miRTarBase - #MIRT023222 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol STARD13   
Synonyms ARHGAP37, DLC2, GT650, LINC00464
Description StAR related lipid transfer domain containing 13
Transcript NM_052851   
Other Transcripts NM_178006 , NM_178007   
Expression
Putative miRNA Targets on STARD13
3'UTR of STARD13
(miRNA target sites are highlighted)
>STARD13|NM_052851|3'UTR
   1 GTTTTGCCCAGTGTGACATCAAACTCAGGGAAGAGGAAGCTAAAGTGACGAGTGTGGCAGAGAGTGTGCATGTGAGAAAG
  81 CGAGAGAAAGAGGAACTGAAGGACGCGGTTAATGCCTAAAAATGGAAACGTTAAGAAGTTGGAATGTTGGAGATGCAAGA
 161 ATTTCCAAGAACTTTCTTAGCCTTCCTGGAGATGGCTACATCCCTACTAATATAATTTTAAAATGAGAACTTTATATATA
 241 TTACTTAAAATTAAATGGACTATTCCTTGTGCATTGCCTAATTTGCTATTTAAAGGCTTCTAAGAAGCGTATACCTAACT
 321 GTAAATAAATGTATGTATAGCATATGTACATATGTGTGTATATCTCCATCTTTACTGTATATATGTAAAATACCAATTTT
 401 ATATAGAATTGTGTGTTTTGAAAATGACGGTGTCTGACTCAGTGAGTCCCTTCCTCACACAGTTCTTTCCAAGTGGCTCT
 481 GGGCCCCATCTCTCCACTGTCCTGTAAGCTGTGCAGAACCTGCTGCTAACACCAAGGTGTGAACATGCCCTGATGCCTAA
 561 CCAAAGATGAGTTAACCAAAGGAAAATAACATTAAAGGAGACTTATGTGTTAACGCTTTGTTTCTGCTATTCAAAAACTG
 641 AGAGTGGAGATCTGGGATAAAGCAAGGAAATAATAATTACTCCTCCTTAAAGCAAATGGGGGGGTGAGAAGTCATTACCA
 721 AATTTAAAGCTAGATGAGGAGTTGCCACTGGGCCCAGTAAGATGGAATTTCAGTGAGATATGGACCACCGGAGTCAGCGA
 801 GAGTGACTGAAACAGAAGCGATACCTCTCGCTCCCATGCCCATCACTACAGACCCCAAGTCAAGATGAATATCATAGCCT
 881 TTACTTCTTCACAGCCAAAGGGAGCCCCTGTGTTGTCTCAAGTTTTTATAAATACATTTCATAATGTTATTAAATGTCAT
 961 TCTATTTGACCAGTGGCCTATTTGGTCACAGTTAATTGGTGTTTTCTTATTGCACTGAATTCAACTCCAGACACCATACA
1041 AAGGGAGATGATGGCCATTCCGTTCAAATCCTAGATCGTTACAGCTTCAGGGAATTCATATTTTGTTATGTGTAGGATAC
1121 TCTTAAAATGTAATTCATTAAACTTTTACAATCTGAAAGACAGGGTTTTTAACTAACATGAGACCAAAACTATGTTCTTT
1201 GATTAGTTTTAGATAGTATAATCGGGTTTATTAATTCTTCTGTGTTTCTTCACTAGCCAGTCCAAGCTACCTATGCATTT
1281 GACCCAACCTTATTTATTATTGTACAGATGAAGCGAATTGACTCCCTTTAGCCAACTGCTAATGGATCGAATGTGCTTTT
1361 TATTGTAATTCAACAGCTATAGAGAGAAAGATAACTTATTGTGTGTTTGATTTCAGGGAGAGAGATTTTCTTTGGTCATC
1441 CATAATAGAGATTGATAAGATTTAGCAACTGGTGTTGGAGAAAAAAAGAAAAGCAAATGAGTGTTTTCAGGTTTTTTTGC
1521 ATTATATGCATTTATGTAATGTTTCTGTTATCAGCAATGTGCAATTATTTTATTGAGAGGAATAAAAAAGCTTTCTATGA
1601 GTTTGGTATGGTGCGAGGAAAATCTTACAGTTTGAATTATGACCTAGAAATTTTTCATTCCCATATCTACCTAAGAAGGA
1681 AGCAGTAAATCCATAATTTACCTTTTGGGCAATGCTTTGTGAGCAAAACAAAGTCACTTCTGCCATAACATCTTGAATTT
1761 AACCATATATGCCAGATTACTTTATATGCATCAACAAGATCACCAGTGAAGTTTAATCTAGCTAAACACTGGTCCTGCTC
1841 CTGAGATGGGATCCTATGTGTTTGGAAAACGTGATAGGCACACGAGGATGAGTGGCTTTGTATCGCCCAGAGAGGTGCTT
1921 GTCCAGATTTCACATGCACATGAATTGCCTGGGGATCTTGTGAAACTGCAGACTCTGCTCCAAGTAATCTGGGCTGGGCC
2001 TGAGATTCTGCATTTCTAAGGAGTCTCAGGGATGCCTATGCTGCTGGCCTAAAACCACACTCAGAAACGAGGACCTAGAA
2081 GATCCCTAAAACAGAATAAGAACAAATGTGATTGTATTTCTGATTCTCCCTCTCTTCGAATTATCTGACTTTTTTGTTTT
2161 TGTGCACATAGTAATCATATCACCGCTGCATAACAACACAGTGCATCTTTTTAAAACAAGGAAAAGGGAAAAAAAGGAGA
2241 AAAAACGATGCATCAAGCTTGTTTGTCAAATACCACAGTATTTTATTCATTGTTATCTTGCCAATGGAAATAAAGTATGA
2321 TATTGCATTTAAATATTATATTTATACCTCATGTATATTTTTACCTCAATTGTTGATATCAATCATCAATTGTAAATAAA
2401 TAATTGCCAAGGCAAATAAATTTATATATATTAAATATTTCCTATTTTCTATAAAATAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugugguaacaGUGUGAGgu 5'
                       |||||||  
Target 5' gctggcctaaaacCACACTCag 3'
2043 - 2064 125.00 -11.70
2
miRNA  3' guUUGUGGU--AACA-GUGUGAGGu 5'
            |||||||   |||  |||: || 
Target 5' ctAACACCAAGGTGTGAACATGCCc 3'
526 - 550 118.00 -14.90
3
miRNA  3' guuuGUGGUA-ACA--GUGUGAGGu 5'
              ::::|| |||   |:||||: 
Target 5' atttTGTTATGTGTAGGATACTCTt 3'
1100 - 1124 116.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30472825 9 COSMIC
COSN30484727 28 COSMIC
COSN30517557 29 COSMIC
COSN30755108 35 COSMIC
COSN30174785 49 COSMIC
COSN30104368 52 COSMIC
COSN30151792 76 COSMIC
COSN30497576 81 COSMIC
COSN31612853 104 COSMIC
COSN30113692 105 COSMIC
COSN31560315 106 COSMIC
COSN13438566 130 COSMIC
COSN30104945 130 COSMIC
COSN1157666 138 COSMIC
COSN30105692 150 COSMIC
COSN8128484 152 COSMIC
COSN16364618 391 COSMIC
COSN31539891 415 COSMIC
COSN31550381 480 COSMIC
COSN31592860 492 COSMIC
COSN1606449 493 COSMIC
COSN21746664 494 COSMIC
COSN31559463 544 COSMIC
COSN30542819 669 COSMIC
COSN31535449 844 COSMIC
COSN31607470 864 COSMIC
COSN31528566 962 COSMIC
COSN31565431 1078 COSMIC
COSN28633226 1226 COSMIC
COSN15370569 1855 COSMIC
COSN31608777 1948 COSMIC
COSN21944282 2009 COSMIC
COSN7398824 2057 COSMIC
COSN31609896 2137 COSMIC
COSN31522428 2258 COSMIC
COSN25422002 2384 COSMIC
COSN31535283 2422 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775244876 6 dbSNP
rs750674163 8 dbSNP
rs781259258 10 dbSNP
rs74490372 12 dbSNP
rs751796117 13 dbSNP
rs1398929660 14 dbSNP
rs1446622138 19 dbSNP
rs1223386772 22 dbSNP
rs1271107352 28 dbSNP
rs1486632541 29 dbSNP
rs776171478 31 dbSNP
rs1462712811 38 dbSNP
rs779453835 39 dbSNP
rs561508904 42 dbSNP
rs1014472279 44 dbSNP
rs769202501 45 dbSNP
rs188301214 49 dbSNP
rs759566839 50 dbSNP
rs576051353 51 dbSNP
rs780206528 53 dbSNP
rs1418681428 63 dbSNP
rs938147077 65 dbSNP
rs1238199423 69 dbSNP
rs535436233 74 dbSNP
rs1402486124 81 dbSNP
rs746095587 82 dbSNP
rs1336274436 84 dbSNP
rs1046511397 93 dbSNP
rs1311162881 93 dbSNP
rs926116825 98 dbSNP
rs781509680 104 dbSNP
rs1294162518 105 dbSNP
rs945082825 106 dbSNP
rs913588236 107 dbSNP
rs976127957 108 dbSNP
rs1251957922 113 dbSNP
rs972059797 118 dbSNP
rs944333276 129 dbSNP
rs910508523 130 dbSNP
rs986036724 136 dbSNP
rs1386636635 138 dbSNP
rs984039614 145 dbSNP
rs1162112003 152 dbSNP
rs951865411 154 dbSNP
rs1393036158 155 dbSNP
rs1326726325 156 dbSNP
rs1334973345 172 dbSNP
rs147468196 182 dbSNP
rs1317439177 183 dbSNP
rs1192142583 186 dbSNP
rs921057358 193 dbSNP
rs1245416350 198 dbSNP
rs1251946360 199 dbSNP
rs976999906 204 dbSNP
rs972192061 206 dbSNP
rs1021142894 207 dbSNP
rs1009215763 216 dbSNP
rs1185805803 224 dbSNP
rs1462045507 224 dbSNP
rs116596164 225 dbSNP
rs1442368945 233 dbSNP
rs1186275286 234 dbSNP
rs757179852 246 dbSNP
rs1283617952 255 dbSNP
rs1002495871 256 dbSNP
rs1032586846 256 dbSNP
rs554815180 258 dbSNP
rs1204541437 260 dbSNP
rs1354319848 266 dbSNP
rs1287896623 280 dbSNP
rs1338444607 300 dbSNP
rs554079044 304 dbSNP
rs541744025 308 dbSNP
rs574019540 309 dbSNP
rs1275038606 310 dbSNP
rs555476152 331 dbSNP
rs1014183428 333 dbSNP
rs537555838 335 dbSNP
rs1034600121 337 dbSNP
rs897885402 342 dbSNP
rs1324873739 343 dbSNP
rs567924757 344 dbSNP
rs1324224417 348 dbSNP
rs1461118762 349 dbSNP
rs1199547627 353 dbSNP
rs904694180 358 dbSNP
rs1261928313 365 dbSNP
rs1429779208 376 dbSNP
rs1190397590 377 dbSNP
rs1042257192 379 dbSNP
rs1480711698 380 dbSNP
rs945161201 392 dbSNP
rs1403659043 395 dbSNP
rs1465306809 396 dbSNP
rs1401219805 400 dbSNP
rs1380661034 404 dbSNP
rs763974554 406 dbSNP
rs892231879 413 dbSNP
rs1346739140 416 dbSNP
rs1040142885 418 dbSNP
rs1172186733 420 dbSNP
rs944387121 420 dbSNP
rs910184179 427 dbSNP
rs182553795 428 dbSNP
rs942035280 429 dbSNP
rs1486638112 430 dbSNP
rs1202907192 431 dbSNP
rs986048180 432 dbSNP
rs557947939 435 dbSNP
rs1050388908 438 dbSNP
rs9527074 442 dbSNP
rs539619380 444 dbSNP
rs1427029505 458 dbSNP
rs920453191 468 dbSNP
rs79417570 469 dbSNP
rs961885777 473 dbSNP
rs547715772 484 dbSNP
rs1451854063 486 dbSNP
rs1488586179 490 dbSNP
rs1158230309 493 dbSNP
rs1366299943 499 dbSNP
rs1265189734 505 dbSNP
rs190746133 512 dbSNP
rs1406788029 522 dbSNP
rs1024849463 526 dbSNP
rs1301840944 530 dbSNP
rs186032743 536 dbSNP
rs1392397682 538 dbSNP
rs1309583179 548 dbSNP
rs1318399370 551 dbSNP
rs992865926 554 dbSNP
rs1237553555 557 dbSNP
rs921195007 561 dbSNP
rs1359538457 566 dbSNP
rs143067526 567 dbSNP
rs531443233 568 dbSNP
rs1279043718 570 dbSNP
rs1266753052 572 dbSNP
rs1488103766 579 dbSNP
rs1177610513 581 dbSNP
rs1034275225 590 dbSNP
rs1158288769 596 dbSNP
rs7991053 601 dbSNP
rs1426698339 602 dbSNP
rs1337038966 604 dbSNP
rs1269084287 605 dbSNP
rs913637192 607 dbSNP
rs61941365 614 dbSNP
rs527509967 615 dbSNP
rs1300377429 622 dbSNP
rs560380317 629 dbSNP
rs1414683297 639 dbSNP
rs1360164353 642 dbSNP
rs1031969631 645 dbSNP
rs1383048886 656 dbSNP
rs375029844 657 dbSNP
rs1247597032 664 dbSNP
rs542154167 666 dbSNP
rs1001877509 667 dbSNP
rs1408430557 682 dbSNP
rs1318311608 692 dbSNP
rs969599093 696 dbSNP
rs1020524818 698 dbSNP
rs1010857981 699 dbSNP
rs898022649 700 dbSNP
rs1478821995 701 dbSNP
rs1036446263 703 dbSNP
rs139780383 704 dbSNP
rs202126804 705 dbSNP
rs555743048 706 dbSNP
rs1040152913 707 dbSNP
rs1173165001 708 dbSNP
rs1237909486 712 dbSNP
rs1353263513 713 dbSNP
rs1211896861 717 dbSNP
rs1008611167 718 dbSNP
rs1406410722 724 dbSNP
rs1435732339 733 dbSNP
rs1271799720 746 dbSNP
rs1454275088 749 dbSNP
rs1282013589 753 dbSNP
rs1377824098 754 dbSNP
rs192275057 758 dbSNP
rs1214578267 775 dbSNP
rs888801914 778 dbSNP
rs1198849182 781 dbSNP
rs1297722177 786 dbSNP
rs150764250 789 dbSNP
rs930313308 790 dbSNP
rs1050359937 791 dbSNP
rs1462459360 793 dbSNP
rs866641046 799 dbSNP
rs147586576 804 dbSNP
rs372925980 804 dbSNP
rs1475819507 818 dbSNP
rs1286332773 819 dbSNP
rs1041388336 820 dbSNP
rs920532247 829 dbSNP
rs1431930160 830 dbSNP
rs1332350388 845 dbSNP
rs1036279418 847 dbSNP
rs576152185 855 dbSNP
rs940555092 856 dbSNP
rs917056261 859 dbSNP
rs1467361974 863 dbSNP
rs1430901521 866 dbSNP
rs1290095017 867 dbSNP
rs992877277 869 dbSNP
rs958760411 874 dbSNP
rs1338393791 887 dbSNP
rs987992648 891 dbSNP
rs1283797118 904 dbSNP
rs936371334 906 dbSNP
rs927312744 907 dbSNP
rs776277952 912 dbSNP
rs980409689 925 dbSNP
rs969065673 930 dbSNP
rs1261164163 933 dbSNP
rs1487975608 941 dbSNP
rs978763549 945 dbSNP
rs1414366974 949 dbSNP
rs186984844 952 dbSNP
rs992860554 964 dbSNP
rs962323060 970 dbSNP
rs1015472996 976 dbSNP
rs1424090737 978 dbSNP
rs1006361184 983 dbSNP
rs34687423 984 dbSNP
rs1160796617 990 dbSNP
rs1358104227 991 dbSNP
rs141250303 991 dbSNP
rs1303697454 994 dbSNP
rs996122020 998 dbSNP
rs1273994448 999 dbSNP
rs1232068258 1011 dbSNP
rs9568845 1015 dbSNP
rs180929149 1017 dbSNP
rs901884361 1025 dbSNP
rs1225705162 1027 dbSNP
rs1020987617 1033 dbSNP
rs1010452409 1035 dbSNP
rs965929724 1037 dbSNP
rs943910870 1048 dbSNP
rs1019769476 1049 dbSNP
rs554066964 1053 dbSNP
rs1458808906 1055 dbSNP
rs371749330 1056 dbSNP
rs113768203 1062 dbSNP
rs1050153820 1064 dbSNP
rs1244045862 1077 dbSNP
rs777676553 1078 dbSNP
rs1392840889 1080 dbSNP
rs1403563368 1084 dbSNP
rs994950353 1089 dbSNP
rs1222537212 1092 dbSNP
rs980552142 1098 dbSNP
rs549764254 1102 dbSNP
rs947700295 1103 dbSNP
rs531304542 1105 dbSNP
rs1368968579 1110 dbSNP
rs1246866330 1113 dbSNP
rs762232076 1114 dbSNP
rs1354291711 1115 dbSNP
rs1209797232 1116 dbSNP
rs570440487 1122 dbSNP
rs1458433001 1129 dbSNP
rs1236027828 1134 dbSNP
rs774676093 1136 dbSNP
rs917534366 1137 dbSNP
rs1369717639 1150 dbSNP
rs1471489626 1158 dbSNP
rs1166888353 1159 dbSNP
rs1162594102 1164 dbSNP
rs991847341 1165 dbSNP
rs1217638771 1178 dbSNP
rs1467043483 1178 dbSNP
rs940580591 1179 dbSNP
rs1399894079 1182 dbSNP
rs962581955 1190 dbSNP
rs189024978 1193 dbSNP
rs984907348 1197 dbSNP
rs1056866901 1206 dbSNP
rs117848662 1212 dbSNP
rs1029025070 1214 dbSNP
rs527379905 1216 dbSNP
rs1488546436 1217 dbSNP
rs901927528 1218 dbSNP
rs1203916319 1219 dbSNP
rs1247929520 1223 dbSNP
rs927409004 1224 dbSNP
rs532166 1225 dbSNP
rs1373624288 1227 dbSNP
rs1478744858 1241 dbSNP
rs1168402554 1242 dbSNP
rs775791741 1244 dbSNP
rs1470074963 1247 dbSNP
rs1349274063 1253 dbSNP
rs1304815803 1254 dbSNP
rs913190860 1259 dbSNP
rs769927566 1260 dbSNP
rs1319026224 1261 dbSNP
rs371996307 1266 dbSNP
rs1217358758 1271 dbSNP
rs796184276 1274 dbSNP
rs903729247 1277 dbSNP
rs1242697015 1279 dbSNP
rs1225727658 1280 dbSNP
rs1257452001 1284 dbSNP
rs1342411348 1289 dbSNP
rs548042653 1299 dbSNP
rs745926260 1302 dbSNP
rs1199427734 1303 dbSNP
rs1019865116 1308 dbSNP
rs1044923925 1309 dbSNP
rs1007086891 1310 dbSNP
rs184059827 1314 dbSNP
rs562615349 1315 dbSNP
rs1177956382 1318 dbSNP
rs994562954 1326 dbSNP
rs1287185517 1339 dbSNP
rs1465754447 1341 dbSNP
rs757518305 1348 dbSNP
rs898830227 1349 dbSNP
rs985043893 1354 dbSNP
rs1346681857 1356 dbSNP
rs746853309 1378 dbSNP
rs1014569314 1384 dbSNP
rs1388937258 1391 dbSNP
rs1005222391 1395 dbSNP
rs895768495 1399 dbSNP
rs1232105537 1403 dbSNP
rs1056961697 1416 dbSNP
rs144878772 1418 dbSNP
rs1213823744 1421 dbSNP
rs1285298091 1424 dbSNP
rs1159045896 1434 dbSNP
rs1192806352 1435 dbSNP
rs576065187 1437 dbSNP
rs1265024193 1442 dbSNP
rs1432322463 1452 dbSNP
rs564127190 1453 dbSNP
rs368173440 1455 dbSNP
rs966494788 1470 dbSNP
rs1418001455 1471 dbSNP
rs1158101056 1472 dbSNP
rs1366778681 1478 dbSNP
rs1174977393 1493 dbSNP
rs142701749 1502 dbSNP
rs1043544306 1503 dbSNP
rs1292244496 1511 dbSNP
rs1019047892 1512 dbSNP
rs1392263265 1513 dbSNP
rs1268933743 1519 dbSNP
rs1309621754 1519 dbSNP
rs1378643100 1519 dbSNP
rs1010635265 1520 dbSNP
rs1307932918 1523 dbSNP
rs1184190268 1524 dbSNP
rs1321742986 1529 dbSNP
rs181127092 1533 dbSNP
rs1263533896 1540 dbSNP
rs1030921357 1551 dbSNP
rs1196144670 1554 dbSNP
rs1240313332 1568 dbSNP
rs1000746078 1572 dbSNP
rs903780164 1573 dbSNP
rs1044892619 1574 dbSNP
rs1425574939 1581 dbSNP
rs913242819 1589 dbSNP
rs1163301868 1590 dbSNP
rs1219291027 1591 dbSNP
rs1349807893 1592 dbSNP
rs988852748 1594 dbSNP
rs1484922771 1597 dbSNP
rs777649172 1605 dbSNP
rs912852539 1614 dbSNP
rs1314092168 1615 dbSNP
rs758091926 1617 dbSNP
rs1444147756 1621 dbSNP
rs1330196310 1642 dbSNP
rs752686396 1644 dbSNP
rs1229531841 1645 dbSNP
rs765028049 1649 dbSNP
rs189083283 1656 dbSNP
rs1339793313 1657 dbSNP
rs1219051860 1659 dbSNP
rs1259786131 1660 dbSNP
rs973573033 1660 dbSNP
rs535638810 1662 dbSNP
rs770266 1665 dbSNP
rs1238203048 1672 dbSNP
rs1373464525 1679 dbSNP
rs1484317339 1679 dbSNP
rs1180182168 1680 dbSNP
rs567281137 1682 dbSNP
rs1429601859 1684 dbSNP
rs1173390906 1688 dbSNP
rs1466235545 1690 dbSNP
rs1465367124 1693 dbSNP
rs115488608 1699 dbSNP
rs1359365449 1700 dbSNP
rs1449642840 1701 dbSNP
rs1300534235 1702 dbSNP
rs184305183 1703 dbSNP
rs1400560435 1704 dbSNP
rs1167735364 1706 dbSNP
rs1477187611 1714 dbSNP
rs753343199 1719 dbSNP
rs1279678870 1721 dbSNP
rs766060515 1730 dbSNP
rs1035576295 1740 dbSNP
rs1325362 1742 dbSNP
rs114343516 1747 dbSNP
rs1196471998 1752 dbSNP
rs1201327756 1753 dbSNP
rs1477730937 1756 dbSNP
rs536850 1759 dbSNP
rs1249793698 1770 dbSNP
rs934235559 1775 dbSNP
rs1425477906 1776 dbSNP
rs947191363 1786 dbSNP
rs1000211024 1795 dbSNP
rs1358085380 1799 dbSNP
rs193151498 1801 dbSNP
rs1318759668 1802 dbSNP
rs1419704801 1815 dbSNP
rs1300033532 1822 dbSNP
rs1338322314 1824 dbSNP
rs1399224448 1829 dbSNP
rs1275193444 1830 dbSNP
rs1280159671 1831 dbSNP
rs559310023 1834 dbSNP
rs1278095350 1836 dbSNP
rs1053605736 1837 dbSNP
rs1284564184 1840 dbSNP
rs944059265 1851 dbSNP
rs878927145 1853 dbSNP
rs758989524 1865 dbSNP
rs1012483144 1866 dbSNP
rs1248842491 1870 dbSNP
rs1311760322 1871 dbSNP
rs763167365 1875 dbSNP
rs541371604 1883 dbSNP
rs896355056 1884 dbSNP
rs529878307 1888 dbSNP
rs1159911096 1900 dbSNP
rs137859974 1904 dbSNP
rs550505713 1905 dbSNP
rs932859631 1909 dbSNP
rs1004594908 1913 dbSNP
rs1351405395 1915 dbSNP
rs920105243 1918 dbSNP
rs974290678 1920 dbSNP
rs145243368 1925 dbSNP
rs35371927 1927 dbSNP
rs961828606 1930 dbSNP
rs776120136 1933 dbSNP
rs529741900 1934 dbSNP
rs959709783 1952 dbSNP
rs930327598 1957 dbSNP
rs1307205864 1983 dbSNP
rs900744400 1989 dbSNP
rs1210963113 1997 dbSNP
rs564141177 1998 dbSNP
rs1292576401 2000 dbSNP
rs545749843 2002 dbSNP
rs1450300892 2006 dbSNP
rs770194511 2010 dbSNP
rs1368347413 2022 dbSNP
rs1252030400 2030 dbSNP
rs745981317 2031 dbSNP
rs1439896857 2036 dbSNP
rs1180067663 2039 dbSNP
rs1001426758 2043 dbSNP
rs1377978076 2051 dbSNP
rs1469135005 2052 dbSNP
rs1163832836 2055 dbSNP
rs1415872633 2057 dbSNP
rs969972708 2059 dbSNP
rs1403440732 2060 dbSNP
rs1248836200 2068 dbSNP
rs572220538 2069 dbSNP
rs944861217 2070 dbSNP
rs912025900 2071 dbSNP
rs1021949094 2073 dbSNP
rs1011443539 2074 dbSNP
rs891621202 2078 dbSNP
rs1245594274 2083 dbSNP
rs1053211855 2088 dbSNP
rs1354821858 2091 dbSNP
rs560354402 2106 dbSNP
rs891144040 2107 dbSNP
rs1259131828 2114 dbSNP
rs765805180 2123 dbSNP
rs1200142289 2126 dbSNP
rs1342099841 2128 dbSNP
rs1187605466 2129 dbSNP
rs542286085 2137 dbSNP
rs771089053 2138 dbSNP
rs1049732553 2141 dbSNP
rs932618712 2145 dbSNP
rs1466939319 2149 dbSNP
rs1023550453 2151 dbSNP
rs1396033539 2156 dbSNP
rs564821333 2156 dbSNP
rs1336220319 2157 dbSNP
rs920216167 2163 dbSNP
rs1400255391 2164 dbSNP
rs1338723221 2167 dbSNP
rs1039016047 2168 dbSNP
rs1447978134 2169 dbSNP
rs1279312151 2171 dbSNP
rs990792870 2177 dbSNP
rs1217182563 2180 dbSNP
rs747269885 2184 dbSNP
rs574967867 2185 dbSNP
rs1389346881 2187 dbSNP
rs560691631 2190 dbSNP
rs959759981 2194 dbSNP
rs928371247 2198 dbSNP
rs189072118 2200 dbSNP
rs1187153116 2203 dbSNP
rs1263797297 2204 dbSNP
rs1478718635 2205 dbSNP
rs1191196408 2207 dbSNP
rs1372768260 2210 dbSNP
rs1034825130 2213 dbSNP
rs979767803 2216 dbSNP
rs1362490788 2217 dbSNP
rs1005134035 2218 dbSNP
rs1440565656 2220 dbSNP
rs1240213672 2221 dbSNP
rs148842474 2226 dbSNP
rs1451152500 2227 dbSNP
rs1268121822 2228 dbSNP
rs1027384705 2229 dbSNP
rs1299420213 2233 dbSNP
rs1210426645 2234 dbSNP
rs1021582898 2235 dbSNP
rs1342907179 2236 dbSNP
rs577098781 2237 dbSNP
rs1295341710 2240 dbSNP
rs577573562 2246 dbSNP
rs1283635220 2247 dbSNP
rs955906274 2250 dbSNP
rs994449863 2255 dbSNP
rs1209521819 2257 dbSNP
rs1031479623 2264 dbSNP
rs1286700776 2266 dbSNP
rs1365285636 2278 dbSNP
rs145519541 2291 dbSNP
rs1311051277 2315 dbSNP
rs1433823586 2316 dbSNP
rs1260811400 2317 dbSNP
rs891238358 2318 dbSNP
rs1049825735 2320 dbSNP
rs1201293042 2322 dbSNP
rs996881876 2323 dbSNP
rs1376130563 2333 dbSNP
rs1453914438 2335 dbSNP
rs1159309612 2337 dbSNP
rs898485130 2338 dbSNP
rs1330063468 2341 dbSNP
rs1362487748 2347 dbSNP
rs1038626884 2351 dbSNP
rs1391922029 2352 dbSNP
rs1388875109 2353 dbSNP
rs1039691420 2355 dbSNP
rs486763 2357 dbSNP
rs908729872 2365 dbSNP
rs1309380503 2372 dbSNP
rs1056583466 2376 dbSNP
rs1260011862 2378 dbSNP
rs1298000536 2387 dbSNP
rs1211385255 2389 dbSNP
rs934839560 2389 dbSNP
rs1468223569 2403 dbSNP
rs1179454818 2404 dbSNP
rs926016067 2411 dbSNP
rs939510528 2424 dbSNP
rs978877683 2426 dbSNP
rs1159090656 2428 dbSNP
rs1382527301 2430 dbSNP
rs1292124665 2432 dbSNP
rs1459804876 2432 dbSNP
rs778976697 2436 dbSNP
rs377711176 2437 dbSNP
rs1172063911 2444 dbSNP
rs1331525349 2448 dbSNP
rs74637050 2451 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*