miRTarBase - #MIRT006805 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HMGA2   
Synonyms BABL, HMGI-C, HMGIC, LIPO, STQTL9
Description high mobility group AT-hook 2
Transcript NM_003483   
Other Transcripts NM_003484   
Expression
Putative miRNA Targets on HMGA2
3'UTR of HMGA2
(miRNA target sites are highlighted)
>HMGA2|NM_003483|3'UTR
   1 GGGGCGCCAACGTTCGATTTCTACCTCAGCAGCAGTTGGATCTTTTGAAGGGAGAAGACACTGCAGTGACCACTTATTCT
  81 GTATTGCCATGGTCTTTCCACTTTCATCTGGGGTGGGGTGGGGTGGGGTGGGGGAGGGGGGGGTGGGGTGGGGAGAAATC
 161 ACATAACCTTAAAAAGGACTATATTAATCACCTTCTTTGTAATCCCTTCACAGTCCCAGGTTTAGTGAAAAACTGCTGTA
 241 AACACAGGGGACACAGCTTAACAATGCAACTTTTAATTACTGTTTTCTTTTTTCTTAACCTACTAATAGTTTGTTGATCT
 321 GATAAGCAAGAGTGGGCGGGTGAGAAAAACCGAATTGGGTTTAGTCAATCACTGCACTGCATGCAAACAAGAAACGTGTC
 401 ACACTTGTGACGTCGGGCATTCATATAGGAAGAACGCGGTGTGTAACACTGTGTACACCTCAAATACCACCCCAACCCAC
 481 TCCCTGTAGTGAATCCTCTGTTTAGAACACCAAAGATAAGGACTAGATACTACTTTCTCTTTTTCGTATAATCTTGTAGA
 561 CACTTACTTGATGATTTTTAACTTTTTATTTCTAAATGAGACGAAATGCTGATGTATCCTTTCATTCAGCTAACAAACTA
 641 GAAAAGGTTATGTTCATTTTTCAAAAAGGGAAGTAAGCAAACAAATATTGCCAACTCTTCTATTTATGGATATCACACAT
 721 ATCAGCAGGAGTAATAAATTTACTCACAGCACTTGTTTTCAGGACAACACTTCATTTTCAGGAAATCTACTTCCTACAGA
 801 GCCAAAATGCCATTTAGCAATAAATAACACTTGTCAGCCTCAGAGCATTTAAGGAAACTAGACAAGTAAAATTATCCTCT
 881 TTGTAATTTAATGAAAAGGTACAACAGAATAATGCATGATGAACTCACCTAATTATGAGGTGGGAGGAGCGAAATCTAAA
 961 TTTCTTTTGCTATAGTTATACATCAATTTAAAAAGCAAAAAAAAAAAAGGGGGGGGCAATCTCTCTCTGTGTCTTTCTCT
1041 CTCTCTCTTCCTCTCCCTCTCTCTTTTCATTGTGTATCAGTTTCCATGAAAGACCTGAATACCACTTACCTCAAATTAAG
1121 CATATGTGTTACTTCAAGTAATACGTTTTGACATAAGATGGTTGACCAAGGTGCTTTTCTTCGGCTTGAGTTCACCATCT
1201 CTTCATTCAAACTGCACTTTTAGCCAGAGATGCAATATATCCCCACTACTCAATACTACCTCTGAATGTTACAACGAATT
1281 TACAGTCTAGTACTTATTACATGCTGCTATACACAAGCAATGCAAGAAAAAAACTTACTGGGTAGGTGATTCTAATCATC
1361 TGCAGTTCTTTTTGTACACTTAATTACAGTTAAAGAAGCAATCTCCTTACTGTGTTTCAGCATGACTATGTATTTTTCTA
1441 TGTTTTTTTAATTAAAAATTTTTAAAATACTTGTTTCAGCTTCTCTGCTAGATTTCTACATTAACTTGAAAATTTTTTAA
1521 CCAAGTCGCTCCTAGGTTCTTAAGGATAATTTTCCTCAATCACACTACACATCACACAAGATTTGACTGTAATATTTAAA
1601 TATTACCCTCCAAGTCTGTACCTCAAATGAATTCTTTAAGGAGATGGACTAATTGACTTGCAAAGACCTACCTCCAGACT
1681 TCAAAAGGAATGAACTTGTTACTTGCAGCATTCATTTGTTTTTTCAATGTTTGAAATAGTTCAAACTGCAGCTAACCCTA
1761 GTCAAAACTATTTTTGTAAAAGACATTTGATAGAAAGGAACACGTTTTTACATACTTTTGCAAAATAAGTAAATAATAAA
1841 TAAAATAAAAGCCAACCTTCAAAGAAACTTGAAGCTTTGTAGGTGAGATGCAACAAGCCCTGCTTTTGCATAATGCAATC
1921 AAAAATATGTGTTTTTAAGATTAGTTGAATATAAGAAAATGCTTGACAAATATTTTCATGTATTTTACACAAATGTGATT
2001 TTTGTAATATGTCTCAACCAGATTTATTTTAAACGCTTCTTATGTAGAGTTTTTATGCCTTTCTCTCCTAGTGAGTGTGC
2081 TGACTTTTTAACATGGTATTATCAACTGGGCCAGGAGGTAGTTTCTCATGACGGCTTTTGTCAGTATGGCTTTTAGTACT
2161 GAAGCCAAATGAAACTCAAAACCATCTCTCTTCCAGCTGCTTCAGGGAGGTAGTTTCAAAGGCCACATACCTCTCTGAGA
2241 CTGGCAGATCGCTCACTGTTGTGAATCACCAAAGGAGCTATGGAGAGAATTAAAACTCAACATTACTGTTAACTGTGCGT
2321 TAAATAAGCAAATAAACAGTGGCTCATAAAAATAAAAGTCGCATTCCATATCTTTGGATGGGCCTTTTAGAAACCTCATT
2401 GGCCAGCTCATAAAATGGAAGCAATTGCTCATGTTGGCCAAACATGGTGCACCGAGTGATTTCCATCTCTGGTAAAGTTA
2481 CACTTTTATTTCCTGTATGTTGTACAATCAAAACACACTACTACCTCTTAAGTCCCAGTATACCTCATTTTTCATACTGA
2561 AAAAAAAAGCTTGTGGCCAATGGAACAGTAAGAACATCATAAAATTTTTATATATATAGTTTATTTTTGTGGGAGATAAA
2641 TTTTATAGGACTGTTCTTTGCTGTTGTTGGTCGCAGCTACATAAGACTGGACATTTAACTTTTCTACCATTTCTGCAAGT
2721 TAGGTATGTTTGCAGGAGAAAAGTATCAAGACGTTTAACTGCAGTTGACTTTCTCCCTGTTCCTTTGAGTGTCTTCTAAC
2801 TTTATTCTTTGTTCTTTATGTAGAATTGCTGTCTATGATTGTACTTTGAATCGCTTGCTTGTTGAAAATATTTCTCTAGT
2881 GTATTATCACTGTCTGTTCTGCACAATAAACATAACAGCCTCTGTGATCCCCATGTGTTTTGATTCCTGCTCTTTGTTAC
2961 AGTTCCATTAAATGAGTAATAAAGTTTGGTCAAAACAGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              | ::||||  ||||||| 
Target 5' tagtACTTATTACATGCTGCTa 3'
1288 - 1309 158.00 -12.30
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ::||::|| | |||||:| 
Target 5' ataGGACTGTTCTTTGCTGTTg 3'
2645 - 2666 147.00 -11.10
3
miRNA  3' gugUUUGGUA---AUA--CACGACGAu 5'
             |||||||   | |    |||||| 
Target 5' tcaAAACCATCTCTCTTCCAGCTGCTt 3'
2176 - 2202 125.00 -11.56
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1242348 1 COSMIC
COSN30498980 6 COSMIC
COSN31596349 11 COSMIC
COSN30474072 17 COSMIC
COSN32053014 48 COSMIC
COSN30491708 52 COSMIC
COSN30534211 55 COSMIC
COSN8586555 59 COSMIC
COSN31576754 60 COSMIC
COSN31580488 80 COSMIC
COSN31614160 88 COSMIC
COSN31519445 95 COSMIC
COSN30101185 120 COSMIC
COSN30544403 257 COSMIC
COSN31487560 353 COSMIC
COSN31518960 375 COSMIC
COSN30539738 436 COSMIC
COSN21723481 538 COSMIC
COSN31519727 546 COSMIC
COSN1581244 586 COSMIC
COSN5326035 687 COSMIC
COSN17038425 825 COSMIC
COSN5950066 863 COSMIC
COSN27212563 1009 COSMIC
COSN8586556 1010 COSMIC
COSN1150951 1036 COSMIC
COSN30166699 1048 COSMIC
COSN20109788 1049 COSMIC
COSN26670430 1056 COSMIC
COSN26584325 1064 COSMIC
COSN26679429 1075 COSMIC
COSN30538239 1121 COSMIC
COSN31572636 1183 COSMIC
COSN31609326 1209 COSMIC
COSN26679430 1233 COSMIC
COSN28657680 1276 COSMIC
COSN19052666 1334 COSMIC
COSN31515725 1461 COSMIC
COSN30541930 1484 COSMIC
COSN26638373 1546 COSMIC
COSN31568588 1553 COSMIC
COSN24304566 1630 COSMIC
COSN31529638 1635 COSMIC
COSN7618365 1647 COSMIC
COSN29985168 1696 COSMIC
COSN9568130 1699 COSMIC
COSN5950067 1843 COSMIC
COSN31520008 1859 COSMIC
COSN27143837 1940 COSMIC
COSN30169882 1984 COSMIC
COSN26586650 2074 COSMIC
COSN31516604 2178 COSMIC
COSN31577346 2211 COSMIC
COSN29570602 2213 COSMIC
COSN26634875 2383 COSMIC
COSN31523268 2481 COSMIC
COSN25350982 2489 COSMIC
COSN30542496 2562 COSMIC
COSN30543041 2563 COSMIC
COSN30542027 2569 COSMIC
COSN21857329 2584 COSMIC
COSN31530470 2607 COSMIC
COSN31584727 2643 COSMIC
COSN31562847 2675 COSMIC
COSN31544871 2678 COSMIC
COSN25345985 2684 COSMIC
COSN25350983 2707 COSMIC
COSN31609312 2875 COSMIC
COSN26564959 2880 COSMIC
rs1042725 1276 GWAS
rs8756 2681 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772000269 2 dbSNP
rs200916173 3 dbSNP
rs1221978454 4 dbSNP
rs374602952 5 dbSNP
rs1043157437 6 dbSNP
rs1179375258 7 dbSNP
rs1173016277 10 dbSNP
rs768594093 16 dbSNP
rs377439189 17 dbSNP
rs1164945515 26 dbSNP
rs199886793 35 dbSNP
rs1210955843 41 dbSNP
rs750164743 43 dbSNP
rs936462782 52 dbSNP
rs1052803161 61 dbSNP
rs1294248321 64 dbSNP
rs1490995808 65 dbSNP
rs1293296076 78 dbSNP
rs750986770 86 dbSNP
rs1243081946 91 dbSNP
rs1358110468 93 dbSNP
rs1229228760 109 dbSNP
rs1270355040 109 dbSNP
rs1324459854 109 dbSNP
rs892407845 111 dbSNP
rs1013909148 114 dbSNP
rs1199332473 115 dbSNP
rs1367312438 115 dbSNP
rs200298444 115 dbSNP
rs1237580526 120 dbSNP
rs1424026459 120 dbSNP
rs1397324838 122 dbSNP
rs1046098687 123 dbSNP
rs1457264980 125 dbSNP
rs1013205128 130 dbSNP
rs1372836563 133 dbSNP
rs1200663198 134 dbSNP
rs1215859153 135 dbSNP
rs1481640563 135 dbSNP
rs1222417780 136 dbSNP
rs1255913479 136 dbSNP
rs3837433 136 dbSNP
rs865882164 136 dbSNP
rs1197144131 137 dbSNP
rs1337093891 138 dbSNP
rs949829862 139 dbSNP
rs3741427 140 dbSNP
rs1487082728 142 dbSNP
rs1192699121 143 dbSNP
rs1257889785 144 dbSNP
rs868367967 145 dbSNP
rs1180108998 149 dbSNP
rs1031819825 150 dbSNP
rs1408407439 150 dbSNP
rs530463861 155 dbSNP
rs1035966279 167 dbSNP
rs904855329 173 dbSNP
rs1471126394 178 dbSNP
rs1001912620 180 dbSNP
rs1427708833 180 dbSNP
rs1199323021 182 dbSNP
rs1470819978 188 dbSNP
rs1160499786 192 dbSNP
rs1183283374 197 dbSNP
rs1435599176 203 dbSNP
rs550106211 204 dbSNP
rs897527374 207 dbSNP
rs1325408834 208 dbSNP
rs995487986 215 dbSNP
rs183701788 216 dbSNP
rs377007807 237 dbSNP
rs1222792753 246 dbSNP
rs1015933772 251 dbSNP
rs1419274815 259 dbSNP
rs1440025871 260 dbSNP
rs889367804 265 dbSNP
rs1337621223 267 dbSNP
rs1454844921 268 dbSNP
rs1404319159 279 dbSNP
rs866969942 300 dbSNP
rs538871482 305 dbSNP
rs1019137099 317 dbSNP
rs966105367 321 dbSNP
rs963525673 330 dbSNP
rs1342707568 331 dbSNP
rs1468108228 338 dbSNP
rs552672509 339 dbSNP
rs3741428 340 dbSNP
rs1183821746 341 dbSNP
rs988248292 348 dbSNP
rs534995821 351 dbSNP
rs1317333128 356 dbSNP
rs1026879561 357 dbSNP
rs979851883 360 dbSNP
rs925854720 383 dbSNP
rs955011122 384 dbSNP
rs1240284796 385 dbSNP
rs1315870549 396 dbSNP
rs1248413501 403 dbSNP
rs991255454 408 dbSNP
rs1336354417 409 dbSNP
rs1287482116 412 dbSNP
rs1351067478 413 dbSNP
rs1347333497 417 dbSNP
rs917102618 419 dbSNP
rs1379123855 423 dbSNP
rs988118860 423 dbSNP
rs910590615 433 dbSNP
rs543741442 436 dbSNP
rs1207730238 437 dbSNP
rs771341762 438 dbSNP
rs1470447895 439 dbSNP
rs1213517947 446 dbSNP
rs1487947831 448 dbSNP
rs756421016 457 dbSNP
rs1292433017 459 dbSNP
rs949799071 463 dbSNP
rs1357372622 467 dbSNP
rs1312211648 468 dbSNP
rs1215441854 469 dbSNP
rs555038399 478 dbSNP
rs34236173 482 dbSNP
rs1439162863 484 dbSNP
rs926006222 485 dbSNP
rs766831309 490 dbSNP
rs188200042 495 dbSNP
rs919007284 501 dbSNP
rs1366682785 504 dbSNP
rs1413164065 509 dbSNP
rs1425935987 513 dbSNP
rs1052308173 515 dbSNP
rs913718521 525 dbSNP
rs1421361074 530 dbSNP
rs949370829 535 dbSNP
rs1184505100 539 dbSNP
rs1477389317 540 dbSNP
rs75843835 545 dbSNP
rs930285842 547 dbSNP
rs879597401 549 dbSNP
rs1310813931 551 dbSNP
rs904877175 553 dbSNP
rs1489877117 565 dbSNP
rs1265009901 572 dbSNP
rs1374099377 583 dbSNP
rs1001796330 586 dbSNP
rs1466791597 587 dbSNP
rs1037431421 604 dbSNP
rs1271175194 608 dbSNP
rs1218363386 626 dbSNP
rs1346546252 633 dbSNP
rs898940921 645 dbSNP
rs537303655 647 dbSNP
rs1285734358 651 dbSNP
rs993639397 658 dbSNP
rs1275119529 670 dbSNP
rs1364835810 689 dbSNP
rs1232914628 694 dbSNP
rs1292485061 695 dbSNP
rs1026515589 697 dbSNP
rs1355876255 698 dbSNP
rs1167879815 700 dbSNP
rs556984212 705 dbSNP
rs1346646999 708 dbSNP
rs889344489 711 dbSNP
rs576933517 716 dbSNP
rs74328684 717 dbSNP
rs1458167402 720 dbSNP
rs559000036 723 dbSNP
rs1266739450 724 dbSNP
rs17847167 730 dbSNP
rs1018237594 732 dbSNP
rs1236275307 755 dbSNP
rs964727549 787 dbSNP
rs978784350 788 dbSNP
rs1009648462 790 dbSNP
rs1033000029 790 dbSNP
rs1379625405 794 dbSNP
rs1222197278 797 dbSNP
rs956144407 800 dbSNP
rs191471976 808 dbSNP
rs1312073182 812 dbSNP
rs1705 813 dbSNP
rs17847168 816 dbSNP
rs773974364 818 dbSNP
rs140646931 821 dbSNP
rs1445671464 846 dbSNP
rs1420588866 847 dbSNP
rs949208410 855 dbSNP
rs1406505862 859 dbSNP
rs1178386942 860 dbSNP
rs1464377394 867 dbSNP
rs1467504765 872 dbSNP
rs80299335 875 dbSNP
rs561394379 895 dbSNP
rs1424977926 904 dbSNP
rs34288246 928 dbSNP
rs1400177080 929 dbSNP
rs1445452586 930 dbSNP
rs1420900297 949 dbSNP
rs1248590172 950 dbSNP
rs926517939 951 dbSNP
rs1461971281 952 dbSNP
rs1245219878 954 dbSNP
rs1202124760 965 dbSNP
rs958628680 966 dbSNP
rs937911233 970 dbSNP
rs1241879014 973 dbSNP
rs1318195803 976 dbSNP
rs1332482708 985 dbSNP
rs1306507710 986 dbSNP
rs1230539903 990 dbSNP
rs145822537 992 dbSNP
rs1383004920 995 dbSNP
rs1338334298 996 dbSNP
rs1394006239 996 dbSNP
rs1170776525 997 dbSNP
rs772055044 997 dbSNP
rs796162493 997 dbSNP
rs917071587 997 dbSNP
rs1445344314 999 dbSNP
rs1318409314 1006 dbSNP
rs971169177 1007 dbSNP
rs1181992091 1008 dbSNP
rs1262949562 1008 dbSNP
rs372718814 1008 dbSNP
rs766528847 1008 dbSNP
rs1359546388 1009 dbSNP
rs1491162928 1009 dbSNP
rs77164510 1009 dbSNP
rs77692662 1010 dbSNP
rs971874249 1011 dbSNP
rs1383724822 1012 dbSNP
rs918988447 1014 dbSNP
rs1297511254 1015 dbSNP
rs1037356765 1016 dbSNP
rs1411541172 1017 dbSNP
rs1367591415 1019 dbSNP
rs1472616095 1020 dbSNP
rs898826341 1020 dbSNP
rs929108878 1021 dbSNP
rs7296768 1026 dbSNP
rs1263020911 1028 dbSNP
rs1269482854 1028 dbSNP
rs1477064592 1028 dbSNP
rs201441270 1036 dbSNP
rs563842645 1040 dbSNP
rs1198503538 1043 dbSNP
rs1264150696 1044 dbSNP
rs1048709277 1046 dbSNP
rs10573247 1048 dbSNP
rs7312910 1050 dbSNP
rs910234185 1058 dbSNP
rs552835798 1061 dbSNP
rs943599498 1070 dbSNP
rs1423581969 1071 dbSNP
rs566165063 1077 dbSNP
rs1321726611 1078 dbSNP
rs1017770073 1087 dbSNP
rs1404864630 1095 dbSNP
rs900785650 1103 dbSNP
rs149062521 1104 dbSNP
rs75519341 1105 dbSNP
rs1042969377 1110 dbSNP
rs1464342563 1120 dbSNP
rs1423429869 1126 dbSNP
rs1200781629 1127 dbSNP
rs1392175749 1133 dbSNP
rs143099265 1139 dbSNP
rs1196075552 1143 dbSNP
rs1450538574 1145 dbSNP
rs537064335 1146 dbSNP
rs988918880 1152 dbSNP
rs1315830267 1157 dbSNP
rs1024782373 1167 dbSNP
rs1224023265 1170 dbSNP
rs970604878 1174 dbSNP
rs557190608 1176 dbSNP
rs1001389397 1177 dbSNP
rs1336447660 1179 dbSNP
rs1276018975 1182 dbSNP
rs148192099 1183 dbSNP
rs926444190 1184 dbSNP
rs959397477 1186 dbSNP
rs182847557 1189 dbSNP
rs746238231 1191 dbSNP
rs937963367 1192 dbSNP
rs1172514464 1196 dbSNP
rs1477400694 1199 dbSNP
rs565798879 1202 dbSNP
rs1180088710 1207 dbSNP
rs1024135275 1208 dbSNP
rs971305239 1209 dbSNP
rs1267144569 1215 dbSNP
rs971892818 1230 dbSNP
rs920261590 1243 dbSNP
rs1026594654 1244 dbSNP
rs951810531 1245 dbSNP
rs928928906 1247 dbSNP
rs554823863 1254 dbSNP
rs984986356 1256 dbSNP
rs1281391078 1273 dbSNP
rs1042725 1276 dbSNP
rs1376382547 1277 dbSNP
rs1287055927 1284 dbSNP
rs763729121 1297 dbSNP
rs1337639705 1300 dbSNP
rs1454859316 1303 dbSNP
rs1357845329 1307 dbSNP
rs1334079662 1315 dbSNP
rs1401836140 1323 dbSNP
rs774399701 1326 dbSNP
rs1159882231 1327 dbSNP
rs1437316106 1334 dbSNP
rs1379235726 1339 dbSNP
rs1183838139 1343 dbSNP
rs1191978790 1344 dbSNP
rs1262849005 1351 dbSNP
rs879138836 1362 dbSNP
rs753665647 1363 dbSNP
rs1042726 1367 dbSNP
rs1042727 1368 dbSNP
rs942982804 1378 dbSNP
rs975750065 1382 dbSNP
rs923495786 1406 dbSNP
rs944461922 1407 dbSNP
rs1042550677 1410 dbSNP
rs1353090862 1412 dbSNP
rs541478260 1416 dbSNP
rs900671276 1417 dbSNP
rs1377390916 1420 dbSNP
rs1000452212 1426 dbSNP
rs1284022285 1430 dbSNP
rs1431957923 1431 dbSNP
rs936759030 1439 dbSNP
rs561457942 1441 dbSNP
rs1421082877 1442 dbSNP
rs751631691 1442 dbSNP
rs1013515612 1443 dbSNP
rs755710279 1443 dbSNP
rs1411334013 1450 dbSNP
rs1339674314 1457 dbSNP
rs891809363 1458 dbSNP
rs1265171434 1459 dbSNP
rs1010630526 1460 dbSNP
rs1024289924 1464 dbSNP
rs34231266 1475 dbSNP
rs1488000951 1478 dbSNP
rs1292643790 1483 dbSNP
rs1224019207 1484 dbSNP
rs1320090298 1490 dbSNP
rs1042729 1500 dbSNP
rs1342789846 1513 dbSNP
rs1244193067 1522 dbSNP
rs781344625 1528 dbSNP
rs1033511273 1529 dbSNP
rs952007056 1533 dbSNP
rs959158052 1534 dbSNP
rs1303285940 1537 dbSNP
rs543886862 1545 dbSNP
rs188169958 1546 dbSNP
rs1410306145 1552 dbSNP
rs1042730 1557 dbSNP
rs984649582 1558 dbSNP
rs950647967 1562 dbSNP
rs532730390 1569 dbSNP
rs983553048 1571 dbSNP
rs12425753 1574 dbSNP
rs1202513772 1576 dbSNP
rs142712559 1577 dbSNP
rs944495326 1578 dbSNP
rs568474503 1580 dbSNP
rs1182461484 1588 dbSNP
rs1246289081 1589 dbSNP
rs1205562529 1590 dbSNP
rs1320443331 1594 dbSNP
rs1380309080 1595 dbSNP
rs922102920 1601 dbSNP
rs1324840068 1603 dbSNP
rs1304094910 1607 dbSNP
rs922962694 1608 dbSNP
rs1364946790 1614 dbSNP
rs1292574788 1619 dbSNP
rs1447110137 1622 dbSNP
rs1402170746 1629 dbSNP
rs936126374 1635 dbSNP
rs1054731430 1646 dbSNP
rs866184973 1653 dbSNP
rs1328982065 1658 dbSNP
rs1464934865 1662 dbSNP
rs892065504 1681 dbSNP
rs1178160603 1688 dbSNP
rs1344212398 1692 dbSNP
rs978782013 1693 dbSNP
rs1177970149 1703 dbSNP
rs1010473765 1706 dbSNP
rs922627 1711 dbSNP
rs769411635 1714 dbSNP
rs1462052947 1715 dbSNP
rs1258269506 1716 dbSNP
rs370788613 1719 dbSNP
rs1231785252 1720 dbSNP
rs1395324418 1725 dbSNP
rs907198773 1728 dbSNP
rs1001574112 1740 dbSNP
rs1240267406 1752 dbSNP
rs1378604049 1758 dbSNP
rs1034360307 1760 dbSNP
rs949499486 1761 dbSNP
rs1402718663 1764 dbSNP
rs1304510421 1770 dbSNP
rs191412735 1774 dbSNP
rs994604321 1776 dbSNP
rs1046363950 1783 dbSNP
rs1441663744 1792 dbSNP
rs1378632941 1793 dbSNP
rs1178316765 1801 dbSNP
rs1027478649 1804 dbSNP
rs1235921290 1805 dbSNP
rs1254576225 1806 dbSNP
rs950728018 1822 dbSNP
rs1199219900 1827 dbSNP
rs779913418 1832 dbSNP
rs1216615152 1835 dbSNP
rs1261857814 1835 dbSNP
rs1199903745 1838 dbSNP
rs548666549 1843 dbSNP
rs993421634 1851 dbSNP
rs78295945 1857 dbSNP
rs574831732 1868 dbSNP
rs1306614443 1886 dbSNP
rs1042732 1893 dbSNP
rs1042734 1894 dbSNP
rs1042735 1896 dbSNP
rs1042736 1897 dbSNP
rs965668055 1899 dbSNP
rs1340815406 1900 dbSNP
rs974503172 1910 dbSNP
rs921658128 1921 dbSNP
rs1378303160 1928 dbSNP
rs1042737 1931 dbSNP
rs1298741349 1932 dbSNP
rs550732371 1937 dbSNP
rs147005466 1942 dbSNP
rs778231031 1946 dbSNP
rs1158238052 1950 dbSNP
rs913390492 1952 dbSNP
rs1406830032 1956 dbSNP
rs138213871 1958 dbSNP
rs1045943458 1966 dbSNP
rs1375652763 1968 dbSNP
rs1185816332 1971 dbSNP
rs997292449 1980 dbSNP
rs1030002309 1981 dbSNP
rs907203395 1984 dbSNP
rs768454241 2000 dbSNP
rs1488982157 2001 dbSNP
rs1402333069 2008 dbSNP
rs1283312607 2024 dbSNP
rs1215414541 2035 dbSNP
rs966742455 2036 dbSNP
rs1274294284 2042 dbSNP
rs1297635499 2043 dbSNP
rs187939732 2048 dbSNP
rs1388677055 2051 dbSNP
rs1401807256 2059 dbSNP
rs1055823024 2061 dbSNP
rs958326506 2070 dbSNP
rs1393063160 2073 dbSNP
rs1161691751 2081 dbSNP
rs1457708896 2104 dbSNP
rs1312042572 2106 dbSNP
rs17847170 2112 dbSNP
rs192310189 2113 dbSNP
rs1263134330 2128 dbSNP
rs1042739 2132 dbSNP
rs916771035 2133 dbSNP
rs949468984 2134 dbSNP
rs1451684768 2135 dbSNP
rs1046499133 2145 dbSNP
rs2170201 2147 dbSNP
rs995542896 2149 dbSNP
rs535284166 2165 dbSNP
rs1042740 2177 dbSNP
rs1355334692 2180 dbSNP
rs1258519853 2182 dbSNP
rs1027943156 2190 dbSNP
rs1042741 2192 dbSNP
rs1042742 2193 dbSNP
rs1315942017 2206 dbSNP
rs918679238 2208 dbSNP
rs1233984535 2214 dbSNP
rs929928613 2223 dbSNP
rs886236434 2228 dbSNP
rs1196229707 2231 dbSNP
rs1386463187 2231 dbSNP
rs761384755 2233 dbSNP
rs771765459 2239 dbSNP
rs1333732755 2246 dbSNP
rs867717325 2251 dbSNP
rs887663460 2252 dbSNP
rs1464423006 2254 dbSNP
rs1423453316 2257 dbSNP
rs185347553 2270 dbSNP
rs1480011186 2271 dbSNP
rs538795949 2273 dbSNP
rs1378896545 2276 dbSNP
rs761247117 2278 dbSNP
rs575275859 2279 dbSNP
rs1467712373 2282 dbSNP
rs900378366 2292 dbSNP
rs189879705 2303 dbSNP
rs1456286170 2314 dbSNP
rs547674457 2319 dbSNP
rs766591530 2320 dbSNP
rs1030044836 2324 dbSNP
rs1273208143 2339 dbSNP
rs1232655876 2342 dbSNP
rs181750301 2344 dbSNP
rs1311749900 2347 dbSNP
rs1444959188 2354 dbSNP
rs999567653 2356 dbSNP
rs184919666 2361 dbSNP
rs958512842 2362 dbSNP
rs1400716957 2369 dbSNP
rs1453271264 2381 dbSNP
rs374980605 2384 dbSNP
rs1180186401 2391 dbSNP
rs991070449 2400 dbSNP
rs916739881 2401 dbSNP
rs913393093 2413 dbSNP
rs535866086 2422 dbSNP
rs970836276 2423 dbSNP
rs546476844 2425 dbSNP
rs1210173201 2431 dbSNP
rs1354522882 2432 dbSNP
rs1401020447 2435 dbSNP
rs745362298 2437 dbSNP
rs982249013 2442 dbSNP
rs147193372 2446 dbSNP
rs1285098711 2448 dbSNP
rs1450670796 2449 dbSNP
rs930090923 2450 dbSNP
rs754249723 2454 dbSNP
rs1048863540 2455 dbSNP
rs1360682755 2465 dbSNP
rs34972628 2468 dbSNP
rs1160051553 2473 dbSNP
rs1321857602 2479 dbSNP
rs139284844 2487 dbSNP
rs1417535683 2496 dbSNP
rs982111645 2511 dbSNP
rs1406822919 2518 dbSNP
rs1182196238 2521 dbSNP
rs768402998 2528 dbSNP
rs1223098163 2529 dbSNP
rs78773853 2549 dbSNP
rs1263344981 2553 dbSNP
rs1473660087 2557 dbSNP
rs1187211749 2560 dbSNP
rs909910206 2560 dbSNP
rs1488658145 2571 dbSNP
rs1265482368 2573 dbSNP
rs928866387 2574 dbSNP
rs1316512962 2576 dbSNP
rs1490070608 2578 dbSNP
rs542466968 2597 dbSNP
rs941941490 2645 dbSNP
rs1039005705 2647 dbSNP
rs1293207291 2655 dbSNP
rs1401187429 2657 dbSNP
rs867632645 2661 dbSNP
rs1340573697 2663 dbSNP
rs937574122 2664 dbSNP
rs1397628349 2665 dbSNP
rs80228028 2673 dbSNP
rs1165058937 2674 dbSNP
rs8756 2681 dbSNP
rs1185920842 2682 dbSNP
rs1051608670 2691 dbSNP
rs552885609 2709 dbSNP
rs1425723700 2710 dbSNP
rs999306302 2715 dbSNP
rs1485591151 2716 dbSNP
rs1247493763 2720 dbSNP
rs763830574 2724 dbSNP
rs1224142097 2735 dbSNP
rs1162717556 2739 dbSNP
rs1273002534 2744 dbSNP
rs1219657411 2749 dbSNP
rs1032420781 2752 dbSNP
rs371955441 2753 dbSNP
rs758194543 2754 dbSNP
rs1212240065 2759 dbSNP
rs1365206384 2760 dbSNP
rs1420473286 2762 dbSNP
rs1360738169 2763 dbSNP
rs761638818 2765 dbSNP
rs1438225771 2768 dbSNP
rs1347776290 2770 dbSNP
rs1324922591 2787 dbSNP
rs1004695914 2793 dbSNP
rs893505725 2799 dbSNP
rs188648596 2808 dbSNP
rs1168515351 2832 dbSNP
rs533165764 2836 dbSNP
rs546455873 2837 dbSNP
rs868242381 2838 dbSNP
rs1430444935 2840 dbSNP
rs1426009737 2844 dbSNP
rs371770370 2853 dbSNP
rs1028701053 2854 dbSNP
rs1199593894 2858 dbSNP
rs956987343 2859 dbSNP
rs951529802 2866 dbSNP
rs984263132 2870 dbSNP
rs566451819 2871 dbSNP
rs1306385317 2872 dbSNP
rs1020001468 2875 dbSNP
rs1312212879 2880 dbSNP
rs535250837 2882 dbSNP
rs1220480249 2885 dbSNP
rs981656358 2892 dbSNP
rs1302250201 2903 dbSNP
rs199747252 2905 dbSNP
rs1402275164 2911 dbSNP
rs1287705807 2914 dbSNP
rs76032154 2916 dbSNP
rs1296346848 2923 dbSNP
rs975426736 2947 dbSNP
rs1359693993 2952 dbSNP
rs1178277310 2953 dbSNP
rs555310747 2964 dbSNP
rs867088488 2966 dbSNP
rs933252522 2982 dbSNP
rs1214774998 2985 dbSNP
rs1238010913 2988 dbSNP
rs1052013676 2991 dbSNP
rs11175982 2997 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MEG-01
Location of target site 3'UTR
Tools used in this research miRanda , PicTar , TargetScan
Original Description (Extracted from the article) ... This analysis identified miR-15ab, miR-16,miR-26ab, miR-196ab and Let-7a as potential HMGA-targeting miRNAs. Interestingly, the targeting sites of these HMGA-targeting miRNAs on the 3'UTR of HMGA1 and HMGA2 are extremely conserved in human, mouse and rat. ...

- Palmieri D; D'Angelo D; Valentino T; De et al., 2012, Oncogene.

Article - Palmieri D; D'Angelo D; Valentino T; De et al.
- Oncogene, 2012
Previous studies have demonstrated that high mobility group A proteins have a critical role on the onset of human pituitary adenomas. Indeed, both high mobility group A (HMGA) genes are overexpressed in pituitary adenomas, and consistently transgenic mice overexpressing either the Hmga1 or the Hmga2 gene develop mixed growth hormone/prolactin (GH-PRL)-secreting pituitary adenomas. Trisomy of chromosome 12, where HMGA2 is located, and/or amplification of the HMGA2 gene locus account for the HMGA2 overexpression in most human prolactinomas. Conversely, HMGA1 overexpression is not associated to any rearrangement or amplification of the HMGA1 locus. We have first identified micro RNAs (miRNAs) able to target both HMGA1 and HMGA2 messenger RNAs. Then, all of these miRNAs have been found downregulated in pituitary adenomas of different histotypes, compared with normal pituitary. Interestingly, their downregulation was also observed in nonfunctioning pituitary adenomas where HMGA2 overexpression is not associated to any alteration of the HMGA2 locus. Functional studies show that all these HMGA-targeting miRNAs inhibit the proliferation of the rat pituitary adenoma cell line GH3. Therefore, these results indicate that the downregulation of the miRNAs able to target the HMGA genes could contribute to increase HMGA protein levels in human pituitary adenomas, and then to pituitary tumorigenesis.
LinkOut: [PMID: 22139073]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.536 4.2e-3 -0.571 2.2e-3 23 Click to see details
GSE14794 Lymphoblastoid cells -0.196 3.2e-2 -0.179 4.6e-2 90 Click to see details
GSE21032 Prostate cancer -0.197 3.7e-2 -0.116 1.5e-1 83 Click to see details
GSE19350 CNS germ cell tumors -0.507 4.6e-2 -0.420 8.7e-2 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.332 5.2e-2 0.372 3.4e-2 25 Click to see details
GSE19783 ER- ER- breast cancer -0.175 6.1e-2 -0.135 1.2e-1 79 Click to see details
GSE32688 Pancreatic cancer 0.261 7.5e-2 0.324 3.5e-2 32 Click to see details
GSE19536 Breast cancer -0.12 1.2e-1 -0.086 2.0e-1 100 Click to see details
GSE28544 Breast cancer 0.22 1.5e-1 0.512 5.3e-3 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.207 1.6e-1 0.290 8.0e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer 0.226 1.7e-1 0.003 4.9e-1 20 Click to see details
GSE17306 Multiple myeloma 0.126 1.9e-1 0.173 1.2e-1 49 Click to see details
GSE28260 Renal cortex and medulla -0.24 2.1e-1 -0.016 4.8e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.116 2.9e-1 -0.141 2.6e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.112 3.4e-1 0.147 2.9e-1 16 Click to see details
GSE17498 Multiple myeloma -0.051 3.8e-1 0.164 1.6e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.033 4.5e-1 0.179 2.3e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.012 4.6e-1 0.055 3.3e-1 64 Click to see details
GSE38226 Liver fibrosis 0.014 4.8e-1 -0.142 2.7e-1 21 Click to see details
GSE38226 Liver fibrosis 0.014 4.8e-1 -0.142 2.7e-1 21 Click to see details
GSE38226 Liver fibrosis 0.014 4.8e-1 -0.142 2.7e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.267 0.01 -0.255 0.01 84 Click to see details
LUAD 0.516 0.04 0.385 0.11 12 Click to see details
UCEC -0.34 0.08 -0.275 0.13 19 Click to see details
THCA 0.187 0.08 0.153 0.12 59 Click to see details
PCPG 0.909 0.14 1.000 0.5 3 Click to see details
LUSC -0.175 0.15 -0.159 0.17 38 Click to see details
PRAD 0.149 0.15 0.203 0.08 50 Click to see details
CESC -0.721 0.24 -0.500 0.33 3 Click to see details
ESCA 0.175 0.3 0.191 0.29 11 Click to see details
KICH 0.106 0.31 0.236 0.13 25 Click to see details
PAAD 0.343 0.33 0.400 0.3 4 Click to see details
STAD 0.076 0.34 0.147 0.21 32 Click to see details
KIRC -0.048 0.35 -0.109 0.19 68 Click to see details
LIHC 0.035 0.41 -0.006 0.48 49 Click to see details
KIRP -0.04 0.41 -0.097 0.3 32 Click to see details
BLCA 0.045 0.43 0.110 0.33 18 Click to see details
CHOL -0.066 0.43 -0.183 0.32 9 Click to see details
COAD -0.049 0.45 -0.238 0.29 8 Click to see details
HNSC 0.018 0.45 0.021 0.45 42 Click to see details
HNSC 0.018 0.45 0.021 0.45 42 Click to see details
HNSC 0.018 0.45 0.021 0.45 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*