs1351691524 114 dbSNP
rs548570707 136 dbSNP
rs1044564824 152 dbSNP
rs1231528342 155 dbSNP
rs1434843915 157 dbSNP
rs904691150 158 dbSNP
rs1346322510 169 dbSNP
rs1443779231 172 dbSNP
rs191726970 184 dbSNP
rs1317959077 186 dbSNP
rs538124446 202 dbSNP
rs1399695472 204 dbSNP
rs1276339029 213 dbSNP
rs1160007655 229 dbSNP
rs1031398495 233 dbSNP
rs182299198 235 dbSNP
rs187088824 239 dbSNP
rs955684090 240 dbSNP
rs1057636 257 dbSNP
rs771110897 261 dbSNP
rs1018596484 271 dbSNP
rs13433 275 dbSNP
rs1447727717 275 dbSNP
rs1264088783 278 dbSNP
rs571411442 280 dbSNP
rs1199001998 288 dbSNP
rs1269364304 288 dbSNP
rs1490727798 289 dbSNP
rs975104498 298 dbSNP
rs920402655 330 dbSNP
rs951980601 337 dbSNP
rs1191116810 341 dbSNP
rs984181455 342 dbSNP
rs35686890 353 dbSNP
rs1168994040 358 dbSNP
rs1422186635 370 dbSNP
rs1326542077 372 dbSNP
rs1057146078 377 dbSNP
rs940115977 377 dbSNP
rs1374555145 386 dbSNP
rs1174044326 389 dbSNP
rs369619368 407 dbSNP
rs532499070 410 dbSNP
rs879264279 415 dbSNP
rs1366615266 417 dbSNP
rs1057638 426 dbSNP
rs1374887843 436 dbSNP
rs1316558981 462 dbSNP
rs1485468844 466 dbSNP
rs1258583262 489 dbSNP
rs1213444478 494 dbSNP
rs1045048760 495 dbSNP
rs1274512203 499 dbSNP
rs571772249 501 dbSNP
rs372127537 502 dbSNP
rs867465970 502 dbSNP
rs535877149 505 dbSNP
rs904663003 516 dbSNP
rs1272018285 518 dbSNP
rs1416363665 521 dbSNP
rs1000340231 522 dbSNP
rs1354114106 522 dbSNP
rs1410492141 523 dbSNP
rs1053242232 534 dbSNP
rs201603989 535 dbSNP
rs565868417 535 dbSNP
rs200623673 543 dbSNP
rs536480238 548 dbSNP
rs1260687540 553 dbSNP
rs190965118 556 dbSNP
rs1471800915 557 dbSNP
rs1232686472 560 dbSNP
rs1205757967 562 dbSNP
rs1447223486 571 dbSNP
rs900169922 581 dbSNP
rs1235263468 584 dbSNP
rs34169642 590 dbSNP
rs1211273142 599 dbSNP
rs996074939 600 dbSNP
rs1163549731 602 dbSNP
rs1028001985 607 dbSNP
rs952019081 608 dbSNP
rs3208783 623 dbSNP
rs1278742358 625 dbSNP
rs1427005531 626 dbSNP
rs1442760939 657 dbSNP
rs1356189123 666 dbSNP
rs983271082 674 dbSNP
rs1014798713 675 dbSNP
rs1384461487 691 dbSNP
rs112843832 704 dbSNP
rs961449664 721 dbSNP
rs1167303233 723 dbSNP
rs1380731212 729 dbSNP
rs201990168 731 dbSNP
rs60927272 731 dbSNP
rs1315718811 741 dbSNP
rs1178128885 743 dbSNP
rs1471399720 750 dbSNP
rs1245457704 765 dbSNP
rs60771113 768 dbSNP
rs1467601340 784 dbSNP
rs544082512 785 dbSNP
rs1236530700 788 dbSNP
rs1314777104 792 dbSNP
rs35073573 792 dbSNP
rs1224122814 798 dbSNP
rs1283185762 798 dbSNP
rs1259939062 799 dbSNP
rs1375309289 811 dbSNP
rs1301131423 815 dbSNP
rs1173510414 820 dbSNP
rs371359059 827 dbSNP
rs1371766516 829 dbSNP
rs1328022014 830 dbSNP
rs12787 836 dbSNP
rs1433065897 842 dbSNP
rs1344827406 845 dbSNP
rs948740950 851 dbSNP
rs980358392 868 dbSNP
rs1423540561 871 dbSNP
rs926181021 874 dbSNP
rs936288646 875 dbSNP
rs1275856160 877 dbSNP
rs1194942386 885 dbSNP
rs1253015392 885 dbSNP
rs1484643420 887 dbSNP
rs1460523028 896 dbSNP
rs182077617 897 dbSNP
rs1183502552 902 dbSNP
rs892003999 908 dbSNP
rs1244362400 912 dbSNP
rs12021 914 dbSNP
rs185098313 931 dbSNP
rs1446976444 936 dbSNP
rs1348488620 938 dbSNP
rs944420418 940 dbSNP
rs1057655 942 dbSNP
rs1380574794 946 dbSNP
rs1180050472 956 dbSNP
rs1361425051 956 dbSNP
rs1289620151 960 dbSNP
rs1040536229 961 dbSNP
rs1057656 962 dbSNP
rs1357723554 967 dbSNP
rs1312664605 970 dbSNP
rs1491004841 970 dbSNP
rs535504301 970 dbSNP
rs79465035 970 dbSNP
rs1057657 971 dbSNP
rs1426195810 974 dbSNP
rs1418192108 975 dbSNP
rs1027351117 976 dbSNP
rs1209884267 980 dbSNP
rs887685925 980 dbSNP
rs1160567764 983 dbSNP
rs1403987106 986 dbSNP
rs1004842286 990 dbSNP
rs1225185502 999 dbSNP
rs1337475461 1000 dbSNP
rs190085424 1009 dbSNP
rs960536767 1019 dbSNP
rs1353779106 1027 dbSNP
rs1305972223 1029 dbSNP
rs1336168085 1037 dbSNP
rs1377698000 1040 dbSNP
rs1296904798 1042 dbSNP
rs1240714454 1043 dbSNP
rs544778626 1048 dbSNP
rs183166589 1049 dbSNP
rs530204047 1053 dbSNP
rs980499556 1055 dbSNP
rs1064338 1065 dbSNP
rs926011788 1071 dbSNP
rs936255662 1080 dbSNP
rs1264487511 1082 dbSNP
rs879226752 1083 dbSNP
rs548633926 1086 dbSNP
rs1475386665 1092 dbSNP
rs989024807 1108 dbSNP
rs913369424 1114 dbSNP
rs1480278300 1119 dbSNP
rs944889885 1125 dbSNP
rs1206706718 1131 dbSNP
rs1292878664 1136 dbSNP
rs1234155056 1143 dbSNP
rs1040570030 1144 dbSNP
rs1305315195 1145 dbSNP
rs1391262435 1146 dbSNP
rs900235410 1157 dbSNP
rs188586834 1166 dbSNP
rs1420115823 1169 dbSNP
rs931784888 1170 dbSNP
rs887442124 1179 dbSNP
rs1004767045 1180 dbSNP
rs531547965 1186 dbSNP
rs1480240911 1188 dbSNP
rs373173503 1193 dbSNP
rs12440028 1200 dbSNP
rs1418349776 1208 dbSNP
rs1460373540 1212 dbSNP
rs1297588676 1215 dbSNP
rs1396923800 1226 dbSNP
rs1178926530 1253 dbSNP
rs1467151972 1253 dbSNP
rs1272659847 1255 dbSNP
rs1013820560 1258 dbSNP
rs1337242025 1261 dbSNP
rs1259243670 1266 dbSNP
rs1392986060 1267 dbSNP
rs192954168 1268 dbSNP
rs1309729128 1282 dbSNP
rs547173407 1292 dbSNP
rs773596769 1294 dbSNP
rs1001668552 1295 dbSNP
rs1441083904 1300 dbSNP
rs1392423023 1302 dbSNP
rs1284615950 1312 dbSNP
rs1033387883 1313 dbSNP
rs1305309585 1315 dbSNP
rs1225865129 1327 dbSNP
rs1452503787 1327 dbSNP
rs1252387929 1329 dbSNP
rs1194324671 1340 dbSNP
rs3985843 1357 dbSNP
rs535938973 1372 dbSNP
rs1481249771 1381 dbSNP
rs3985844 1387 dbSNP
rs1351802009 1400 dbSNP
rs988994989 1407 dbSNP
rs1232671768 1411 dbSNP
rs913505675 1412 dbSNP
rs1304899991 1413 dbSNP
rs183756896 1433 dbSNP
rs3985845 1434 dbSNP
rs1332363802 1436 dbSNP
rs1315725131 1437 dbSNP
rs1057669 1444 dbSNP
rs1057670 1451 dbSNP
rs1381330732 1457 dbSNP
rs976648498 1459 dbSNP
rs1299819869 1460 dbSNP
rs1432691424 1462 dbSNP
rs1394398051 1463 dbSNP
rs1174237360 1480 dbSNP
rs1479021438 1481 dbSNP
rs922162789 1485 dbSNP
rs931685557 1498 dbSNP
rs1200468477 1502 dbSNP
rs1447816532 1504 dbSNP
rs1265693107 1509 dbSNP
rs3959665 1516 dbSNP
rs1048809618 1518 dbSNP
rs908847850 1519 dbSNP
rs560983567 1529 dbSNP
rs1281637358 1543 dbSNP
rs1271113060 1545 dbSNP
rs1426871357 1546 dbSNP
rs1346452883 1547 dbSNP
rs1267899932 1566 dbSNP
rs1169648029 1569 dbSNP
rs1326641533 1571 dbSNP
rs1373504512 1577 dbSNP
rs1412677445 1589 dbSNP
rs940355604 1603 dbSNP
rs1374650814 1638 dbSNP
rs1463470988 1643 dbSNP
rs187754231 1644 dbSNP
rs1416109470 1659 dbSNP
rs1161401494 1660 dbSNP
rs1394356160 1666 dbSNP
rs148009287 1679 dbSNP
rs559223917 1681 dbSNP
rs1013539824 1682 dbSNP
rs1045301012 1683 dbSNP
rs577432762 1686 dbSNP
rs905028923 1698 dbSNP
rs1190138952 1700 dbSNP
rs1001991555 1701 dbSNP
rs1194731613 1702 dbSNP
rs1272993141 1702 dbSNP
rs1033071723 1708 dbSNP
rs1259535538 1719 dbSNP
rs192544650 1722 dbSNP
rs868781531 1731 dbSNP
rs1020275138 1734 dbSNP
rs966693467 1737 dbSNP
rs1333907487 1742 dbSNP
rs1328151587 1765 dbSNP
rs976364694 1768 dbSNP
rs1223483755 1769 dbSNP
rs1163001982 1772 dbSNP
rs183604133 1775 dbSNP
rs1418951899 1789 dbSNP
rs1183948892 1790 dbSNP
rs1485016367 1808 dbSNP
rs922057889 1812 dbSNP
rs1232778543 1819 dbSNP
rs953582516 1829 dbSNP
rs1457790502 1831 dbSNP
rs1239472505 1839 dbSNP
rs1211376121 1844 dbSNP
rs1185942518 1850 dbSNP
rs1262541136 1853 dbSNP
rs1229792146 1865 dbSNP
rs1278723288 1866 dbSNP
rs984922333 1878 dbSNP
rs1442872411 1882 dbSNP
rs1379119714 1884 dbSNP
rs1323985191 1886 dbSNP
rs1440334133 1892 dbSNP
rs1430209392 1897 dbSNP
rs1181732688 1904 dbSNP
rs1395486947 1904 dbSNP
rs1384369433 1905 dbSNP
rs1425143308 1909 dbSNP
rs1407757770 1910 dbSNP
rs1159587495 1913 dbSNP
rs908941728 1915 dbSNP
rs142415531 1921 dbSNP
rs1036022999 1924 dbSNP
rs1467674100 1941 dbSNP
rs1246909827 1949 dbSNP
rs917630739 1955 dbSNP
rs1445024491 1959 dbSNP
rs1452638071 1977 dbSNP
rs1288904471 1979 dbSNP
rs949290653 1986 dbSNP
rs1301242908 1994 dbSNP
rs1233618193 1996 dbSNP
rs1368459891 2009 dbSNP
rs1295467045 2026 dbSNP
rs1428895264 2039 dbSNP
rs773108959 2053 dbSNP
rs904996094 2060 dbSNP
rs1313626155 2062 dbSNP
rs936536937 2068 dbSNP
rs1173619502 2075 dbSNP
rs1453220935 2078 dbSNP
rs1425294825 2082 dbSNP
rs1053575056 2084 dbSNP
rs893213466 2086 dbSNP
rs1474231989 2102 dbSNP
rs1241220379 2104 dbSNP
rs1010315811 2105 dbSNP
rs1489172632 2107 dbSNP
rs1382487592 2109 dbSNP
rs1020202947 2114 dbSNP
rs901850878 2115 dbSNP
rs1312779908 2117 dbSNP
rs1303515981 2119 dbSNP
rs1292482431 2122 dbSNP
rs998145962 2132 dbSNP
rs1402210102 2140 dbSNP
rs1315300397 2144 dbSNP
rs1312767287 2146 dbSNP
rs1029262959 2148 dbSNP
rs766720527 2152 dbSNP
rs1407783465 2154 dbSNP
rs1261365629 2156 dbSNP
rs1466359257 2161 dbSNP
rs1016477168 2165 dbSNP
rs1478652620 2182 dbSNP
rs961790143 2183 dbSNP
rs576811666 2189 dbSNP
rs1445180860 2190 dbSNP
rs1483528795 2199 dbSNP
rs1257756070 2208 dbSNP
rs866874509 2210 dbSNP
rs1183333070 2217 dbSNP
rs1307039388 2218 dbSNP
rs1258895637 2225 dbSNP
rs1220724177 2236 dbSNP
rs1353887226 2239 dbSNP
rs1293080429 2256 dbSNP
rs1405561643 2262 dbSNP
rs1418118186 2263 dbSNP
rs971811951 2270 dbSNP
rs1297003218 2274 dbSNP
rs1460006752 2295 dbSNP
rs1398948883 2296 dbSNP
rs917555068 2297 dbSNP
rs1466874057 2302 dbSNP
rs1163940955 2304 dbSNP
rs949094383 2304 dbSNP
rs370478883 2308 dbSNP
rs1258151565 2310 dbSNP
rs981073678 2313 dbSNP
rs1159441723 2315 dbSNP
rs1480324707 2316 dbSNP
rs926543083 2317 dbSNP
rs936617110 2319 dbSNP
rs1332948453 2324 dbSNP
rs1272862684 2325 dbSNP
rs1346441144 2326 dbSNP
rs1305429815 2327 dbSNP
rs1391355650 2328 dbSNP
rs1053547203 2337 dbSNP
rs1331420582 2349 dbSNP
rs1467834788 2351 dbSNP
rs1292632275 2356 dbSNP
rs1458174451 2370 dbSNP
rs1370006284 2376 dbSNP
rs1156753745 2378 dbSNP
rs1335496566 2386 dbSNP
rs892302562 2389 dbSNP
rs1180585470 2392 dbSNP
rs1467230110 2395 dbSNP
rs1252589905 2408 dbSNP
rs946100574 2409 dbSNP
rs1489648621 2413 dbSNP
rs1259339073 2414 dbSNP
rs1286276889 2420 dbSNP
rs1238857356 2422 dbSNP
rs146377429 2434 dbSNP
rs1312147514 2438 dbSNP
rs901815267 2440 dbSNP
rs997506146 2441 dbSNP
rs1386992777 2447 dbSNP
rs1029434840 2448 dbSNP
rs530938535 2461 dbSNP
rs1331494409 2462 dbSNP
rs1201790937 2463 dbSNP
rs765837101 2465 dbSNP
rs1016404959 2467 dbSNP
rs1452607062 2469 dbSNP
rs545851654 2471 dbSNP
rs139688996 2477 dbSNP
rs971779040 2482 dbSNP
rs1435114924 2491 dbSNP
rs751087675 2499 dbSNP
rs1259993850 2500 dbSNP
rs759237286 2506 dbSNP
rs374010573 2509 dbSNP
rs1288716762 2512 dbSNP
rs970907662 2513 dbSNP
rs1345027004 2519 dbSNP
rs11630629 2535 dbSNP
rs1233419752 2554 dbSNP
rs1230940326 2557 dbSNP
rs1480219478 2574 dbSNP
rs58284238 2576 dbSNP
rs957909254 2580 dbSNP
rs1340921241 2585 dbSNP
rs1299919359 2596 dbSNP
rs1413628274 2600 dbSNP
rs989364430 2610 dbSNP
rs375278216 2615 dbSNP
rs945227415 2624 dbSNP
rs529795976 2626 dbSNP
rs548267441 2627 dbSNP
rs1193243817 2636 dbSNP
rs933434382 2640 dbSNP
rs1265796171 2642 dbSNP
rs1050448864 2644 dbSNP
rs1280037564 2663 dbSNP
rs1442333309 2663 dbSNP
rs569620069 2668 dbSNP
rs1006447106 2669 dbSNP
rs1441855423 2681 dbSNP
rs1299114434 2682 dbSNP
rs1217673723 2683 dbSNP
rs1340826985 2686 dbSNP
rs537067934 2691 dbSNP
rs1352507474 2695 dbSNP
rs1412775651 2706 dbSNP
rs558254989 2708 dbSNP
rs1334805637 2709 dbSNP
rs897972911 2711 dbSNP
rs542776482 2713 dbSNP
rs1170153752 2718 dbSNP
rs1466345724 2725 dbSNP
rs1426114074 2729 dbSNP
rs1163222144 2737 dbSNP
rs1472700438 2740 dbSNP
rs1324424398 2750 dbSNP
rs1220858422 2761 dbSNP
rs1443603073 2765 dbSNP
rs1025593426 2771 dbSNP
rs1197554882 2783 dbSNP
rs970500044 2786 dbSNP
rs1259635095 2791 dbSNP
rs1231202425 2792 dbSNP
rs1355403459 2798 dbSNP
rs1284666632 2804 dbSNP
rs1246901925 2820 dbSNP
rs1333994226 2820 dbSNP
rs764039065 2820 dbSNP
rs1270878247 2827 dbSNP
rs1402693216 2827 dbSNP
rs1306850726 2830 dbSNP
rs1405089814 2834 dbSNP
rs1415019875 2840 dbSNP
rs1204881400 2845 dbSNP
rs1469065424 2849 dbSNP
rs1253728586 2855 dbSNP
rs1380289236 2857 dbSNP
rs1489695582 2859 dbSNP
rs1198285216 2860 dbSNP
rs1457861949 2865 dbSNP
rs1268965746 2868 dbSNP
rs1002363112 2872 dbSNP
rs1478764842 2885 dbSNP
rs1218966353 2888 dbSNP
rs1450754683 2901 dbSNP
rs772209840 2903 dbSNP
rs113014475 2917 dbSNP
rs34543803 2917 dbSNP
rs538051823 2917 dbSNP
rs755725861 2917 dbSNP
rs199546996 2920 dbSNP
rs1351407609 2927 dbSNP
rs1308502543 2942 dbSNP
rs1240941869 2947 dbSNP
rs957710933 2956 dbSNP
rs1301477708 2962 dbSNP
rs571191920 2963 dbSNP
rs1169577269 2967 dbSNP
rs769700070 2980 dbSNP
rs1325928018 2985 dbSNP
rs1399388287 3002 dbSNP
rs1360423076 3012 dbSNP
rs1159808569 3013 dbSNP
rs1372840747 3014 dbSNP
rs1403313508 3020 dbSNP
rs913801868 3026 dbSNP
rs535335736 3027 dbSNP
rs1477483063 3028 dbSNP
rs966626567 3031 dbSNP
rs1223453078 3032 dbSNP
rs1487216747 3036 dbSNP
rs1477995508 3051 dbSNP
rs1285164665 3060 dbSNP
rs1217290607 3061 dbSNP
rs1355866190 3065 dbSNP
rs1302835966 3068 dbSNP
rs1276608464 3069 dbSNP
rs1346223668 3076 dbSNP
rs1438621239 3082 dbSNP
rs1268505652 3087 dbSNP
rs28669217 3088 dbSNP
rs1429001286 3089 dbSNP
rs1340327913 3094 dbSNP
rs1299271810 3098 dbSNP
rs1422071668 3120 dbSNP
rs1215116131 3121 dbSNP
rs1173336032 3133 dbSNP
rs1413449000 3141 dbSNP
rs575096513 3144 dbSNP
rs1192594276 3145 dbSNP
rs1476697502 3148 dbSNP
rs933382479 3151 dbSNP
rs542011976 3153 dbSNP
rs1357088494 3154 dbSNP
rs910526599 3177 dbSNP
rs532126054 3180 dbSNP
rs1037730917 3188 dbSNP
rs1312870077 3193 dbSNP
rs1280947937 3198 dbSNP
rs557452212 3203 dbSNP
rs1190336048 3209 dbSNP
rs1317615175 3227 dbSNP
rs1241049975 3230 dbSNP
rs898068062 3233 dbSNP
rs114017199 3234 dbSNP
rs1189834227 3235 dbSNP
rs758975239 3236 dbSNP
rs1423206504 3240 dbSNP
rs1446590943 3240 dbSNP
rs906700929 3242 dbSNP
rs1177708461 3244 dbSNP
rs544144221 3247 dbSNP
rs1033862452 3249 dbSNP
rs1171121199 3257 dbSNP
rs1478704701 3259 dbSNP
rs957806262 3260 dbSNP
rs762802336 3266 dbSNP
rs546204510 3274 dbSNP
rs1239299141 3284 dbSNP
rs1435693279 3290 dbSNP
rs565129003 3293 dbSNP
rs72729121 3302 dbSNP
rs576765492 3303 dbSNP
rs1380501239 3310 dbSNP
rs540936362 3325 dbSNP
rs1315503437 3328 dbSNP
rs559174979 3345 dbSNP
rs1379193709 3347 dbSNP
rs1203051272 3349 dbSNP
rs1282915684 3354 dbSNP
rs1399056466 3365 dbSNP
rs749496994 3371 dbSNP
rs1463293940 3373 dbSNP
rs1029465142 3378 dbSNP
rs954026945 3379 dbSNP
rs529860745 3380 dbSNP
rs1424312261 3394 dbSNP
rs1250372631 3398 dbSNP
rs1176818355 3399 dbSNP
rs1443341627 3401 dbSNP
rs986211177 3401 dbSNP
rs1183318612 3421 dbSNP
rs143088797 3422 dbSNP
rs1473878485 3423 dbSNP
rs1222850529 3438 dbSNP
rs1157095890 3439 dbSNP
rs16962560 3443 dbSNP
rs942123420 3447 dbSNP
rs973395182 3452 dbSNP
rs919260676 3457 dbSNP
rs563433133 3463 dbSNP
rs1375556911 3466 dbSNP
rs1309444975 3470 dbSNP
rs1457778435 3481 dbSNP
rs1388204139 3490 dbSNP
rs1292723142 3492 dbSNP
rs1458253318 3495 dbSNP
rs1322664428 3502 dbSNP
rs530501605 3512 dbSNP
rs1439123801 3515 dbSNP
rs1381009232 3516 dbSNP
rs1180686841 3519 dbSNP
rs552196993 3524 dbSNP
rs1431646970 3526 dbSNP
rs1267022210 3536 dbSNP
rs929539181 3544 dbSNP
rs1047097041 3545 dbSNP
rs1216525387 3564 dbSNP
rs1352259163 3570 dbSNP
rs938159105 3578 dbSNP
rs1055326720 3579 dbSNP
rs893548528 3587 dbSNP
rs16962561 3590 dbSNP
rs1328961973 3596 dbSNP
rs1010649653 3598 dbSNP
rs1387085596 3610 dbSNP
rs1347192405 3613 dbSNP
rs1296200091 3614 dbSNP
rs1342095578 3617 dbSNP
rs1236418304 3618 dbSNP
rs1361157764 3636 dbSNP
rs1020539946 3639 dbSNP
rs1329433355 3644 dbSNP
rs150688099 3659 dbSNP
rs28460471 3662 dbSNP
rs1460337467 3667 dbSNP
rs1261493443 3668 dbSNP
rs16962566 3672 dbSNP
rs1345508054 3673 dbSNP
rs547323249 3679 dbSNP
rs568744006 3680 dbSNP
rs1266020136 3685 dbSNP
rs536064339 3702 dbSNP
rs1206357348 3703 dbSNP
rs1342284878 3723 dbSNP
rs1255009134 3727 dbSNP
rs1233529668 3730 dbSNP
rs954013142 3731 dbSNP
rs1276058579 3735 dbSNP
rs1341020482 3748 dbSNP
rs1399244654 3748 dbSNP
rs1257270556 3759 dbSNP
rs1394315231 3768 dbSNP
rs1444549471 3780 dbSNP
rs1401627623 3784 dbSNP
rs1180119056 3792 dbSNP
rs985687089 3802 dbSNP
rs1471070039 3808 dbSNP
rs1016813350 3809 dbSNP
rs1170372174 3810 dbSNP
rs1478379107 3813 dbSNP
rs963455836 3814 dbSNP
rs973491482 3816 dbSNP
rs1363384529 3845 dbSNP
rs1440128302 3852 dbSNP
rs4262892 3854 dbSNP
rs530234862 3855 dbSNP
rs1203820312 3861 dbSNP
rs1254890990 3861 dbSNP
rs1462376870 3867 dbSNP
rs1255809278 3870 dbSNP
rs1217763880 3875 dbSNP
rs1318362347 3877 dbSNP
rs1473056482 3883 dbSNP
rs919229478 3892 dbSNP
rs1339862635 3901 dbSNP
rs548364984 3910 dbSNP
rs1454685651 3915 dbSNP
rs1398344408 3921 dbSNP
rs773020952 3946 dbSNP
rs982155638 3949 dbSNP
rs928193226 3950 dbSNP
rs188447123 3962 dbSNP
rs4264346 3965 dbSNP
rs1055216914 3972 dbSNP
rs893977656 3973 dbSNP
rs1445982225 3977 dbSNP
rs1303418350 3986 dbSNP
rs946435975 3995 dbSNP
rs1197660019 4003 dbSNP
rs1438122171 4009 dbSNP
rs1274840222 4010 dbSNP
rs1404082287 4023 dbSNP
rs4264347 4025 dbSNP
rs1207910120 4031 dbSNP
rs113441454 4040 dbSNP
rs1284760003 4043 dbSNP
rs1248197851 4044 dbSNP
rs748169671 4061 dbSNP
rs902153433 4064 dbSNP
rs1308712165 4068 dbSNP
rs1447810315 4073 dbSNP
rs539538910 4075 dbSNP
rs998244260 4077 dbSNP
rs1321986412 4080 dbSNP
rs1405185771 4095 dbSNP
rs534774627 4095 dbSNP
rs192885172 4097 dbSNP
rs1029360769 4109 dbSNP
rs1425963621 4115 dbSNP
rs2413952 4121 dbSNP
rs145680473 4130 dbSNP
rs1016741960 4132 dbSNP
rs962548231 4133 dbSNP
rs1196452531 4136 dbSNP
rs919806406 4161 dbSNP
rs1026381380 4163 dbSNP
rs950858055 4165 dbSNP
rs559236862 4173 dbSNP
rs1351523887 4176 dbSNP
rs1233141577 4184 dbSNP
rs1285384958 4187 dbSNP
rs1224473740 4195 dbSNP
rs1375765902 4196 dbSNP
rs1273350727 4214 dbSNP
rs1436146607 4216 dbSNP
rs574376308 4221 dbSNP
rs1398713122 4225 dbSNP
rs982512526 4229 dbSNP
rs139987411 4233 dbSNP
rs959849848 4235 dbSNP
rs991041033 4245 dbSNP
rs71467689 4261 dbSNP
rs946905652 4265 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BxPC-3
Disease pancreatic carcinoma
Location of target site 3'UTR
Tools used in this research microRNA.org , miRanda , miRBase Target Database , PicTar , TargetBoost , TargetScan
Original Description (Extracted from the article) ... miR-15a and miR-214 were dysregulated in the tumor samples. This is the first time that miR-214 has been identified as aberrantly expressed in pancreatic cancer. In vitro experiments showed that overexpression of miR-15a inhibited the viability of pancreatic cancer cells,whereas overexpression of miR-214 decreased the sensitivity of the cells to gemcitabine (GEM). Furthermore, we identified WNT3A and FGF7 as potential targets of miR-15a and ING4 as a target of miR-214. ...

- Zhang XJ; Ye H; Zeng CW; He B; Zhang H; Chen YQ, 2010, Journal of hematology & oncology.

Article - Zhang XJ; Ye H; Zeng CW; He B; Zhang H; Chen YQ
- Journal of hematology & oncology, 2010
BACKGROUND: Recent reports indicate that microRNAs (miRNAs) play a critical role in malignancies. However, the role that miRNAs play in pancreatic cancer remains to be determined. The purpose of this study was to investigate aberrantly expressed miRNAs in pancreatic cancer tissues and demonstrate their roles in disease progression. RESULTS: We detected the expression patterns of miRNAs in 10 pancreatic cancer tissues and their adjacent benign tissues by quantitative real time-PCR (qRT-PCR) and found that miR-15a and miR-214 were dysregulated in the tumor samples. This is the first time that miR-214 has been identified as aberrantly expressed in pancreatic cancer. In vitro experiments showed that overexpression of miR-15a inhibited the viability of pancreatic cancer cells, whereas overexpression of miR-214 decreased the sensitivity of the cells to gemcitabine (GEM). Furthermore, we identified WNT3A and FGF7 as potential targets of miR-15a and ING4 as a target of miR-214. CONCLUSIONS: Aberrant expression of miRNAs such as miR-15a and miR-214 results in different cellular effects in pancreatic cancer. Downregulation of miR-15a might contribute to proliferation of pancreatic cancer cells, whereas upregulation of miR-214 in pancreatic cancer specimens might be related to the poor response of pancreatic cancer cells to chemotherapy. MiR-15a directly targets multiple genes relevant in pancreatic cancer, suggesting that it may serve as a novel therapeutic target for treatment of the disease.
LinkOut: [PMID: 21106054]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*