miRTarBase - #MIRT006998 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PURA   
Synonyms MRD31, PUR-ALPHA, PUR1, PURALPHA
Description purine rich element binding protein A
Transcript NM_005859   
Expression
Putative miRNA Targets on PURA
3'UTR of PURA
(miRNA target sites are highlighted)
>PURA|NM_005859|3'UTR
   1 TCAAACTGAATGAAACCCCCACACACACACACATGCATACACACACACACACAGCCACACACACAGAAAATATACTGTAA
  81 AGAAAGAGAGAAAATAAAAAGTTAAAAAGTTAAAAAAAAAAAAAAACCTGTTAACTCCAAGGGAGCACCACCCACAGAAC
 161 CTCCACCAACTGACAGTTTCTCTTCTTGACTTGCCACCCATCGCTGGATGTTGTCCACTTTATCCACCATATAAAACAGT
 241 AAGCAGCTGCTAAAAACAAAAAAAATACAAAAAGTAATAACATTATATGAACTGTGTTTCCTACTTGATTAAAAAATATA
 321 AAGAACTGAGTGTTTATTTCCCTAATTAACCAAGAACTTTTGTACACGTTTAAGCTATTATTATTAAAAAGTGTTTGCAA
 401 AATGGTCAAGATTATAATATTGCTGAATTATATAAAAGTCCTTTTCATGTTGAGCTAACATTTGACTTTAGCACAAAAAA
 481 GAGATATTTTAGAACACGTAAAATAATATTTTTAGTTTTTCTCATTTTGTTACCAAATTTCAAACCTTACATGGAGGTTA
 561 TTATAGTATATTTGACACCCTATATACCTGTGATTAGAGATGTGTATATATATGAGGGCTAGGCATGCTGTGTGTCTGAG
 641 CTTTGTCTAAATGTTATGCAGAAGTTTGTAGAGTTAAAGGTACGTAGGTTTAATTCATGCAAGGTAAACAATAAGTGCTC
 721 TCTTTTATACAATATGCATTGCATCTGGACCTTAAACTTATAAAAATGGTCAGTGAAACTTCTGTGAACATGAAGAAATT
 801 ATTAAAAAAGGCATTTAAATGAAATTTGCTAAGTTGTGATTTTTATGGTTGGAACCAAAGTTATTCAAATAGTAAAAGGA
 881 AAAAGAAAGAAAAAGGAGATCTCCCATAATATTTTTCTGCATCTGTTTGCTTTGACTGAGTAGGCGTTTTGTCATTATTG
 961 TGTATATGAGATGTACTTGTATCGTTCATAATATATTTTTTTTATTATGTGTAGAAAGATTTTAAAAAACTAACGTGCAG
1041 CAATTTCCAGTGAACCTGTACTTGGACATCAGGTAGTGAGTCTATTTGTGGTCACTAGCACTGTCTCCTAAACTTGTAAG
1121 AGGTCTGAAGCTATTCTTTGATTTTTGCTAGTGCTATTAACTTATGTAGACCTGTTAAAAAGCAGAGCAACACAATTATA
1201 GTTATCCTACTGAGCCATGGATTCTGAGTTTTGTTTTAAAAGTGAAAGCCAAGTTGGTGTATGTAAAGGATTTCCATGTA
1281 GCTGTGGTGCTAGTTATTACTGGCTACATTATATGCTAAGTGTATTTGTGTTCCCCAAGTGTACAAGCCTTCTATCAAAA
1361 GTATGTTCTATAACTCATATATTCAAGGTGTAGGGTATGAAAATGCAAAGTTTAGGAGAGCACTTTACCAAGCTGGTGTC
1441 CTCCAAACTGAAATTGTTTGTAACGATAGTCTTTTACAGGTTTTCCTTTAAAGATGTTTGTGTGCTTTTAATTGACAACT
1521 AACTTCTTGCTGCTGTATAGTAAAATATTAATATATTTTTATCATTAAACTGCTGCATGACTATCATCTTTGAGTGAAGA
1601 GAAAATGTTATAAAAAAGATGCCTTAAACAGTACATTTTGGTTTGGAATTCTGTAGAAAGTATTTTGGTAAAAAAAAAAA
1681 AAAAAAAAAAGGGTCTTGTCTGACAGAGAGTTCTGGGGATGGAATTGTTTCTTGGCAAATCCAGCCATATAGATCTAACT
1761 GCTGTATGTATAAGACACCACCTGTAGGAGCGGGAAGGTATCAGTGCTTCTTATATTGTAAAGCATTGGCCTAGGAAGGC
1841 AAACAGTTGTCTTTTTGAAGGATTTTTTTCTGCTGGTCCTTTGGGTTTTGATTTGATATTTTTATGCTCCCTGGTTGAGT
1921 GTGTTGTCTTCGTTTTTGAGATCTACTGTATGTGTTGAATAACAAGCTATTTTCATTGTACTGTGCATTTTCCCATTAAA
2001 TTGTTTGCTTTTAATATTCAATGTTAAATATGAGGTGACCGTACAGTAGTTAGGAGTTTCTTTACTTACAAAATCACTGG
2081 AAATGATTAAATTGCTTTTCCCCCTCCCCAGAGGTGCATTTTTCTTATTTCCATATAGTAAAGTTGAGCTTTTACAGTGC
2161 ATAATGTGACATTTGGAATGCTTATCAACTGCATGTAAACATTAATAACCTGCACTTTTTTGTCTTAAGGTTTGTTGAGC
2241 TGTTTTGTTCACTGTACTTTAACTGTGATATGGAAAAGACTGCATTCTCTGTGCTGTTACTAATTAGGAAAGAGAATTGC
2321 TTTGATTTTGTCTCTTGTTTACTATAGCTTCTTAAAGTTAAGCCTTGTACTACAGGTTGTTGGAGTACTCCTAGATCACT
2401 GTTTCATAGTAGCCAGCAATAAGTAGTGCAAGTCAACAAAAACACAGCAAACTTAGGCAAAGTGTCCTTTCTTTGAGATG
2481 CGAGTTCTTTCATGAGGTTTTCTTTAGGGCCAGAGTTACCTAAAGTGAAGCCTTTCTTATCTATAGACTTCAGATTCTGC
2561 TTGGAATCCCACCGGCTCAAGAAGCACATGTATTGTGCAATTAATTGTCTTTACACTAAAACAGTTTAATACAATCTAAC
2641 TACGATTTTGAAACCAGTGTCTGATTTATGGTCAGTGGGTTTAAAAAGAAATCCACATGCAGATCTTTTAAGACTTAAAA
2721 AGTGATCATAGAAAAGACTAAGTGACTGTAAAGATGCTCTTTTTTTAAGCATCTCACTTTACCTCCCCAAGCACCCTCCC
2801 AAACCTTGTCTTCCCTCTTCTGTTGCATCCTTTCCCTACCCTTCCCTCCCAGGTGCTCGGTACTTTACCTAGTTTCTATA
2881 TATCAGTGTTTTATGTTGGAATTTTTCCTTGTTTTTATTTTACTAGTTGGTAAACCCTGTTTATGCTGAAACAAATAAGG
2961 AAATGGTATATTTGACCATATGTGTTATTCATAGAAGACAGTATGATCAAATGTGCCAAAAACAAGCAAACAAAACTTAA
3041 TTCCTGAGAAGTATGCCTTATTTTTATTGATCTGCTTTGTCTTACAATTAAGGTCCAAGAGCTTGGTTAAACTGTATTAT
3121 TTGCCTAAGTATAAAAGAAAACTTGAACTGCATTGCAATATTGACGTTCTTTAAAATGAGAGACACTGTCAAGTAATTTA
3201 ATCCAGAGATCAGCCACCAGATTTGAAATGCTTATGTATGTGTGTGTGTTTGGAGTTGTTTTTTTCTTTTAAATCACCAA
3281 ATTTTTTTTAAGCTACTTTTTATTTGTGCCTCCTATTTATCATGCTGATGTTAGAAGCAGCAGTCATCCAGCCACAGAGG
3361 GAGCTAAAGTTAACTAACCAGAACTGTAGAAATCATTATACATGCCTTTGACAACAAAGGAAGTTCATAAGAAAAGCCAT
3441 GTCGGCTTTTCCTCTACTAGATACAGATTGGAGGTAGATGAATATTTGCCAAATGGAAAAAAAGACAATGCTAGTCAGAA
3521 AAGACAAACTGTTTTCCAGCTTCTCAAAAAGCCATGGAGAGTAGAAACCAAAACCAACAGGGAAATAAAAAACCTTGAAA
3601 GTCTCACTTTCTAGTTGTCCCATGCAGGGGTTGAAATTTGATTCCAAGCGGAAAGTATATTATGTTTTTTCAGGCCTTCA
3681 CATCTAGAGAGATGGATAACTTCCAATTTGATTTTTCAGGTAATAGAGAAAGCTGCTAGTAATTTTAACCCCTGCCTAAA
3761 GAAGACATATACTTCATTTGGGAGCAAATACTTATTGCCTTGAAAAGTAGCACTGTAATAGCCTATGATAATTAGTTGTA
3841 GAATAACCTTTATCCCTTTCAAACTATGCAAATTATTAAATAAGTGTAAATTAGGATTCAATTAAAGATAGTTGATTATA
3921 TTGCAATCAGATGGCATTCACAAACTTAACTGGAGCATATACAAATATATTAGTCTAAGTTTTGTATGCTAACAGAAAGA
4001 TATAATTTAGCTACCTATTCTAAAAATGGTGAATATTATTAATATTGTATAATAGGAGTGGGAAGACTGCCTCCTTTTTT
4081 GAAGAGAGAGATTAAGGATTTTTATAATTGTTTTTCATCAAATTTTAATATTTTTGTCAAATTTTTAGGTATTTAATTTG
4161 TAAAACAGTTTGCTTTGTACTGGCATACAGAAAATAGGGTATTGATTTTAAACTTTTTGAAGCCAAGTGATCAAGTACAT
4241 TTGTAATAAAAGTCAATGGATCTATAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGU--AAUACACGACGAu 5'
              |||:|  || | ||||||| 
Target 5' tgacAACTAACTTCT-TGCTGCTg 3'
1513 - 1535 155.00 -12.20
2
miRNA  3' gugUUUG--GUA--AUACACGACGAu 5'
             |:||  |||  | |||||||:| 
Target 5' aaaAGACTGCATTCTCTGTGCTGTTa 3'
2274 - 2299 147.00 -14.10
3
miRNA  3' guguuUGGUAA-UACACGACGau 5'
               |:|||| |  ||||||  
Target 5' tttttATCATTAAACTGCTGCat 3'
1556 - 1578 137.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16161736 5 COSMIC
COSN5069796 7 COSMIC
COSN15626037 20 COSMIC
COSN30126436 20 COSMIC
COSN23012833 34 COSMIC
COSN30170429 53 COSMIC
COSN17153512 55 COSMIC
COSN30114215 91 COSMIC
COSN32061233 127 COSMIC
COSN30526904 207 COSMIC
COSN30531799 236 COSMIC
COSN23012834 266 COSMIC
COSN17037959 288 COSMIC
COSN30135011 326 COSMIC
COSN30114411 355 COSMIC
COSN30120073 376 COSMIC
COSN30142446 383 COSMIC
COSN15626038 442 COSMIC
COSN30140736 442 COSMIC
COSN30125231 457 COSMIC
COSN30159382 624 COSMIC
COSN30126105 684 COSMIC
COSN29461459 740 COSMIC
COSN30174228 749 COSMIC
COSN29462313 759 COSMIC
COSN30120273 805 COSMIC
COSN30512615 833 COSMIC
COSN31485559 842 COSMIC
COSN30137650 1035 COSMIC
COSN30531687 1115 COSMIC
COSN31571626 1137 COSMIC
COSN30511177 1265 COSMIC
COSN15626039 1357 COSMIC
COSN20101897 1442 COSMIC
COSN26958422 1449 COSMIC
COSN30173993 1466 COSMIC
COSN5069798 2303 COSMIC
COSN26562470 2384 COSMIC
COSN8491939 2457 COSMIC
COSN9408241 2533 COSMIC
COSN24301180 2692 COSMIC
COSN8204121 2750 COSMIC
COSN7877351 2759 COSMIC
COSN26958423 2771 COSMIC
COSN27572241 2805 COSMIC
COSN15626040 2908 COSMIC
COSN22282956 3390 COSMIC
COSN15626041 3534 COSMIC
COSN6865182 3586 COSMIC
COSN15626042 3700 COSMIC
COSN29631249 3707 COSMIC
COSN5590498 3714 COSMIC
COSN29396221 4313 COSMIC
COSN9927027 4462 COSMIC
COSN20139556 4463 COSMIC
COSN9408243 5474 COSMIC
COSN4843855 5531 COSMIC
COSN26649674 5600 COSMIC
COSN26553114 5631 COSMIC
COSN20849985 5952 COSMIC
COSN21576577 5974 COSMIC
COSN26644006 6383 COSMIC
COSN28674756 6413 COSMIC
COSN7877352 6563 COSMIC
COSN28685002 6633 COSMIC
COSN8491940 6633 COSMIC
COSN27092643 6710 COSMIC
COSN28686172 6747 COSMIC
COSN8491941 6747 COSMIC
COSN17546076 7116 COSMIC
COSN27869374 7153 COSMIC
COSN19432218 7195 COSMIC
COSN2072950 7569 COSMIC
COSN30070785 7647 COSMIC
COSN2072951 7880 COSMIC
COSN26291776 8022 COSMIC
COSN26958424 8119 COSMIC
COSN26640775 8218 COSMIC
COSN8204122 8898 COSMIC
COSN26958425 8983 COSMIC
COSN15914818 9040 COSMIC
COSN26556236 9123 COSMIC
COSN5590499 9204 COSMIC
COSN25713717 9393 COSMIC
COSN22537887 9679 COSMIC
COSN26958426 9804 COSMIC
COSN15624552 9868 COSMIC
COSN28648804 9869 COSMIC
COSN26573976 9909 COSMIC
COSN17855061 9941 COSMIC
COSN15624553 10342 COSMIC
COSN15624554 10463 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778185033 9 dbSNP
rs796621978 11 dbSNP
rs772449984 16 dbSNP
rs1054922771 19 dbSNP
rs1024411866 20 dbSNP
rs574050232 20 dbSNP
rs745382368 20 dbSNP
rs771576763 20 dbSNP
rs780262946 20 dbSNP
rs942393648 20 dbSNP
rs1366397450 21 dbSNP
rs771630896 21 dbSNP
rs200742171 22 dbSNP
rs769290329 33 dbSNP
rs1250913993 35 dbSNP
rs1490849383 35 dbSNP
rs1292617827 36 dbSNP
rs1209367415 39 dbSNP
rs1350265427 39 dbSNP
rs144048243 39 dbSNP
rs762634132 39 dbSNP
rs768154435 39 dbSNP
rs1367443738 42 dbSNP
rs1405012102 45 dbSNP
rs763365149 48 dbSNP
rs1343219414 52 dbSNP
rs1443961599 53 dbSNP
rs1416600971 61 dbSNP
rs1331631003 62 dbSNP
rs1407326113 64 dbSNP
rs746975346 67 dbSNP
rs1388120073 83 dbSNP
rs1454061557 85 dbSNP
rs899276346 85 dbSNP
rs1410998726 87 dbSNP
rs1156796835 91 dbSNP
rs1481363755 92 dbSNP
rs1198239824 95 dbSNP
rs1269567671 95 dbSNP
rs955089941 96 dbSNP
rs1264047103 97 dbSNP
rs1012315079 98 dbSNP
rs1227437478 99 dbSNP
rs987657083 102 dbSNP
rs1225781507 108 dbSNP
rs1303808135 110 dbSNP
rs1003422875 112 dbSNP
rs112796901 112 dbSNP
rs1274839189 112 dbSNP
rs1318259184 112 dbSNP
rs80110625 112 dbSNP
rs869247127 112 dbSNP
rs906536685 112 dbSNP
rs1470871211 115 dbSNP
rs1429888484 116 dbSNP
rs1030835185 121 dbSNP
rs1217335740 123 dbSNP
rs752346793 124 dbSNP
rs1172213479 125 dbSNP
rs956584120 126 dbSNP
rs1277818682 127 dbSNP
rs1246496191 128 dbSNP
rs544738308 129 dbSNP
rs1216561211 133 dbSNP
rs1250176366 137 dbSNP
rs1463675196 138 dbSNP
rs1278457461 141 dbSNP
rs1218014063 143 dbSNP
rs1188343814 144 dbSNP
rs1396000663 146 dbSNP
rs1228548119 149 dbSNP
rs1479206811 150 dbSNP
rs1032661267 156 dbSNP
rs1011126678 158 dbSNP
rs1454323576 168 dbSNP
rs1359527671 177 dbSNP
rs1333380369 179 dbSNP
rs953941506 183 dbSNP
rs562691090 184 dbSNP
rs1398602489 186 dbSNP
rs1171401945 188 dbSNP
rs1169299402 192 dbSNP
rs755577217 209 dbSNP
rs1400827138 214 dbSNP
rs1388491233 216 dbSNP
rs1321926278 219 dbSNP
rs985698836 231 dbSNP
rs912363430 232 dbSNP
rs966112755 238 dbSNP
rs1237289854 255 dbSNP
rs1433821341 258 dbSNP
rs976112592 261 dbSNP
rs533372878 277 dbSNP
rs545287968 292 dbSNP
rs1205236164 293 dbSNP
rs1332675348 293 dbSNP
rs964155460 316 dbSNP
rs560460712 320 dbSNP
rs1434012434 321 dbSNP
rs1274233514 327 dbSNP
rs1351270737 331 dbSNP
rs975156205 335 dbSNP
rs1283353728 347 dbSNP
rs1445639004 348 dbSNP
rs922294415 351 dbSNP
rs1308578150 356 dbSNP
rs527621243 358 dbSNP
rs548898261 363 dbSNP
rs919281751 366 dbSNP
rs768380068 376 dbSNP
rs1413394251 381 dbSNP
rs567503270 384 dbSNP
rs1208418630 386 dbSNP
rs929294879 393 dbSNP
rs1180474019 397 dbSNP
rs531261264 401 dbSNP
rs1233903098 407 dbSNP
rs1182092063 408 dbSNP
rs189201459 409 dbSNP
rs940942081 410 dbSNP
rs1224130177 417 dbSNP
rs759820133 421 dbSNP
rs1288780427 424 dbSNP
rs1055711451 427 dbSNP
rs1352580376 429 dbSNP
rs1288867712 442 dbSNP
rs1409159697 443 dbSNP
rs570877689 453 dbSNP
rs1348611991 456 dbSNP
rs1305000212 458 dbSNP
rs920771098 460 dbSNP
rs538269703 470 dbSNP
rs1160758486 471 dbSNP
rs896629209 477 dbSNP
rs371233781 479 dbSNP
rs1162963449 480 dbSNP
rs1402733284 483 dbSNP
rs1413197212 484 dbSNP
rs1456240896 498 dbSNP
rs1471881981 498 dbSNP
rs769455484 499 dbSNP
rs878876017 526 dbSNP
rs1392405462 542 dbSNP
rs1192420209 547 dbSNP
rs1384901273 549 dbSNP
rs906546296 551 dbSNP
rs1218970045 557 dbSNP
rs752853873 562 dbSNP
rs902210444 565 dbSNP
rs1000933342 569 dbSNP
rs1268502816 570 dbSNP
rs1336300227 574 dbSNP
rs1052376244 579 dbSNP
rs1031967464 580 dbSNP
rs778171102 581 dbSNP
rs1010802824 583 dbSNP
rs553378671 585 dbSNP
rs1291958991 589 dbSNP
rs1006778597 593 dbSNP
rs1411514779 605 dbSNP
rs1433178472 607 dbSNP
rs1389720388 610 dbSNP
rs1019882680 625 dbSNP
rs1022585161 628 dbSNP
rs1286374954 629 dbSNP
rs1348771934 630 dbSNP
rs965162808 640 dbSNP
rs1227842827 654 dbSNP
rs976164871 668 dbSNP
rs996604336 674 dbSNP
rs1029396326 685 dbSNP
rs1208457679 691 dbSNP
rs1465951638 694 dbSNP
rs1289536525 706 dbSNP
rs1026347372 707 dbSNP
rs1207863737 707 dbSNP
rs982476746 710 dbSNP
rs1257621548 712 dbSNP
rs950760491 724 dbSNP
rs1210762956 729 dbSNP
rs1185053892 730 dbSNP
rs1250228630 735 dbSNP
rs1472006262 737 dbSNP
rs1188006731 751 dbSNP
rs985199846 762 dbSNP
rs908185557 771 dbSNP
rs1366189938 805 dbSNP
rs1456016399 811 dbSNP
rs1297165112 827 dbSNP
rs1433267240 829 dbSNP
rs566807281 847 dbSNP
rs938278249 848 dbSNP
rs1397031853 853 dbSNP
rs991064316 857 dbSNP
rs1303888872 865 dbSNP
rs1465962068 867 dbSNP
rs1357969403 869 dbSNP
rs1173339921 871 dbSNP
rs1431386891 871 dbSNP
rs973674006 876 dbSNP
rs1306160078 877 dbSNP
rs920769179 877 dbSNP
rs1369845323 881 dbSNP
rs1409327008 882 dbSNP
rs781744624 886 dbSNP
rs1200871777 895 dbSNP
rs1482866870 910 dbSNP
rs948183787 917 dbSNP
rs1207314414 920 dbSNP
rs757111493 924 dbSNP
rs1313472071 927 dbSNP
rs1274146564 930 dbSNP
rs1342502723 931 dbSNP
rs1226494709 933 dbSNP
rs918113711 938 dbSNP
rs1385323645 943 dbSNP
rs949520387 965 dbSNP
rs1283811287 971 dbSNP
rs1042196499 972 dbSNP
rs534549352 974 dbSNP
rs1300431263 976 dbSNP
rs1343383388 978 dbSNP
rs1370668958 979 dbSNP
rs928023775 980 dbSNP
rs555678787 985 dbSNP
rs574177850 986 dbSNP
rs537910096 990 dbSNP
rs879837420 993 dbSNP
rs1253914140 994 dbSNP
rs1200555086 995 dbSNP
rs1043614961 996 dbSNP
rs946657944 996 dbSNP
rs556707967 1007 dbSNP
rs578049483 1008 dbSNP
rs1266321117 1010 dbSNP
rs545406631 1024 dbSNP
rs560514319 1035 dbSNP
rs143262149 1036 dbSNP
rs1007240376 1040 dbSNP
rs1240381453 1055 dbSNP
rs890905239 1062 dbSNP
rs750233689 1066 dbSNP
rs1290712305 1076 dbSNP
rs867123815 1083 dbSNP
rs1350463493 1101 dbSNP
rs1306839246 1102 dbSNP
rs1019474408 1103 dbSNP
rs1392364361 1113 dbSNP
rs758337061 1118 dbSNP
rs901046553 1123 dbSNP
rs1457186840 1126 dbSNP
rs780006588 1131 dbSNP
rs578062907 1134 dbSNP
rs1027881888 1142 dbSNP
rs1251078074 1152 dbSNP
rs950813238 1157 dbSNP
rs781743432 1166 dbSNP
rs1354916332 1173 dbSNP
rs1209502072 1179 dbSNP
rs77987489 1183 dbSNP
rs1369901150 1200 dbSNP
rs1435201005 1205 dbSNP
rs1303502106 1206 dbSNP
rs928118615 1208 dbSNP
rs1287067137 1221 dbSNP
rs939474341 1249 dbSNP
rs554215585 1252 dbSNP
rs1332353635 1254 dbSNP
rs988232936 1259 dbSNP
rs913898485 1262 dbSNP
rs946698439 1269 dbSNP
rs1322292903 1277 dbSNP
rs180729389 1281 dbSNP
rs1411069181 1313 dbSNP
rs1156862302 1315 dbSNP
rs1479025361 1316 dbSNP
rs1378302105 1317 dbSNP
rs1333810549 1321 dbSNP
rs959383171 1336 dbSNP
rs991508027 1339 dbSNP
rs918166168 1341 dbSNP
rs1209732420 1344 dbSNP
rs768382923 1350 dbSNP
rs549584071 1351 dbSNP
rs1266740670 1355 dbSNP
rs1050955110 1359 dbSNP
rs1366162714 1371 dbSNP
rs1231112867 1373 dbSNP
rs1295794323 1375 dbSNP
rs564616881 1379 dbSNP
rs1274893380 1381 dbSNP
rs1342090649 1382 dbSNP
rs1368320968 1386 dbSNP
rs1234689963 1395 dbSNP
rs187294870 1407 dbSNP
rs1435458143 1409 dbSNP
rs1004378802 1410 dbSNP
rs1482017486 1421 dbSNP
rs192403370 1427 dbSNP
rs5871723 1440 dbSNP
rs543039715 1447 dbSNP
rs1402868076 1455 dbSNP
rs1172059466 1462 dbSNP
rs765875738 1465 dbSNP
rs936436279 1478 dbSNP
rs1389251454 1508 dbSNP
rs181887421 1515 dbSNP
rs1022573914 1517 dbSNP
rs1178214033 1522 dbSNP
rs1053520568 1525 dbSNP
rs1452947303 1545 dbSNP
rs778493656 1546 dbSNP
rs1199332247 1553 dbSNP
rs910905729 1559 dbSNP
rs942370993 1561 dbSNP
rs1175750899 1567 dbSNP
rs1389689156 1570 dbSNP
rs1364070546 1575 dbSNP
rs1268165417 1576 dbSNP
rs1437472261 1579 dbSNP
rs1040978198 1584 dbSNP
rs1333442774 1587 dbSNP
rs1364997885 1591 dbSNP
rs1372517041 1608 dbSNP
rs1169364771 1611 dbSNP
rs1429319839 1612 dbSNP
rs1417720752 1618 dbSNP
rs1165352100 1636 dbSNP
rs980984268 1641 dbSNP
rs1237346496 1652 dbSNP
rs1186085804 1656 dbSNP
rs369376929 1667 dbSNP
rs1387687938 1669 dbSNP
rs1253316532 1670 dbSNP
rs1283478787 1670 dbSNP
rs1356790511 1670 dbSNP
rs1484375690 1670 dbSNP
rs199790744 1670 dbSNP
rs879198655 1670 dbSNP
rs901102187 1671 dbSNP
rs1035183783 1687 dbSNP
rs1300721299 1691 dbSNP
rs1304103259 1691 dbSNP
rs960826096 1692 dbSNP
rs1352923109 1693 dbSNP
rs1019525926 1699 dbSNP
rs1325780536 1701 dbSNP
rs1406281646 1705 dbSNP
rs988633115 1705 dbSNP
rs1231923232 1715 dbSNP
rs994013516 1716 dbSNP
rs1163283536 1719 dbSNP
rs1268146026 1734 dbSNP
rs1330781483 1735 dbSNP
rs1206503923 1750 dbSNP
rs913960223 1759 dbSNP
rs1182246812 1763 dbSNP
rs1046896289 1766 dbSNP
rs1230749590 1779 dbSNP
rs1488710388 1785 dbSNP
rs1223348858 1789 dbSNP
rs1192673755 1792 dbSNP
rs534177858 1793 dbSNP
rs374539293 1798 dbSNP
rs1331117338 1810 dbSNP
rs1006741184 1815 dbSNP
rs146813175 1816 dbSNP
rs1288925973 1824 dbSNP
rs1227791419 1827 dbSNP
rs1432477294 1830 dbSNP
rs1175812943 1836 dbSNP
rs1371319419 1839 dbSNP
rs1016338003 1845 dbSNP
rs1295454767 1852 dbSNP
rs932589341 1863 dbSNP
rs959671672 1863 dbSNP
rs1412712678 1874 dbSNP
rs1324298060 1886 dbSNP
rs1459204528 1894 dbSNP
rs1012253181 1901 dbSNP
rs1024944419 1905 dbSNP
rs1389940975 1908 dbSNP
rs1050967605 1914 dbSNP
rs1417958726 1923 dbSNP
rs567724316 1932 dbSNP
rs1157280278 1933 dbSNP
rs1344798816 1941 dbSNP
rs978315140 1946 dbSNP
rs1478151554 1996 dbSNP
rs1458764890 1998 dbSNP
rs1252059570 2009 dbSNP
rs538453906 2013 dbSNP
rs1466092335 2021 dbSNP
rs747742319 2022 dbSNP
rs1315105803 2029 dbSNP
rs958216623 2032 dbSNP
rs140630230 2041 dbSNP
rs1367154481 2042 dbSNP
rs1301536847 2046 dbSNP
rs1437636856 2048 dbSNP
rs1037200381 2049 dbSNP
rs1351859386 2052 dbSNP
rs898271734 2061 dbSNP
rs910970141 2065 dbSNP
rs761280707 2072 dbSNP
rs1044079385 2073 dbSNP
rs532452759 2081 dbSNP
rs1394032888 2092 dbSNP
rs578138513 2107 dbSNP
rs922244069 2113 dbSNP
rs1223521506 2123 dbSNP
rs1263395395 2127 dbSNP
rs539182829 2129 dbSNP
rs1488119320 2131 dbSNP
rs1002416512 2132 dbSNP
rs929915198 2134 dbSNP
rs1248383793 2141 dbSNP
rs1035193833 2162 dbSNP
rs961176786 2168 dbSNP
rs1009767833 2169 dbSNP
rs763454245 2171 dbSNP
rs1253858614 2183 dbSNP
rs888306588 2186 dbSNP
rs1005376948 2191 dbSNP
rs1278407478 2201 dbSNP
rs1230914752 2202 dbSNP
rs968201659 2207 dbSNP
rs1407562802 2224 dbSNP
rs979506455 2225 dbSNP
rs1381906142 2226 dbSNP
rs1038231661 2230 dbSNP
rs1303943752 2231 dbSNP
rs1424559890 2244 dbSNP
rs1374348280 2254 dbSNP
rs921273865 2256 dbSNP
rs1167362992 2261 dbSNP
rs1171259128 2264 dbSNP
rs771230223 2265 dbSNP
rs1390472564 2268 dbSNP
rs1169465487 2272 dbSNP
rs1426528124 2283 dbSNP
rs1258100697 2285 dbSNP
rs986734760 2288 dbSNP
rs1485356860 2289 dbSNP
rs1255453358 2298 dbSNP
rs1207467336 2315 dbSNP
rs1343124774 2335 dbSNP
rs764487384 2344 dbSNP
rs1250982902 2348 dbSNP
rs1012307451 2356 dbSNP
rs1024998171 2358 dbSNP
rs774721162 2375 dbSNP
rs939918494 2376 dbSNP
rs1314005291 2382 dbSNP
rs1228233086 2385 dbSNP
rs1354155285 2387 dbSNP
rs1036890953 2395 dbSNP
rs1411183838 2403 dbSNP
rs919751823 2405 dbSNP
rs1297255868 2420 dbSNP
rs1460241243 2425 dbSNP
rs1369999119 2440 dbSNP
rs931109799 2448 dbSNP
rs1309217643 2451 dbSNP
rs1474838530 2459 dbSNP
rs1415661000 2468 dbSNP
rs970698615 2482 dbSNP
rs554162526 2483 dbSNP
rs905536823 2492 dbSNP
rs1489618903 2493 dbSNP
rs1266373909 2499 dbSNP
rs1233125853 2500 dbSNP
rs1278393891 2503 dbSNP
rs1290765151 2506 dbSNP
rs1002468953 2513 dbSNP
rs1335866521 2514 dbSNP
rs1305787749 2516 dbSNP
rs999805175 2518 dbSNP
rs186263269 2532 dbSNP
rs896760254 2536 dbSNP
rs1310129538 2542 dbSNP
rs1460742278 2542 dbSNP
rs1010232999 2544 dbSNP
rs1320945653 2544 dbSNP
rs1161328125 2545 dbSNP
rs1031242812 2547 dbSNP
rs958486037 2554 dbSNP
rs1472933044 2557 dbSNP
rs1363284705 2561 dbSNP
rs1179800665 2564 dbSNP
rs989665519 2569 dbSNP
rs1018826740 2571 dbSNP
rs963844057 2573 dbSNP
rs976449599 2574 dbSNP
rs922297973 2575 dbSNP
rs572416255 2579 dbSNP
rs1482005447 2585 dbSNP
rs982698459 2590 dbSNP
rs771618814 2599 dbSNP
rs1203131758 2616 dbSNP
rs909799503 2619 dbSNP
rs1232310636 2623 dbSNP
rs542525621 2630 dbSNP
rs1183879968 2635 dbSNP
rs1236328319 2637 dbSNP
rs1332409666 2637 dbSNP
rs78410921 2639 dbSNP
rs1444442654 2645 dbSNP
rs1368549613 2655 dbSNP
rs954041554 2656 dbSNP
rs894275246 2657 dbSNP
rs948142005 2658 dbSNP
rs1384252069 2662 dbSNP
rs1046503220 2669 dbSNP
rs576289178 2672 dbSNP
rs543585958 2674 dbSNP
rs757506249 2698 dbSNP
rs999522636 2701 dbSNP
rs1193272428 2702 dbSNP
rs564776211 2704 dbSNP
rs545612199 2714 dbSNP
rs1359301863 2720 dbSNP
rs1189655611 2726 dbSNP
rs1446922954 2729 dbSNP
rs1449566536 2733 dbSNP
rs1300760012 2734 dbSNP
rs767820709 2735 dbSNP
rs1346544573 2737 dbSNP
rs1031379376 2740 dbSNP
rs1280543715 2744 dbSNP
rs894063920 2754 dbSNP
rs116936473 2755 dbSNP
rs1018465152 2758 dbSNP
rs1345349877 2759 dbSNP
rs538363823 2760 dbSNP
rs1299476068 2763 dbSNP
rs1431274830 2771 dbSNP
rs1325722420 2772 dbSNP
rs1316133251 2778 dbSNP
rs964164517 2786 dbSNP
rs1397814691 2799 dbSNP
rs919775283 2800 dbSNP
rs976502051 2805 dbSNP
rs931099039 2809 dbSNP
rs547090001 2812 dbSNP
rs565310435 2816 dbSNP
rs1392328297 2817 dbSNP
rs1279234748 2823 dbSNP
rs1169559807 2828 dbSNP
rs865957785 2837 dbSNP
rs1443122143 2843 dbSNP
rs951090781 2852 dbSNP
rs1190252015 2854 dbSNP
rs529708511 2860 dbSNP
rs1209615842 2867 dbSNP
rs1257570683 2867 dbSNP
rs1484479887 2869 dbSNP
rs2013169 2871 dbSNP
rs1214870261 2872 dbSNP
rs941305605 2879 dbSNP
rs1056765861 2884 dbSNP
rs1460998858 2885 dbSNP
rs1246870334 2886 dbSNP
rs891450960 2887 dbSNP
rs1312344332 2889 dbSNP
rs567925709 2917 dbSNP
rs765264099 2921 dbSNP
rs1448042126 2922 dbSNP
rs1329831717 2923 dbSNP
rs1167904180 2929 dbSNP
rs1409701985 2930 dbSNP
rs1426449934 2930 dbSNP
rs1415714540 2936 dbSNP
rs1417789472 2939 dbSNP
rs1173284309 2942 dbSNP
rs1475819771 2953 dbSNP
rs1417850756 2955 dbSNP
rs546275169 2957 dbSNP
rs562883219 2959 dbSNP
rs1404918143 2975 dbSNP
rs750321781 2978 dbSNP
rs1046554273 2979 dbSNP
rs1204801144 2980 dbSNP
rs1436913298 2993 dbSNP
rs2454636 2999 dbSNP
rs1042995302 3000 dbSNP
rs904039495 3008 dbSNP
rs1335375972 3012 dbSNP
rs1001006359 3014 dbSNP
rs1352431864 3018 dbSNP
rs1362844250 3020 dbSNP
rs1028481622 3021 dbSNP
rs758491577 3027 dbSNP
rs1429745402 3028 dbSNP
rs1275403942 3033 dbSNP
rs79505459 3036 dbSNP
rs1008313295 3038 dbSNP
rs1394300779 3044 dbSNP
rs571873741 3056 dbSNP
rs540684711 3057 dbSNP
rs1163437367 3081 dbSNP
rs1221035678 3087 dbSNP
rs1473909176 3097 dbSNP
rs1261270901 3105 dbSNP
rs1323093802 3122 dbSNP
rs1019645999 3127 dbSNP
rs1052461180 3132 dbSNP
rs1230878022 3137 dbSNP
rs1200658188 3138 dbSNP
rs1468776577 3142 dbSNP
rs1272421083 3143 dbSNP
rs972675780 3152 dbSNP
rs1331195688 3154 dbSNP
rs1209668737 3159 dbSNP
rs1027291882 3165 dbSNP
rs1371389126 3166 dbSNP
rs115129982 3167 dbSNP
rs1011183346 3169 dbSNP
rs1370740436 3173 dbSNP
rs190631705 3175 dbSNP
rs1459256415 3211 dbSNP
rs1192874043 3231 dbSNP
rs1159176193 3236 dbSNP
rs1247826031 3239 dbSNP
rs1018931551 3243 dbSNP
rs754560969 3245 dbSNP
rs1399628340 3247 dbSNP
rs1405296618 3247 dbSNP
rs1175152303 3252 dbSNP
rs1454481224 3257 dbSNP
rs1479258229 3265 dbSNP
rs1191590799 3268 dbSNP
rs1486801869 3282 dbSNP
rs927127991 3282 dbSNP
rs1428075195 3283 dbSNP
rs1315230205 3296 dbSNP
rs938470526 3303 dbSNP
rs1235265784 3305 dbSNP
rs1347475738 3306 dbSNP
rs1457303086 3309 dbSNP
rs1160993344 3314 dbSNP
rs900044400 3322 dbSNP
rs565909180 3323 dbSNP
rs912902356 3324 dbSNP
rs1429357298 3329 dbSNP
rs1399922561 3351 dbSNP
rs1029747414 3353 dbSNP
rs529691637 3355 dbSNP
rs1175020364 3360 dbSNP
rs138696672 3383 dbSNP
rs1042658979 3386 dbSNP
rs904133349 3390 dbSNP
rs1430091239 3395 dbSNP
rs1420089041 3396 dbSNP
rs2291877 3400 dbSNP
rs1484878376 3403 dbSNP
rs1016623754 3411 dbSNP
rs1211771943 3416 dbSNP
rs1485459777 3428 dbSNP
rs1278471557 3429 dbSNP
rs962678817 3432 dbSNP
rs1308471186 3437 dbSNP
rs1295373994 3439 dbSNP
rs1049959394 3441 dbSNP
rs1382050889 3444 dbSNP
rs1345029034 3445 dbSNP
rs991455422 3446 dbSNP
rs1374404892 3454 dbSNP
rs549504210 3455 dbSNP
rs1348746983 3459 dbSNP
rs1204933139 3461 dbSNP
rs755583917 3464 dbSNP
rs981279327 3480 dbSNP
rs1426655273 3492 dbSNP
rs1420007242 3498 dbSNP
rs1188673406 3499 dbSNP
rs924409989 3507 dbSNP
rs1255619999 3509 dbSNP
rs1453683385 3511 dbSNP
rs935448612 3512 dbSNP
rs1481105271 3517 dbSNP
rs1052931165 3528 dbSNP
rs1251103024 3530 dbSNP
rs200391506 3532 dbSNP
rs915274967 3535 dbSNP
rs1268777917 3547 dbSNP
rs1294454331 3550 dbSNP
rs946700752 3560 dbSNP
rs1001400373 3564 dbSNP
rs1354289596 3579 dbSNP
rs1290953124 3584 dbSNP
rs1034154219 3599 dbSNP
rs1409334338 3615 dbSNP
rs1039998089 3621 dbSNP
rs1469255365 3625 dbSNP
rs1163625541 3627 dbSNP
rs1392697197 3634 dbSNP
rs900098316 3638 dbSNP
rs992611696 3646 dbSNP
rs150379540 3649 dbSNP
rs1051219901 3650 dbSNP
rs182696283 3651 dbSNP
rs1410540901 3652 dbSNP
rs1214922545 3656 dbSNP
rs1419883512 3660 dbSNP
rs777276601 3665 dbSNP
rs1290229213 3667 dbSNP
rs576634194 3672 dbSNP
rs1470137299 3674 dbSNP
rs1274304766 3681 dbSNP
rs936939499 3693 dbSNP
rs188104194 3696 dbSNP
rs1240628602 3700 dbSNP
rs1335919887 3701 dbSNP
rs1305857420 3706 dbSNP
rs1049969167 3707 dbSNP
rs1372938142 3710 dbSNP
rs1326380598 3725 dbSNP
rs1017085178 3749 dbSNP
rs962442891 3751 dbSNP
rs1392274938 3756 dbSNP
rs1012999817 3759 dbSNP
rs1160317253 3767 dbSNP
rs1022603410 3771 dbSNP
rs971316092 3785 dbSNP
rs911395693 3791 dbSNP
rs1284991241 3794 dbSNP
rs190846426 3796 dbSNP
rs970144878 3813 dbSNP
rs529778981 3826 dbSNP
rs1455781992 3828 dbSNP
rs924463977 3845 dbSNP
rs1291725076 3848 dbSNP
rs956054436 3861 dbSNP
rs1467513787 3868 dbSNP
rs1264495006 3877 dbSNP
rs1206695221 3887 dbSNP
rs1350804143 3891 dbSNP
rs988277167 3911 dbSNP
rs915311412 3914 dbSNP
rs780914148 3927 dbSNP
rs1349684602 3932 dbSNP
rs771461236 3940 dbSNP
rs1303860962 3942 dbSNP
rs1436717128 3946 dbSNP
rs1187886808 3960 dbSNP
rs1369816583 3985 dbSNP
rs946785158 3990 dbSNP
rs1039688829 3994 dbSNP
rs1320245839 3994 dbSNP
rs921237294 4001 dbSNP
rs934267138 4003 dbSNP
rs1471711239 4004 dbSNP
rs1162643409 4013 dbSNP
rs1436807076 4014 dbSNP
rs1390727319 4021 dbSNP
rs1395979539 4032 dbSNP
rs1173338765 4034 dbSNP
rs1431480812 4034 dbSNP
rs1048910198 4037 dbSNP
rs1375243838 4043 dbSNP
rs888414024 4045 dbSNP
rs774667704 4047 dbSNP
rs1260430116 4050 dbSNP
rs1394499187 4051 dbSNP
rs1390872256 4053 dbSNP
rs1335155306 4054 dbSNP
rs1280607037 4056 dbSNP
rs1252916084 4063 dbSNP
rs1342450906 4068 dbSNP
rs1001410253 4078 dbSNP
rs201968600 4080 dbSNP
rs541800716 4082 dbSNP
rs1034209553 4083 dbSNP
rs1314725882 4089 dbSNP
rs1416712766 4103 dbSNP
rs1343501346 4107 dbSNP
rs1312528458 4120 dbSNP
rs959880570 4122 dbSNP
rs887308765 4130 dbSNP
rs1399053218 4158 dbSNP
rs1014534501 4162 dbSNP
rs1004784503 4167 dbSNP
rs1250112143 4169 dbSNP
rs1038497640 4172 dbSNP
rs1371864096 4177 dbSNP
rs1338235557 4186 dbSNP
rs898246671 4189 dbSNP
rs1475921912 4232 dbSNP
rs563184410 4239 dbSNP
rs1459656237 4240 dbSNP
rs1012638274 4253 dbSNP
rs746293584 4262 dbSNP
rs531986543 4279 dbSNP
rs906850733 4297 dbSNP
rs1002820344 4303 dbSNP
rs1338599660 4315 dbSNP
rs1276230202 4316 dbSNP
rs1235170039 4324 dbSNP
rs1031585848 4325 dbSNP
rs925615278 4330 dbSNP
rs1446050594 4348 dbSNP
rs1451085709 4349 dbSNP
rs1337815664 4358 dbSNP
rs1168300900 4366 dbSNP
rs1329896292 4370 dbSNP
rs1372401369 4375 dbSNP
rs569969590 4376 dbSNP
rs1173180408 4394 dbSNP
rs550504926 4399 dbSNP
rs1462476265 4403 dbSNP
rs1021426467 4405 dbSNP
rs1417918078 4407 dbSNP
rs1180847248 4413 dbSNP
rs777481319 4416 dbSNP
rs779653710 4418 dbSNP
rs1450633082 4425 dbSNP
rs80335426 4426 dbSNP
rs772175013 4439 dbSNP
rs911447801 4448 dbSNP
rs944289305 4449 dbSNP
rs532275151 4450 dbSNP
rs571838907 4452 dbSNP
rs182704398 4456 dbSNP
rs921291469 4466 dbSNP
rs1335435534 4467 dbSNP
rs1272612768 4468 dbSNP
rs1226696697 4470 dbSNP
rs1437694794 4471 dbSNP
rs1353035962 4473 dbSNP
rs1041631161 4474 dbSNP
rs1441875816 4488 dbSNP
rs187531203 4488 dbSNP
rs987050164 4494 dbSNP
rs1048426133 4500 dbSNP
rs1294108322 4502 dbSNP
rs908786758 4507 dbSNP
rs760815575 4508 dbSNP
rs1163388089 4513 dbSNP
rs1055710928 4523 dbSNP
rs1403097458 4523 dbSNP
rs138111520 4531 dbSNP
rs1158806607 4542 dbSNP
rs1257177417 4544 dbSNP
rs1236102160 4562 dbSNP
rs1014171492 4565 dbSNP
rs1468814465 4566 dbSNP
rs770419718 4571 dbSNP
rs35513915 4574 dbSNP
rs1219415092 4576 dbSNP
rs1318838764 4580 dbSNP
rs1202705960 4585 dbSNP
rs898639252 4589 dbSNP
rs1351870950 4591 dbSNP
rs1306071641 4594 dbSNP
rs948476989 4596 dbSNP
rs902980387 4600 dbSNP
rs373966788 4608 dbSNP
rs1044156656 4626 dbSNP
rs906902969 4627 dbSNP
rs1000353128 4630 dbSNP
rs1002536888 4634 dbSNP
rs1433611300 4636 dbSNP
rs1184522013 4641 dbSNP
rs1415407374 4653 dbSNP
rs1031304725 4680 dbSNP
rs1032738844 4680 dbSNP
rs1378113165 4691 dbSNP
rs773741793 4691 dbSNP
rs1454573919 4694 dbSNP
rs1424318900 4695 dbSNP
rs891717265 4700 dbSNP
rs1486831903 4702 dbSNP
rs985822054 4713 dbSNP
rs1487395403 4716 dbSNP
rs1011464601 4721 dbSNP
rs1211990490 4724 dbSNP
rs1347634971 4724 dbSNP
rs976997881 4739 dbSNP
rs918753598 4747 dbSNP
rs1363354252 4748 dbSNP
rs1021896853 4749 dbSNP
rs536385346 4760 dbSNP
rs1199675390 4761 dbSNP
rs554943765 4770 dbSNP
rs1358191233 4771 dbSNP
rs1314356562 4775 dbSNP
rs1435004409 4776 dbSNP
rs1358332869 4783 dbSNP
rs1173779564 4789 dbSNP
rs1430228858 4796 dbSNP
rs1420162026 4797 dbSNP
rs1192949679 4802 dbSNP
rs1476898632 4812 dbSNP
rs930136745 4815 dbSNP
rs964561519 4817 dbSNP
rs984185418 4824 dbSNP
rs561725303 4838 dbSNP
rs768595284 4851 dbSNP
rs1483069679 4853 dbSNP
rs761225677 4860 dbSNP
rs1254626065 4862 dbSNP
rs769309874 4864 dbSNP
rs975501126 4872 dbSNP
rs910001206 4874 dbSNP
rs1176037840 4882 dbSNP
rs1389614701 4883 dbSNP
rs937410343 4885 dbSNP
rs1294637216 4887 dbSNP
rs1415010430 4894 dbSNP
rs1378062451 4895 dbSNP
rs1300800281 4897 dbSNP
rs1463340557 4907 dbSNP
rs776879192 4908 dbSNP
rs753735181 4910 dbSNP
rs1464046018 4920 dbSNP
rs1420077673 4923 dbSNP
rs1188832345 4926 dbSNP
rs1423450387 4927 dbSNP
rs1028359428 4930 dbSNP
rs955416159 4935 dbSNP
rs536903130 4936 dbSNP
rs1238003561 4940 dbSNP
rs1197267451 4941 dbSNP
rs950014321 4961 dbSNP
rs762948641 4962 dbSNP
rs1387928367 4966 dbSNP
rs1244895300 4979 dbSNP
rs1304035272 4991 dbSNP
rs1320667317 4991 dbSNP
rs1343154412 4996 dbSNP
rs558442798 5006 dbSNP
rs1373764229 5008 dbSNP
rs940283811 5010 dbSNP
rs1288626637 5016 dbSNP
rs10061162 5017 dbSNP
rs1213405918 5019 dbSNP
rs1259856594 5026 dbSNP
rs1366887222 5030 dbSNP
rs751298687 5034 dbSNP
rs1380069521 5037 dbSNP
rs147148635 5038 dbSNP
rs1254177011 5050 dbSNP
rs1209877374 5051 dbSNP
rs1487888458 5053 dbSNP
rs1263224600 5055 dbSNP
rs1240710332 5057 dbSNP
rs565836347 5058 dbSNP
rs1308244314 5060 dbSNP
rs1007312486 5064 dbSNP
rs1479519853 5064 dbSNP
rs948858513 5065 dbSNP
rs1373009645 5066 dbSNP
rs1018631264 5068 dbSNP
rs1386189456 5068 dbSNP
rs1044207408 5070 dbSNP
rs754868732 5073 dbSNP
rs977428068 5076 dbSNP
rs552925396 5077 dbSNP
rs1379928343 5079 dbSNP
rs906954065 5082 dbSNP
rs767219839 5087 dbSNP
rs1345031490 5092 dbSNP
rs951707122 5101 dbSNP
rs10050453 5102 dbSNP
rs563256293 5104 dbSNP
rs1053214136 5106 dbSNP
rs1206438314 5117 dbSNP
rs530537291 5123 dbSNP
rs757958454 5125 dbSNP
rs1011932824 5131 dbSNP
rs1349754884 5134 dbSNP
rs1403826548 5143 dbSNP
rs937462648 5144 dbSNP
rs1042970386 5154 dbSNP
rs544103255 5155 dbSNP
rs1297735701 5161 dbSNP
rs1400693124 5166 dbSNP
rs1360083984 5170 dbSNP
rs1296610620 5174 dbSNP
rs1436875307 5178 dbSNP
rs565558598 5187 dbSNP
rs1464973815 5189 dbSNP
rs1305840743 5190 dbSNP
rs1375300352 5197 dbSNP
rs1194615033 5201 dbSNP
rs1322159393 5213 dbSNP
rs1261900986 5215 dbSNP
rs868152036 5219 dbSNP
rs950054680 5221 dbSNP
rs532893161 5223 dbSNP
rs1199672840 5226 dbSNP
rs548002203 5238 dbSNP
rs1490152333 5243 dbSNP
rs924579083 5256 dbSNP
rs1339914080 5257 dbSNP
rs566186675 5265 dbSNP
rs530159072 5278 dbSNP
rs548400458 5279 dbSNP
rs1175749394 5280 dbSNP
rs192660317 5282 dbSNP
rs748836911 5285 dbSNP
rs757739680 5289 dbSNP
rs1422281332 5293 dbSNP
rs1424787740 5296 dbSNP
rs1007319214 5307 dbSNP
rs1040101159 5311 dbSNP
rs1237698725 5315 dbSNP
rs920188161 5316 dbSNP
rs868087659 5319 dbSNP
rs537069149 5324 dbSNP
rs928761065 5325 dbSNP
rs1355836191 5326 dbSNP
rs552181721 5330 dbSNP
rs140376767 5331 dbSNP
rs762263716 5334 dbSNP
rs1017063412 5336 dbSNP
rs534648874 5337 dbSNP
rs553086071 5338 dbSNP
rs746218915 5341 dbSNP
rs912921902 5343 dbSNP
rs947068291 5345 dbSNP
rs1332542564 5359 dbSNP
rs1358457981 5365 dbSNP
rs991549757 5368 dbSNP
rs1229125868 5379 dbSNP
rs917309014 5379 dbSNP
rs772416891 5386 dbSNP
rs1414004485 5420 dbSNP
rs1162254878 5424 dbSNP
rs1309374318 5426 dbSNP
rs900433031 5430 dbSNP
rs775734287 5438 dbSNP
rs113499324 5447 dbSNP
rs890267817 5448 dbSNP
rs924602394 5450 dbSNP
rs769037991 5452 dbSNP
rs1226817496 5483 dbSNP
rs1353179010 5486 dbSNP
rs535499001 5488 dbSNP
rs1054335744 5492 dbSNP
rs750599165 5496 dbSNP
rs1375272490 5504 dbSNP
rs763089584 5507 dbSNP
rs142763109 5511 dbSNP
rs1483666452 5516 dbSNP
rs1349928248 5519 dbSNP
rs1322386079 5529 dbSNP
rs1185811452 5531 dbSNP
rs1403234731 5531 dbSNP
rs1362082510 5537 dbSNP
rs776825466 5538 dbSNP
rs1241760734 5539 dbSNP
rs758067855 5543 dbSNP
rs995523468 5547 dbSNP
rs187369457 5551 dbSNP
rs970312639 5557 dbSNP
rs901618625 5560 dbSNP
rs993653911 5561 dbSNP
rs1422234899 5565 dbSNP
rs766438879 5568 dbSNP
rs887411534 5576 dbSNP
rs1169075756 5577 dbSNP
rs34409976 5595 dbSNP
rs928813185 5606 dbSNP
rs1359396342 5607 dbSNP
rs1448888066 5613 dbSNP
rs1287044811 5614 dbSNP
rs545801704 5616 dbSNP
rs777350281 5623 dbSNP
rs960183691 5629 dbSNP
rs1306132965 5641 dbSNP
rs1381831176 5643 dbSNP
rs1220316095 5646 dbSNP
rs564113125 5648 dbSNP
rs762038898 5656 dbSNP
rs770986690 5659 dbSNP
rs1273674675 5666 dbSNP
rs1013113780 5682 dbSNP
rs1271888134 5683 dbSNP
rs912982343 5687 dbSNP
rs1418763992 5693 dbSNP
rs1358386492 5694 dbSNP
rs1359715720 5696 dbSNP
rs1024875456 5699 dbSNP
rs36120702 5701 dbSNP
rs947088264 5702 dbSNP
rs1424378047 5707 dbSNP
rs774278324 5713 dbSNP
rs147500252 5718 dbSNP
rs1312837430 5723 dbSNP
rs1193172640 5724 dbSNP
rs1487471311 5725 dbSNP
rs867477798 5726 dbSNP
rs1211284226 5733 dbSNP
rs924639292 5741 dbSNP
rs1277160319 5742 dbSNP
rs1319357880 5762 dbSNP
rs767292997 5762 dbSNP
rs957335764 5763 dbSNP
rs921576970 5764 dbSNP
rs1398994379 5766 dbSNP
rs191913297 5766 dbSNP
rs1261477636 5768 dbSNP
rs1337983480 5772 dbSNP
rs1304303548 5775 dbSNP
rs1448521448 5782 dbSNP
rs559855063 5786 dbSNP
rs1173840372 5792 dbSNP
rs184829562 5794 dbSNP
rs548635561 5797 dbSNP
rs556262108 5808 dbSNP
rs1474680367 5811 dbSNP
rs200595971 5816 dbSNP
rs1185436824 5825 dbSNP
rs1258542482 5841 dbSNP
rs1182767344 5842 dbSNP
rs148562325 5844 dbSNP
rs975983263 5849 dbSNP
rs1236136720 5864 dbSNP
rs1201041902 5865 dbSNP
rs1277989473 5866 dbSNP
rs868487869 5868 dbSNP
rs1425331405 5872 dbSNP
rs1470657089 5876 dbSNP
rs1217488581 5887 dbSNP
rs537321492 5904 dbSNP
rs1314455984 5906 dbSNP
rs1228575511 5911 dbSNP
rs530945751 5914 dbSNP
rs929081012 5919 dbSNP
rs1457591222 5922 dbSNP
rs1319969449 5926 dbSNP
rs1047894382 5930 dbSNP
rs1400962599 5935 dbSNP
rs755095135 5937 dbSNP
rs1275359761 5938 dbSNP
rs1346288745 5941 dbSNP
rs1370368678 5941 dbSNP
rs941669046 5946 dbSNP
rs763785173 5949 dbSNP
rs894753731 5951 dbSNP
rs1180912722 5956 dbSNP
rs1013582955 5957 dbSNP
rs757633515 5975 dbSNP
rs1323037341 5997 dbSNP
rs907329426 6001 dbSNP
rs1479357401 6005 dbSNP
rs995970230 6010 dbSNP
rs1266735917 6011 dbSNP
rs878901715 6016 dbSNP
rs1320803094 6034 dbSNP
rs1312577083 6043 dbSNP
rs781073677 6046 dbSNP
rs753333304 6049 dbSNP
rs114740420 6050 dbSNP
rs1445633353 6055 dbSNP
rs576697126 6066 dbSNP
rs1247767445 6073 dbSNP
rs1392931915 6079 dbSNP
rs1481148775 6079 dbSNP
rs1294264009 6083 dbSNP
rs1035939075 6092 dbSNP
rs1348361300 6097 dbSNP
rs1160782119 6104 dbSNP
rs1428178158 6110 dbSNP
rs1440720771 6113 dbSNP
rs990173173 6116 dbSNP
rs1177276125 6119 dbSNP
rs1017617653 6125 dbSNP
rs547561309 6133 dbSNP
rs1159931216 6135 dbSNP
rs1209930709 6139 dbSNP
rs964695887 6142 dbSNP
rs1405588081 6152 dbSNP
rs778295414 6154 dbSNP
rs1218461976 6155 dbSNP
rs1354122825 6161 dbSNP
rs750887151 6163 dbSNP
rs923133649 6164 dbSNP
rs1020841759 6168 dbSNP
rs144886536 6174 dbSNP
rs758856708 6175 dbSNP
rs968514688 6181 dbSNP
rs570516628 6185 dbSNP
rs1386312159 6190 dbSNP
rs1343819042 6199 dbSNP
rs1300250178 6202 dbSNP
rs921630891 6204 dbSNP
rs1360279971 6215 dbSNP
rs1301310773 6236 dbSNP
rs1157288086 6250 dbSNP
rs931640464 6252 dbSNP
rs1378728472 6259 dbSNP
rs941764213 6262 dbSNP
rs1281468370 6263 dbSNP
rs1054758272 6279 dbSNP
rs987388803 6287 dbSNP
rs1488451561 6290 dbSNP
rs894804708 6293 dbSNP
rs1203178989 6303 dbSNP
rs949005246 6316 dbSNP
rs1256538333 6317 dbSNP
rs1232503557 6320 dbSNP
rs911813883 6341 dbSNP
rs1280247166 6344 dbSNP
rs1293165284 6346 dbSNP
rs1400820299 6349 dbSNP
rs763208456 6351 dbSNP
rs1490966565 6360 dbSNP
rs1316600242 6367 dbSNP
rs907383582 6374 dbSNP
rs999458317 6379 dbSNP
rs1172485150 6385 dbSNP
rs940569812 6385 dbSNP
rs1465019582 6386 dbSNP
rs1036212167 6389 dbSNP
rs546027257 6390 dbSNP
rs768770221 6396 dbSNP
rs1333358830 6404 dbSNP
rs1183602295 6405 dbSNP
rs10060173 6413 dbSNP
rs1190695353 6414 dbSNP
rs1443907275 6417 dbSNP
rs1256642893 6423 dbSNP
rs965033235 6448 dbSNP
rs1260010306 6461 dbSNP
rs546593835 6461 dbSNP
rs1469468993 6463 dbSNP
rs976042068 6466 dbSNP
rs568217806 6473 dbSNP
rs1030632683 6474 dbSNP
rs1163577402 6475 dbSNP
rs1333998135 6494 dbSNP
rs1387030569 6496 dbSNP
rs1451079589 6498 dbSNP
rs1332717544 6499 dbSNP
rs1403103891 6499 dbSNP
rs1465707822 6507 dbSNP
rs983269177 6510 dbSNP
rs1048496560 6511 dbSNP
rs909047442 6526 dbSNP
rs747423352 6532 dbSNP
rs535274613 6539 dbSNP
rs1186593763 6548 dbSNP
rs557157831 6551 dbSNP
rs1442626621 6554 dbSNP
rs963132065 6557 dbSNP
rs1199301096 6562 dbSNP
rs575404161 6563 dbSNP
rs1162847928 6572 dbSNP
rs1211856098 6574 dbSNP
rs1357395904 6580 dbSNP
rs1001537019 6585 dbSNP
rs1035656084 6611 dbSNP
rs1331165700 6612 dbSNP
rs368147758 6613 dbSNP
rs1334153074 6626 dbSNP
rs1446746144 6627 dbSNP
rs1353409708 6644 dbSNP
rs949044244 6650 dbSNP
rs896080489 6659 dbSNP
rs1441949108 6660 dbSNP
rs1391004797 6667 dbSNP
rs1010879177 6680 dbSNP
rs1162650434 6682 dbSNP
rs1274192916 6683 dbSNP
rs559116611 6688 dbSNP
rs1381998477 6697 dbSNP
rs781628547 6704 dbSNP
rs189725471 6709 dbSNP
rs978514800 6710 dbSNP
rs1291658126 6715 dbSNP
rs1289472646 6717 dbSNP
rs1220597171 6733 dbSNP
rs1339535624 6742 dbSNP
rs1028696377 6751 dbSNP
rs1356257379 6752 dbSNP
rs1240039739 6766 dbSNP
rs557736682 6778 dbSNP
rs1371824887 6784 dbSNP
rs1196995538 6794 dbSNP
rs928904649 6795 dbSNP
rs1438025438 6813 dbSNP
rs934927309 6816 dbSNP
rs953094079 6822 dbSNP
rs755929266 6827 dbSNP
rs572883306 6828 dbSNP
rs142951185 6846 dbSNP
rs1159091400 6847 dbSNP
rs1399982997 6853 dbSNP
rs940639359 6855 dbSNP
rs1202091091 6858 dbSNP
rs1174351829 6872 dbSNP
rs773185691 6880 dbSNP
rs777445986 6882 dbSNP
rs1244816125 6900 dbSNP
rs1442531736 6901 dbSNP
rs559814346 6907 dbSNP
rs930466795 6909 dbSNP
rs1044879712 6921 dbSNP
rs575103934 6924 dbSNP
rs1462579991 6925 dbSNP
rs927368016 6932 dbSNP
rs1475300040 6939 dbSNP
rs748907769 6940 dbSNP
rs770461182 6941 dbSNP
rs759479306 6942 dbSNP
rs1337616554 6945 dbSNP
rs771946075 6950 dbSNP
rs950729730 6956 dbSNP
rs1345076017 6960 dbSNP
rs1282166842 6969 dbSNP
rs1004749307 6983 dbSNP
rs181190227 6984 dbSNP
rs1315011575 6992 dbSNP
rs1429809058 6999 dbSNP
rs1343316027 7004 dbSNP
rs1178102057 7018 dbSNP
rs1042353521 7022 dbSNP
rs904728055 7024 dbSNP
rs1016058213 7031 dbSNP
rs963141495 7033 dbSNP
rs1478884827 7034 dbSNP
rs1424641332 7035 dbSNP
rs1186242624 7045 dbSNP
rs775333250 7046 dbSNP
rs1239625117 7047 dbSNP
rs370416375 7054 dbSNP
rs1461313607 7059 dbSNP
rs953145875 7067 dbSNP
rs151115751 7069 dbSNP
rs766670462 7069 dbSNP
rs1203969535 7070 dbSNP
rs982225112 7073 dbSNP
rs923624792 7085 dbSNP
rs530907617 7088 dbSNP
rs1053328288 7091 dbSNP
rs914763910 7106 dbSNP
rs200588750 7108 dbSNP
rs1262357703 7112 dbSNP
rs879570384 7114 dbSNP
rs1334734988 7140 dbSNP
rs1467265196 7149 dbSNP
rs1401182356 7152 dbSNP
rs1430164745 7155 dbSNP
rs1018638636 7160 dbSNP
rs1427031347 7163 dbSNP
rs1371464454 7164 dbSNP
rs1416395824 7167 dbSNP
rs760522718 7168 dbSNP
rs1182819394 7171 dbSNP
rs1444496147 7181 dbSNP
rs572259674 7182 dbSNP
rs1039204183 7188 dbSNP
rs1241870779 7200 dbSNP
rs962004762 7201 dbSNP
rs1458700357 7203 dbSNP
rs1408527851 7212 dbSNP
rs900606498 7214 dbSNP
rs1305415211 7221 dbSNP
rs972041724 7228 dbSNP
rs372443296 7248 dbSNP
rs763735879 7249 dbSNP
rs920507533 7255 dbSNP
rs997605850 7257 dbSNP
rs1381885981 7272 dbSNP
rs1312802333 7277 dbSNP
rs951907722 7285 dbSNP
rs1448961761 7298 dbSNP
rs1377741580 7301 dbSNP
rs1297740305 7302 dbSNP
rs778519273 7305 dbSNP
rs1386325648 7310 dbSNP
rs1165885353 7315 dbSNP
rs1424453599 7326 dbSNP
rs1384492122 7341 dbSNP
rs1383833312 7344 dbSNP
rs1294043513 7348 dbSNP
rs753426893 7352 dbSNP
rs1440906999 7354 dbSNP
rs1250540629 7371 dbSNP
rs1176124086 7375 dbSNP
rs140030120 7376 dbSNP
rs937430371 7393 dbSNP
rs1004759292 7409 dbSNP
rs1016110726 7412 dbSNP
rs1289413792 7416 dbSNP
rs1242212533 7423 dbSNP
rs749383979 7424 dbSNP
rs1336292613 7447 dbSNP
rs963252343 7447 dbSNP
rs1012059334 7448 dbSNP
rs564106456 7458 dbSNP
rs1294320861 7472 dbSNP
rs917290861 7476 dbSNP
rs541225637 7481 dbSNP
rs560693598 7485 dbSNP
rs1420769099 7495 dbSNP
rs970918840 7497 dbSNP
rs1157673764 7500 dbSNP
rs1416767280 7502 dbSNP
rs547003359 7505 dbSNP
rs143570943 7513 dbSNP
rs904781423 7515 dbSNP
rs1490101481 7520 dbSNP
rs956339295 7529 dbSNP
rs1218524158 7533 dbSNP
rs1351265230 7538 dbSNP
rs1260099699 7561 dbSNP
rs1000376469 7568 dbSNP
rs1236856745 7571 dbSNP
rs1486715913 7577 dbSNP
rs1050572965 7578 dbSNP
rs989078107 7580 dbSNP
rs914853565 7591 dbSNP
rs1223069162 7592 dbSNP
rs1343874817 7600 dbSNP
rs1260915687 7602 dbSNP
rs947598206 7623 dbSNP
rs889266356 7626 dbSNP
rs1384759432 7642 dbSNP
rs1488023883 7642 dbSNP
rs1008633135 7659 dbSNP
rs755047141 7661 dbSNP
rs367985707 7664 dbSNP
rs1479542808 7665 dbSNP
rs1479868467 7679 dbSNP
rs1175623430 7682 dbSNP
rs1019103450 7686 dbSNP
rs1195519841 7690 dbSNP
rs529726794 7691 dbSNP
rs1051815779 7695 dbSNP
rs1203312022 7702 dbSNP
rs1484201283 7704 dbSNP
rs993575729 7723 dbSNP
rs1223014834 7755 dbSNP
rs1027291557 7760 dbSNP
rs1280312110 7761 dbSNP
rs886457853 7772 dbSNP
rs749938952 7780 dbSNP
rs1326203889 7786 dbSNP
rs951958265 7802 dbSNP
rs199691290 7805 dbSNP
rs1384810928 7808 dbSNP
rs1468857562 7809 dbSNP
rs1403332215 7813 dbSNP
rs1405043992 7818 dbSNP
rs543435285 7818 dbSNP
rs1475576970 7819 dbSNP
rs1372229165 7821 dbSNP
rs899128189 7824 dbSNP
rs980663432 7828 dbSNP
rs1243693829 7837 dbSNP
rs1203012788 7839 dbSNP
rs146795781 7840 dbSNP
rs960519063 7842 dbSNP
rs906329306 7843 dbSNP
rs774369364 7845 dbSNP
rs1249911488 7846 dbSNP
rs1247485002 7850 dbSNP
rs917324341 7859 dbSNP
rs1003724890 7867 dbSNP
rs1314943152 7868 dbSNP
rs550794970 7874 dbSNP
rs946119251 7877 dbSNP
rs1451152735 7882 dbSNP
rs977838782 7893 dbSNP
rs925933508 7908 dbSNP
rs1330378970 7909 dbSNP
rs1030723191 7923 dbSNP
rs1236560716 7927 dbSNP
rs1410114133 7935 dbSNP
rs1395361883 7946 dbSNP
rs1165885177 7957 dbSNP
rs1426287762 7958 dbSNP
rs758913917 7969 dbSNP
rs1360000023 7970 dbSNP
rs956429207 7980 dbSNP
rs1223330742 7991 dbSNP
rs1442766086 7995 dbSNP
rs989167610 7998 dbSNP
rs1182628615 8013 dbSNP
rs936281939 8020 dbSNP
rs1271176611 8028 dbSNP
rs1021965708 8029 dbSNP
rs1291597727 8030 dbSNP
rs1244410703 8031 dbSNP
rs1050626022 8034 dbSNP
rs1356467994 8035 dbSNP
rs968990733 8045 dbSNP
rs1442322579 8046 dbSNP
rs1334706733 8047 dbSNP
rs1271227875 8050 dbSNP
rs1406461737 8051 dbSNP
rs1489876825 8073 dbSNP
rs375458422 8084 dbSNP
rs922095555 8085 dbSNP
rs1410113390 8090 dbSNP
rs1159170579 8093 dbSNP
rs1251476450 8109 dbSNP
rs1421272308 8111 dbSNP
rs140587154 8115 dbSNP
rs1490592176 8175 dbSNP