miRTarBase - #MIRT023228 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POFUT1   
Synonyms DDD2, FUT12, O-FUT, O-Fuc-T, O-FucT-1, OFUCT1
Description protein O-fucosyltransferase 1
Transcript NM_015352   
Other Transcripts NM_172236   
Expression
Putative miRNA Targets on POFUT1
3'UTR of POFUT1
(miRNA target sites are highlighted)
>POFUT1|NM_015352|3'UTR
   1 TTCTGGCCGGAGCACCAGACCCTCTGATCCTGGAGGGACCAGAGTCTGAGCTGGTCCTTCCAGCCAGGCCTGGCAGCCAG
  81 AGGTGCTCCGGGATTGCAAACTCCTCTTCTCACCTGCCAAAGATGGAGAAGAGTGCCAGGGACCCCTCAAGGAGGGAGAC
 161 GCTCCATATCCCAGGGCATAGGACTTGCAGGTTCCTAGGAGCAGGAGCATCTCCCATCGCACGTGCTTTCTGCTCTTCTG
 241 GGAATTTCTCACACTGGCAAAGCAGTCCAGCCTCCGTCTTCTGGTCCACTCTGCTCTGAGCAGCCTGGGATGCTGAACTC
 321 TTCAGAGAGATTTTTTTATAGAGAGATTTCTATAATTTTGATACAAGGTCATGACTATCCTAGAACTCTCTGTGGTTTTT
 401 GAAAATCATTGAATTCTATTAATGTAGGTACCTAAAGTGACCTTAACTGAATGTGGATGAGGCTGGGGCTGGTGTGGGTC
 481 TTTTGGCTGCTTTTCAAGGTGTCCCCCAATGTGGCCCTCAAGAGCCATCCCCACTGCCTGGCCAGAGCCATTGTTGTCCC
 561 CTACTTCCTAGGCCATTTCTGGGGCTTGGGGGATGAATGCTGTCCTGTGCTGTAAACACTATGCAAATGGAAGTTATCGG
 641 TTGTGGTGCTGTGCAGCGCTCTGTGGGCGACTAAGTGCCACTCACGCAGCATGTTCCTGGCAAGGAGCACATACCATCAA
 721 GCCACACTATCATGGTATTGTTCTCACAGTCTTTTGGTGGTTGATGGCCACTGCAAACCTGGCACCATCAGATCTCTTCT
 801 GATCTCTTGCCCCAGTGGGGCCTGGTTGGTAGAATGTTGGCATTCGGTTGATATCCAAAGCCTGTTCTCCCAGCCGTCCT
 881 CCTGCAGCTGGAGCCTTCAGGCCGTATTCTCACGAGGGAACGTTTGCCAAGGCTCTGACCTCACAGAAGATGCCCAGGGC
 961 CCAGAAGCCATCAGAATTATCAGTGGAGAAGCACCTTTTGACTCTTCCCTTCCAATGTAATCTCTGCCAACACCATGAGG
1041 CTTAAGGTGCTCTAAGTCATGAGTGTTTTGGTCTCAAATGCTGCAGTTTTAATAATCTGTGACTCCTGAGAGCCCATGGT
1121 TTTTTGACCTTGTGGTTCTAAAATTCCTTGTCTGACCCCTGTAGATCTTTTCCTTGCCATGTCACCTCCCTTGGCCTTTG
1201 ATCCTGGAAAGGTGGCAGAGCCTCCACTGAGCCAGGCCCAGAGCTCCTTGCAGTGCCTTCTTCCTTGTTTACCTGTGGGA
1281 GGAAACACTTTTTTTGTCAGGGGCAGCCTGGTTCAGAGCTCAGAGGTCACACTGTATCAAAGATCTCAAACAGCAAAGTC
1361 AGCATTTGCTGTATAGAGCTGCCACCCAACTCTAAGCAGGAGAAACTGTACAGAAAGGGCTTTGCTATTTTTCCCTTTTG
1441 GGAAAACAATGAAGTGTTTTAAGTCCTGGGTGGACTGAGAGATGGTTTGCCTGTCCAGACTTGCTCTCAAGCCTCATCCA
1521 GAGAAGGAGCTGCAGATGAGGGAGCCCGTACACTCCCTGCCACCACTAGGTTGTAAGCCTGTAGCTGGCTGGCTGATTTC
1601 ATTTTGGAATTCATTTGCCATCCACAGCCTTACACTAGGCACACACTTTAGAGTCTGGGGCTCCAGTGGGGCCCGCCTAA
1681 TTTTTTTTCCCCCCAAGACAGGGCCTTGCTCTGTCTCCCAGGCTGGAGTGCAGTGGCATGATCATGGCTTACTGCAGCCT
1761 TGATCTCCCAGGCTCAAGCGATCCTTCTGCCTCAGCCTCTCTGGTAGCTGAGACTGCATGCCCAGCTCCAAATCACCTTG
1841 ATTCATATCAGCAGTAATAATCACTTGTGTTCTGAAAGAAAGGGCACCAGAAGTTCTAGCAAAATTCAGTTGTGTTCTGT
1921 GAGCTAGCACTTTTTCCTCTGACCCAATTTTCTTACCTATAAAATGGTGATAAAAACCGACAGGTTGTTCAAAGGCCCAG
2001 ATCAGCTAAAGCATGTATATAAGAGCACGTTGTAAACTTGAAAGAGACAAAGGCACAAATGTGGCTGTTGATTAATTTGA
2081 CTGCTTCTCGTTGCTCGTCACCTCCATGCCAGGCACTGTGCTTGCTAATTGCTTTATGGGGGCATTCTCTTATTTATTCC
2161 CCAGCCCTGGGAAATAGGAGCTGTCATTATCCTTCTCTTTCTGCACAAGGAAAAATTAATGCCCTGAGAATTGTCATAAT
2241 TTTCCCAAGGCTGCCCAGCTGGTGGTGTTAAGCCAGAATTTGACCTCCCAGAGCCAGTTTCCATTAGCTGCCATGCTCTG
2321 CTGCCTCTAATTCACAGAATGCACTTTCTACCCTGTGTGCCATGGAGACCTCCTATGGAAAAATGATCAGCCACCTTACC
2401 TTCTACTGGGTACCTGCTGTGAGTCTGCCTATGCCAGAAGGATTAAGGAGGGGAGGTTACCCAAGAAACAAAGCCTACAT
2481 GCCGCTTACAGCCCCCGTTGGATGGTTGCTCAGTACAACAGTCTTGCATTCAGCAGGTGTTTGTTCATCACCTACTATGT
2561 GTCAGGCTCTATGCTAGGTACTGGGGATACAGGAGAGAATCAAGCGTAAAGTCTTTGTTCTCAAGGAATTTGCATTCTAG
2641 AAAGTAGAAGATGTAATAAATGTACTGTGGGACATGTTAATAAGTGCTATAAAGAAATATAAAGGGTTTGGGAGCAAAAA
2721 GAGGGAGTGGATCTATTTTAGATGAGCCCAGGTAAGACCTCTCTGAAGAGCTGTCATGAAGGAGGGAGGGAGCACATTCC
2801 TGGCAGAGAAAACAGCACGTGCAAAGGCCCCGAGACTGGAGTGTGTTCCTGAAGAGCAGCCAGGAGGCCAGCATGGCTGG
2881 AGAGGCAGGCATAGGCAGGGAACCGAGCAGCAGGTCAGAGCAGGCGAGCTGACATTCTGCAGCCTGGACGGCCATGGCAG
2961 GAAGCTTTTAGTTGGAGAGATACAGGAAGCCTCCTAGGGTTCTGAGCAGAAGAGGGGCATGAGCTGATTCACATTCTGAA
3041 GGACCTCTCTAGCTGGCCAGTGCTGAGGAGGTTGGAGAGAGAAAGGGTGAAAGCAGAGAGACCAGTGCAGGGCTGTTAAC
3121 AGGGTTGCAGGCGAGAGACTGGGGTGCTGGGCTCCCCTAGACTAGGACTCCAGTGCCCTCCTCTCCCAAGAGACAAAGGC
3201 CATTGCATTGAAGGAGGTGGGAAATGATTAGATTCTGAACATATGTAATTATTTTTCAGTCTTTTTCAAAGATACAAATA
3281 TTTACATAGTTTTAATCATGTAATATATACAATTTAATGTCCTAGTGTTTTACTTAATAGTGTATCATGTTTTCCCTGTT
3361 GGTATGTAGCCTGGATAAATGCTCTTAATTATAAAAAATTCTGTCGAGGAGTGTTCCATAGTTTATTGTTTTCCTATTAT
3441 GAGAATTTAGGCCAAGTGTGGTGGCTCATGCCTGTAATCCCAGCACTTTGCGAGGCCGAGGTGGGCAGATCACTTGAGGT
3521 GAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAATTATCTCTACTAAAAATACAAAAAAATAATAATAATAGCCAGGCG
3601 TGGTGGCACATGCCTGTATTCCCAGCTGCTTGGGAGGCTGAGGCAGGAGAATGGCTTGAACCTGGGAGGTGGAGGTTGCA
3681 GTGAGCCGAGATGGTGCCACTGCATTCCAGCCTGGGCAACAGAGCGAGACTCCATCTCAAAAAAAAGGAGACTTCATGTG
3761 CCCCCAATTTTTCACTATTGTTATTTGAAAAAATATTTTTATTTGTAAGAGTTTTTCTTTATTTAAAATGTTCATTAATA
3841 AAGTTGTTGGACGGGAAGCAAAAAAAAAAAGTTGTTTAAGATAAATTCCCAGAAGTGAATTTGTTAGATCAAACACTTAA
3921 AACTTTTTGTTATGGAAGAATTCAAATATAAATAAAAAATTGTGAGTAATAAAATGAACTCACAGTTTCAACAATGACCC
4001 ACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:| ||:|    ||||||| 
Target 5' ggAGC-CCGT----ACACTCCc 3'
1541 - 1557 145.00 -14.70
2
miRNA  3' guuugugguaacaGUGUGAGGu 5'
                       ||||:||| 
Target 5' aggagggagggagCACATTCCt 3'
2780 - 2801 129.00 -11.20
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||||:|    ||||||:: 
Target 5' cttACACTAGGCACACACTTTa 3'
1629 - 1650 127.00 -16.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30491574 25 COSMIC
COSN30469613 47 COSMIC
COSN30101313 50 COSMIC
COSN30119683 94 COSMIC
COSN30121169 102 COSMIC
COSN30150261 123 COSMIC
COSN31516992 417 COSMIC
COSN31545791 488 COSMIC
COSN31546560 580 COSMIC
COSN26562284 589 COSMIC
COSN21574184 881 COSMIC
COSN15928714 894 COSMIC
COSN21602452 932 COSMIC
COSN8995110 986 COSMIC
COSN28202096 1010 COSMIC
COSN1869714 1027 COSMIC
COSN9125734 1267 COSMIC
COSN32062948 1722 COSMIC
COSN27629014 1785 COSMIC
COSN21345936 2117 COSMIC
COSN29195785 2121 COSMIC
COSN17183021 2513 COSMIC
COSN20079636 2872 COSMIC
COSN30116686 2998 COSMIC
COSN31606398 3001 COSMIC
COSN30702150 3016 COSMIC
COSN31512678 3016 COSMIC
COSN30109868 3042 COSMIC
COSN26584368 3064 COSMIC
COSN30522339 3066 COSMIC
COSN30495605 3067 COSMIC
COSN31610511 3086 COSMIC
COSN30478663 3114 COSMIC
COSN2378757 3139 COSMIC
COSN1869716 3159 COSMIC
COSN20079773 3173 COSMIC
COSN31500788 3187 COSMIC
COSN30123036 3219 COSMIC
COSN22256201 3241 COSMIC
COSN17382417 3310 COSMIC
COSN5442914 3334 COSMIC
COSN21672199 3624 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760860002 2 dbSNP
rs369814048 9 dbSNP
rs200160144 10 dbSNP
rs759461335 12 dbSNP
rs1271113726 13 dbSNP
rs760130403 13 dbSNP
rs1339221574 14 dbSNP
rs919249163 21 dbSNP
rs939899363 23 dbSNP
rs1037063682 25 dbSNP
rs747826249 26 dbSNP
rs765226682 31 dbSNP
rs769769211 32 dbSNP
rs1057216369 35 dbSNP
rs1431832184 39 dbSNP
rs372843982 52 dbSNP
rs1186877921 55 dbSNP
rs1472383837 73 dbSNP
rs1235533995 74 dbSNP
rs550384798 90 dbSNP
rs568677693 91 dbSNP
rs1206272926 94 dbSNP
rs17123085 100 dbSNP
rs1273352708 103 dbSNP
rs1227386967 107 dbSNP
rs775419913 112 dbSNP
rs551293268 114 dbSNP
rs566753488 123 dbSNP
rs1350458540 124 dbSNP
rs1306242182 125 dbSNP
rs1000054382 126 dbSNP
rs1000388757 143 dbSNP
rs1164273103 150 dbSNP
rs1403833090 159 dbSNP
rs533976527 161 dbSNP
rs59745045 162 dbSNP
rs1010438752 174 dbSNP
rs1251063002 176 dbSNP
rs1179381990 179 dbSNP
rs1020613901 180 dbSNP
rs527710695 187 dbSNP
rs1232968359 188 dbSNP
rs1220312761 199 dbSNP
rs1029381698 202 dbSNP
rs1455770522 207 dbSNP
rs1319978093 208 dbSNP
rs574051612 210 dbSNP
rs1389393560 214 dbSNP
rs1437929360 216 dbSNP
rs763305158 217 dbSNP
rs976352830 221 dbSNP
rs74585664 223 dbSNP
rs774584748 224 dbSNP
rs1293045735 242 dbSNP
rs192530454 250 dbSNP
rs973625584 252 dbSNP
rs983993592 256 dbSNP
rs929254934 263 dbSNP
rs1313588437 264 dbSNP
rs182089964 270 dbSNP
rs939953986 277 dbSNP
rs948794626 282 dbSNP
rs1044263799 283 dbSNP
rs1487288557 286 dbSNP
rs1254561628 295 dbSNP
rs1214706168 299 dbSNP
rs1464679247 302 dbSNP
rs1266647158 310 dbSNP
rs1211078675 311 dbSNP
rs1318087016 315 dbSNP
rs1210555999 324 dbSNP
rs1300645412 324 dbSNP
rs1036953972 325 dbSNP
rs1488066171 330 dbSNP
rs1304355391 331 dbSNP
rs935938724 342 dbSNP
rs1387576013 353 dbSNP
rs1191548920 376 dbSNP
rs1426922942 380 dbSNP
rs1052927237 386 dbSNP
rs1174734672 391 dbSNP
rs534366720 400 dbSNP
rs1158642784 409 dbSNP
rs545615546 417 dbSNP
rs1448529577 429 dbSNP
rs1246538140 441 dbSNP
rs1188705181 450 dbSNP
rs1412831978 452 dbSNP
rs560806847 463 dbSNP
rs1044769575 466 dbSNP
rs997841558 468 dbSNP
rs1208646248 473 dbSNP
rs572660326 478 dbSNP
rs905969166 486 dbSNP
rs1281154850 491 dbSNP
rs1322201039 502 dbSNP
rs936068721 507 dbSNP
rs1029740736 509 dbSNP
rs1054661425 510 dbSNP
rs889567909 511 dbSNP
rs1007038981 512 dbSNP
rs1302128275 516 dbSNP
rs372372820 518 dbSNP
rs879034593 521 dbSNP
rs561699661 525 dbSNP
rs1376694367 526 dbSNP
rs1017787068 528 dbSNP
rs1428676959 533 dbSNP
rs1019164842 538 dbSNP
rs139595923 541 dbSNP
rs973655289 548 dbSNP
rs1026536287 559 dbSNP
rs997826763 560 dbSNP
rs1486959385 564 dbSNP
rs1258280308 572 dbSNP
rs760909561 578 dbSNP
rs1204587125 583 dbSNP
rs1028389659 584 dbSNP
rs550298820 590 dbSNP
rs1253373825 593 dbSNP
rs867671602 608 dbSNP
rs984270637 615 dbSNP
rs992864728 622 dbSNP
rs1311773431 623 dbSNP
rs1394182607 630 dbSNP
rs1016645044 639 dbSNP
rs562225546 640 dbSNP
rs1312939287 643 dbSNP
rs961207302 652 dbSNP
rs756757778 658 dbSNP
rs1222140637 659 dbSNP
rs972531360 669 dbSNP
rs145111420 670 dbSNP
rs980569854 679 dbSNP
rs1181780686 686 dbSNP
rs1252787121 687 dbSNP
rs925811289 695 dbSNP
rs1163170547 701 dbSNP
rs1473647354 704 dbSNP
rs186584590 709 dbSNP
rs980153202 716 dbSNP
rs1161531666 726 dbSNP
rs1181547174 732 dbSNP
rs761160725 733 dbSNP
rs936136479 741 dbSNP
rs1488298428 744 dbSNP
rs769130149 745 dbSNP
rs1406479324 748 dbSNP
rs1054954074 749 dbSNP
rs1231284803 756 dbSNP
rs1336844590 769 dbSNP
rs1293759011 778 dbSNP
rs1227723235 784 dbSNP
rs891754603 785 dbSNP
rs1330341909 786 dbSNP
rs891849149 793 dbSNP
rs1391581730 795 dbSNP
rs1389629745 810 dbSNP
rs1292134323 811 dbSNP
rs566661630 830 dbSNP
rs933892462 835 dbSNP
rs1429482806 836 dbSNP
rs766895559 846 dbSNP
rs534043658 847 dbSNP
rs1471910669 855 dbSNP
rs1040497640 861 dbSNP
rs902128179 864 dbSNP
rs1365571262 868 dbSNP
rs996819616 869 dbSNP
rs549130561 870 dbSNP
rs1350722107 873 dbSNP
rs746255444 875 dbSNP
rs777102785 876 dbSNP
rs1028022974 877 dbSNP
rs1265611843 883 dbSNP
rs889447725 894 dbSNP
rs1005183827 904 dbSNP
rs1017108074 905 dbSNP
rs567762517 914 dbSNP
rs567616043 915 dbSNP
rs1281938231 922 dbSNP
rs113611428 923 dbSNP
rs1017057544 925 dbSNP
rs961091589 927 dbSNP
rs1239213424 943 dbSNP
rs1330143910 951 dbSNP
rs1377748975 952 dbSNP
rs1442671091 988 dbSNP
rs972583337 994 dbSNP
rs1320344853 996 dbSNP
rs1456085434 1008 dbSNP
rs1387843741 1015 dbSNP
rs1024130639 1017 dbSNP
rs1465546962 1018 dbSNP
rs971335884 1035 dbSNP
rs1376010585 1036 dbSNP
rs538227825 1040 dbSNP
rs980422395 1041 dbSNP
rs766799420 1042 dbSNP
rs1195679697 1046 dbSNP
rs995041419 1048 dbSNP
rs927190856 1050 dbSNP
rs1187753309 1053 dbSNP
rs1445197739 1060 dbSNP
rs1339865768 1066 dbSNP
rs1286340682 1071 dbSNP
rs556722172 1085 dbSNP
rs578138413 1086 dbSNP
rs936009783 1097 dbSNP
rs1277607365 1106 dbSNP
rs539245774 1113 dbSNP
rs754173599 1118 dbSNP
rs1297300877 1137 dbSNP
rs1429141333 1148 dbSNP
rs755284909 1159 dbSNP
rs192463307 1167 dbSNP
rs1473145995 1174 dbSNP
rs1373667384 1175 dbSNP
rs1184159355 1182 dbSNP
rs1435546091 1185 dbSNP
rs1389847133 1187 dbSNP
rs1167722945 1189 dbSNP
rs1040549880 1190 dbSNP
rs147575415 1195 dbSNP
rs1243647468 1197 dbSNP
rs926072602 1211 dbSNP
rs56245555 1212 dbSNP
rs1254740307 1219 dbSNP
rs1212464115 1223 dbSNP
rs932291056 1226 dbSNP
rs1273375706 1231 dbSNP
rs1212453581 1240 dbSNP
rs1341848720 1250 dbSNP
rs988629188 1252 dbSNP
rs1051126880 1259 dbSNP
rs1411321468 1260 dbSNP
rs913053877 1261 dbSNP
rs554951350 1263 dbSNP
rs1314822317 1268 dbSNP
rs1005647616 1273 dbSNP
rs34888967 1289 dbSNP
rs1358111550 1299 dbSNP
rs1051432108 1308 dbSNP
rs573612814 1315 dbSNP
rs1327033270 1327 dbSNP
rs1038022810 1329 dbSNP
rs1317146861 1330 dbSNP
rs896934337 1334 dbSNP
rs910894844 1339 dbSNP
rs1362940970 1340 dbSNP
rs942327930 1359 dbSNP
rs1415667142 1375 dbSNP
rs1189982292 1386 dbSNP
rs1485678320 1390 dbSNP
rs1250450075 1393 dbSNP
rs1201954558 1400 dbSNP
rs1439232887 1401 dbSNP
rs1274124694 1407 dbSNP
rs543805422 1409 dbSNP
rs1038034582 1410 dbSNP
rs751153243 1412 dbSNP
rs562281752 1422 dbSNP
rs532820180 1428 dbSNP
rs1295580869 1439 dbSNP
rs1227491198 1455 dbSNP
rs1024181594 1458 dbSNP
rs898270727 1461 dbSNP
rs544804793 1464 dbSNP
rs1277888895 1465 dbSNP
rs1341154790 1465 dbSNP
rs1444600794 1467 dbSNP
rs1198984496 1468 dbSNP
rs993902832 1470 dbSNP
rs1329287145 1476 dbSNP
rs1460663353 1477 dbSNP
rs1278151390 1478 dbSNP
rs1443132885 1480 dbSNP
rs1166946509 1481 dbSNP
rs1475510887 1483 dbSNP
rs1205636358 1485 dbSNP
rs1406567267 1486 dbSNP
rs1047936818 1490 dbSNP
rs886581781 1493 dbSNP
rs971219293 1501 dbSNP
rs1233168566 1504 dbSNP
rs1220381958 1507 dbSNP
rs1001344182 1510 dbSNP
rs6087842 1514 dbSNP
rs1214822915 1518 dbSNP
rs1034694967 1522 dbSNP
rs146918751 1527 dbSNP
rs1329124083 1528 dbSNP
rs1304937426 1537 dbSNP
rs957288334 1543 dbSNP
rs1374148301 1545 dbSNP
rs990580962 1548 dbSNP
rs913223718 1549 dbSNP
rs1368461311 1553 dbSNP
rs1327715163 1554 dbSNP
rs967470418 1556 dbSNP
rs1001980108 1557 dbSNP
rs780740103 1558 dbSNP
rs976135550 1572 dbSNP
rs1156306772 1579 dbSNP
rs1424014849 1592 dbSNP
rs1408090224 1593 dbSNP
rs560263635 1596 dbSNP
rs1338141354 1614 dbSNP
rs1385736657 1617 dbSNP
rs527606252 1619 dbSNP
rs550364167 1633 dbSNP
rs1050592940 1634 dbSNP
rs909478086 1635 dbSNP
rs549292658 1641 dbSNP
rs1259558268 1647 dbSNP
rs1218570392 1648 dbSNP
rs745866949 1650 dbSNP
rs1278042193 1656 dbSNP
rs1321100203 1659 dbSNP
rs1232326188 1660 dbSNP
rs1350384200 1661 dbSNP
rs896820522 1666 dbSNP
rs1305341686 1667 dbSNP
rs762116000 1668 dbSNP
rs993793019 1673 dbSNP
rs1045513949 1674 dbSNP
rs149031311 1675 dbSNP
rs1345227175 1676 dbSNP
rs553317905 1681 dbSNP
rs913087967 1681 dbSNP
rs1001795140 1684 dbSNP
rs1345980671 1686 dbSNP
rs1034170756 1689 dbSNP
rs1428226263 1689 dbSNP
rs8122822 1690 dbSNP
rs957547122 1698 dbSNP
rs986745274 1699 dbSNP
rs1208893270 1706 dbSNP
rs1464465938 1707 dbSNP
rs1209945995 1714 dbSNP
rs1011441096 1716 dbSNP
rs1020281645 1717 dbSNP
rs1450303969 1722 dbSNP
rs41288632 1723 dbSNP
rs942612573 1733 dbSNP
rs976026205 1734 dbSNP
rs1038070562 1735 dbSNP
rs1362638505 1738 dbSNP
rs919561210 1742 dbSNP
rs923375293 1745 dbSNP
rs1412460651 1746 dbSNP
rs1376753405 1750 dbSNP
rs1478160498 1756 dbSNP
rs780041738 1778 dbSNP
rs1461196793 1780 dbSNP
rs571773700 1781 dbSNP
rs1371664138 1785 dbSNP
rs909372824 1792 dbSNP
rs942314623 1796 dbSNP
rs8122880 1800 dbSNP
rs41288634 1802 dbSNP
rs1429613363 1804 dbSNP
rs1456223897 1806 dbSNP
rs189783017 1806 dbSNP
rs193023120 1809 dbSNP
rs1046807367 1811 dbSNP
rs184581089 1815 dbSNP
rs189336614 1824 dbSNP
rs1243919644 1841 dbSNP
rs1014869421 1848 dbSNP
rs536426284 1849 dbSNP
rs929643266 1855 dbSNP
rs1045403961 1857 dbSNP
rs6058573 1864 dbSNP
rs1286646880 1866 dbSNP
rs937095781 1870 dbSNP
rs539338185 1883 dbSNP
rs1056068714 1885 dbSNP
rs1292532477 1890 dbSNP
rs752661137 1898 dbSNP
rs892967899 1905 dbSNP
rs1356767285 1909 dbSNP
rs758651407 1910 dbSNP
rs1229068183 1912 dbSNP
rs1001782811 1922 dbSNP
rs749118925 1934 dbSNP
rs1300260276 1939 dbSNP
rs903084748 1948 dbSNP
rs997496446 1958 dbSNP
rs1163343611 1964 dbSNP
rs367983382 1979 dbSNP
rs1268523635 1980 dbSNP
rs1421789755 1983 dbSNP
rs1417545288 1984 dbSNP
rs1490932260 1987 dbSNP
rs1201190515 1991 dbSNP
rs151227331 1993 dbSNP
rs555691087 1996 dbSNP
rs8122976 1997 dbSNP
rs1272347844 2014 dbSNP
rs1211705635 2015 dbSNP
rs955478383 2018 dbSNP
rs1181906659 2020 dbSNP
rs1364963656 2027 dbSNP
rs577338423 2030 dbSNP
rs1308622442 2037 dbSNP
rs1391636927 2041 dbSNP
rs987079648 2057 dbSNP
rs1018091609 2058 dbSNP
rs1463457215 2059 dbSNP
rs764177716 2061 dbSNP
rs1158067655 2062 dbSNP
rs141223071 2067 dbSNP
rs1451642962 2068 dbSNP
rs1300754920 2069 dbSNP
rs41288636 2080 dbSNP
rs1182746819 2082 dbSNP
rs1016721249 2090 dbSNP
rs181994021 2091 dbSNP
rs1426291637 2096 dbSNP
rs982436207 2097 dbSNP
rs1350098370 2098 dbSNP
rs1410596360 2104 dbSNP
rs972194846 2111 dbSNP
rs949144407 2121 dbSNP
rs140363751 2136 dbSNP
rs949599627 2141 dbSNP
rs937613282 2152 dbSNP
rs1054598877 2154 dbSNP
rs981134934 2171 dbSNP
rs1244745396 2175 dbSNP
rs748345599 2178 dbSNP
rs1020242253 2184 dbSNP
rs145488524 2198 dbSNP
rs6058574 2203 dbSNP
rs6119785 2210 dbSNP
rs572728855 2213 dbSNP
rs947240998 2218 dbSNP
rs963871401 2224 dbSNP
rs973993394 2228 dbSNP
rs1175761677 2234 dbSNP
rs1455373697 2235 dbSNP
rs1041513292 2237 dbSNP
rs376853385 2239 dbSNP
rs1026935794 2257 dbSNP
rs903135588 2259 dbSNP
rs773280306 2268 dbSNP
rs997380390 2269 dbSNP
rs550222188 2272 dbSNP
rs982467280 2283 dbSNP
rs73903581 2295 dbSNP
rs889123575 2297 dbSNP
rs1236063961 2299 dbSNP
rs761213610 2315 dbSNP
rs1346097223 2341 dbSNP
rs533819738 2353 dbSNP
rs749236805 2354 dbSNP
rs137998077 2360 dbSNP
rs62207424 2363 dbSNP
rs1315068956 2364 dbSNP
rs1415226533 2371 dbSNP
rs993692553 2376 dbSNP
rs1054545955 2389 dbSNP
rs1026472834 2390 dbSNP
rs754596520 2393 dbSNP
rs1395506785 2396 dbSNP
rs893431149 2402 dbSNP
rs759820585 2406 dbSNP
rs1314142685 2412 dbSNP
rs946285846 2414 dbSNP
rs1474625947 2419 dbSNP
rs1254741884 2421 dbSNP
rs1212622051 2424 dbSNP
rs1442594566 2426 dbSNP
rs1272762242 2430 dbSNP
rs547900613 2432 dbSNP
rs1341908207 2434 dbSNP
rs971004560 2443 dbSNP
rs1233188193 2448 dbSNP
rs1353685751 2456 dbSNP
rs117907228 2457 dbSNP
rs566040789 2461 dbSNP
rs1354096375 2468 dbSNP
rs1297348788 2471 dbSNP
rs1327941637 2475 dbSNP
rs1408064700 2476 dbSNP
rs1018324189 2480 dbSNP
rs899909014 2485 dbSNP
rs536894836 2487 dbSNP
rs751227378 2490 dbSNP
rs995377261 2492 dbSNP
rs926829946 2493 dbSNP
rs1252678173 2495 dbSNP
rs958406225 2496 dbSNP
rs756930425 2497 dbSNP
rs554820961 2498 dbSNP
rs570014419 2505 dbSNP
rs1439970683 2513 dbSNP
rs991534173 2514 dbSNP
rs1025080365 2519 dbSNP
rs766974733 2532 dbSNP
rs1243149299 2533 dbSNP
rs1333266834 2541 dbSNP
rs529403523 2547 dbSNP
rs1228894622 2555 dbSNP
rs1372693016 2556 dbSNP
rs1278058228 2557 dbSNP
rs142901592 2558 dbSNP
rs980939507 2570 dbSNP
rs926429839 2572 dbSNP
rs1392123244 2575 dbSNP
rs947124900 2577 dbSNP
rs1405505427 2586 dbSNP
rs1406583171 2587 dbSNP
rs1041566226 2592 dbSNP
rs1389357739 2593 dbSNP
rs541477390 2598 dbSNP
rs1239196204 2603 dbSNP
rs145049524 2605 dbSNP
rs577251922 2606 dbSNP
rs186519409 2607 dbSNP
rs1222928944 2608 dbSNP
rs1316460176 2608 dbSNP
rs376251949 2615 dbSNP
rs1038091086 2624 dbSNP
rs1309724565 2626 dbSNP
rs899279138 2629 dbSNP
rs1439985021 2638 dbSNP
rs1368502844 2646 dbSNP
rs1295273778 2648 dbSNP
rs1437070529 2648 dbSNP
rs993574813 2652 dbSNP
rs1421150583 2660 dbSNP
rs1380459162 2661 dbSNP
rs780174670 2663 dbSNP
rs138762395 2667 dbSNP
rs542809941 2669 dbSNP
rs899941615 2674 dbSNP
rs1192322562 2678 dbSNP
rs533483298 2679 dbSNP
rs1033948921 2681 dbSNP
rs1485802339 2686 dbSNP
rs1048271810 2699 dbSNP
rs959871216 2699 dbSNP
rs1488657597 2706 dbSNP
rs886917148 2707 dbSNP
rs1340525487 2713 dbSNP
rs1279956367 2720 dbSNP
rs1216675437 2723 dbSNP
rs1232345074 2728 dbSNP
rs1297356880 2735 dbSNP
rs1303087229 2736 dbSNP
rs188218035 2736 dbSNP
rs544435217 2737 dbSNP
rs1263245179 2747 dbSNP
rs1286616436 2749 dbSNP
rs1401380546 2752 dbSNP
rs971045086 2753 dbSNP
rs1311941287 2759 dbSNP
rs1206791525 2769 dbSNP
rs368694498 2771 dbSNP
rs754743150 2772 dbSNP
rs1486107196 2777 dbSNP
rs1418076184 2778 dbSNP
rs1428450680 2778 dbSNP
rs778759869 2788 dbSNP
rs576422290 2793 dbSNP
rs6087843 2795 dbSNP
rs1196456796 2801 dbSNP
rs543776814 2806 dbSNP
rs148042194 2809 dbSNP
rs1264926580 2812 dbSNP
rs1484331817 2818 dbSNP
rs565157842 2819 dbSNP
rs1210479589 2820 dbSNP
rs1306702373 2827 dbSNP
rs977141560 2828 dbSNP
rs1220365955 2830 dbSNP
rs181028344 2832 dbSNP
rs914742863 2833 dbSNP
rs772308834 2840 dbSNP
rs1380811277 2842 dbSNP
rs149350926 2846 dbSNP
rs1461850772 2850 dbSNP
rs1346302744 2855 dbSNP
rs1353100092 2859 dbSNP
rs1433421178 2859 dbSNP
rs1292161316 2861 dbSNP
rs1417278188 2865 dbSNP
rs910496059 2876 dbSNP
rs1185823717 2881 dbSNP
rs1367284372 2885 dbSNP
rs559803233 2886 dbSNP
rs943270211 2892 dbSNP
rs1283492792 2896 dbSNP
rs773332215 2905 dbSNP
rs944268817 2906 dbSNP
rs899163389 2924 dbSNP
rs186530633 2926 dbSNP
rs747119538 2927 dbSNP
rs1048469648 2939 dbSNP
rs1313053008 2942 dbSNP
rs886949767 2950 dbSNP
rs906587064 2951 dbSNP
rs770927967 2954 dbSNP
rs1394305667 2968 dbSNP
rs1488016143 2971 dbSNP
rs1003733815 2973 dbSNP
rs1034250118 2977 dbSNP
rs895432937 2982 dbSNP
rs548783492 2984 dbSNP
rs1181556264 2986 dbSNP
rs1408736910 2992 dbSNP
rs1417511765 2993 dbSNP
rs1236155798 3013 dbSNP
rs1180210306 3014 dbSNP
rs777131569 3016 dbSNP
rs968361535 3018 dbSNP
rs1207970108 3019 dbSNP
rs1402975695 3020 dbSNP
rs1163244065 3032 dbSNP
rs1237907962 3034 dbSNP
rs1350980426 3037 dbSNP
rs1311923921 3045 dbSNP
rs1349704947 3050 dbSNP
rs1324528484 3058 dbSNP
rs569879353 3059 dbSNP
rs906476562 3064 dbSNP
rs537230680 3072 dbSNP
rs375957703 3084 dbSNP
rs1230894687 3089 dbSNP
rs561988370 3092 dbSNP
rs753497783 3095 dbSNP
rs762548284 3104 dbSNP
rs1288308721 3105 dbSNP
rs369143833 3106 dbSNP
rs1382326932 3108 dbSNP
rs1159463788 3111 dbSNP
rs751305441 3112 dbSNP
rs756955616 3116 dbSNP
rs1452949077 3118 dbSNP
rs1247025737 3123 dbSNP
rs1463218729 3125 dbSNP
rs780630655 3128 dbSNP
rs1033322809 3129 dbSNP
rs754256995 3130 dbSNP
rs1477424443 3131 dbSNP
rs191192342 3133 dbSNP
rs1020692431 3134 dbSNP
rs779493641 3134 dbSNP
rs377488657 3138 dbSNP
rs759158523 3140 dbSNP
rs772238882 3141 dbSNP
rs1437490280 3142 dbSNP
rs1321505463 3143 dbSNP
rs1330562695 3146 dbSNP
rs540451624 3147 dbSNP
rs1277109615 3152 dbSNP
rs987353358 3157 dbSNP
rs369204612 3158 dbSNP
rs1228320842 3160 dbSNP
rs747292939 3165 dbSNP
rs1236093531 3168 dbSNP
rs765619793 3177 dbSNP
rs965670195 3178 dbSNP
rs771140373 3180 dbSNP
rs776769146 3181 dbSNP
rs759389652 3182 dbSNP
rs769427912 3184 dbSNP
rs753067707 3198 dbSNP
rs144664105 3200 dbSNP
rs183492011 3201 dbSNP
rs1325784923 3202 dbSNP
rs763753162 3208 dbSNP
rs1299079529 3215 dbSNP
rs751109062 3217 dbSNP
rs1390364714 3222 dbSNP
rs761338048 3223 dbSNP
rs921268839 3230 dbSNP
rs78443180 3234 dbSNP
rs1331768155 3237 dbSNP
rs1293586300 3238 dbSNP
rs17123088 3245 dbSNP
rs1378200370 3256 dbSNP
rs760071503 3267 dbSNP
rs1047738045 3268 dbSNP
rs906644295 3272 dbSNP
rs1264667756 3274 dbSNP
rs1216924878 3276 dbSNP
rs908667932 3287 dbSNP
rs1233556331 3291 dbSNP
rs940083054 3301 dbSNP
rs563085385 3303 dbSNP
rs142649615 3305 dbSNP
rs576334401 3311 dbSNP
rs543641527 3325 dbSNP
rs1055336430 3326 dbSNP
rs906332801 3333 dbSNP
rs937943123 3335 dbSNP
rs77666766 3341 dbSNP
rs78617932 3342 dbSNP
rs1338856164 3344 dbSNP
rs1054931507 3348 dbSNP
rs1336398469 3355 dbSNP
rs895305316 3363 dbSNP
rs1416019526 3373 dbSNP
rs1402614720 3374 dbSNP
rs1167301720 3375 dbSNP
rs1463964710 3385 dbSNP
rs1425177789 3387 dbSNP
rs1193678331 3388 dbSNP
rs1235445153 3393 dbSNP
rs893715600 3393 dbSNP
rs1445691094 3397 dbSNP
rs567065958 3402 dbSNP
rs1011039386 3407 dbSNP
rs1022515064 3412 dbSNP
rs1010566154 3417 dbSNP
rs185923617 3419 dbSNP
rs73108527 3420 dbSNP
rs553428837 3421 dbSNP
rs954521835 3426 dbSNP
rs987626143 3428 dbSNP
rs965890390 3432 dbSNP
rs767298813 3433 dbSNP
rs964910866 3437 dbSNP
rs368069970 3440 dbSNP
rs1443721842 3441 dbSNP
rs952939605 3442 dbSNP
rs1171289268 3458 dbSNP
rs1402283643 3458 dbSNP
rs984146809 3458 dbSNP
rs1404302977 3459 dbSNP
rs1410955148 3465 dbSNP
rs973205354 3469 dbSNP
rs920529706 3471 dbSNP
rs1164670290 3487 dbSNP
rs559457882 3492 dbSNP
rs1246549011 3493 dbSNP
rs1459366850 3498 dbSNP
rs750057995 3499 dbSNP
rs1316923353 3502 dbSNP
rs1449977293 3507 dbSNP
rs1339758026 3509 dbSNP
rs760268384 3513 dbSNP
rs771789279 3517 dbSNP
rs765929454 3522 dbSNP
rs1273950514 3532 dbSNP
rs1439694012 3540 dbSNP
rs1208641602 3548 dbSNP
rs982563231 3549 dbSNP
rs1332010681 3560 dbSNP
rs1461812832 3575 dbSNP
rs927825428 3578 dbSNP
rs753778625 3580 dbSNP
rs937874574 3580 dbSNP
rs190613659 3583 dbSNP
rs1388512521 3584 dbSNP
rs983485452 3588 dbSNP
rs915180956 3592 dbSNP
rs1167049996 3599 dbSNP
rs927950784 3600 dbSNP
rs946622331 3601 dbSNP
rs1419972861 3602 dbSNP
rs1222311160 3603 dbSNP
rs1446493202 3610 dbSNP
rs1284210444 3612 dbSNP
rs1219042267 3628 dbSNP
rs1355632998 3640 dbSNP
rs1042048797 3643 dbSNP
rs1218594462 3647 dbSNP
rs1365326670 3650 dbSNP
rs1276542733 3659 dbSNP
rs1436645292 3663 dbSNP
rs1411520664 3667 dbSNP
rs1359328682 3669 dbSNP
rs897295809 3671 dbSNP
rs1421096555 3673 dbSNP
rs1008650849 3675 dbSNP
rs1452689506 3676 dbSNP
rs1431949435 3677 dbSNP
rs939327820 3688 dbSNP
rs1192264779 3701 dbSNP
rs1040493731 3705 dbSNP
rs900242791 3706 dbSNP
rs1196151271 3708 dbSNP
rs1488708267 3710 dbSNP
rs1055625131 3722 dbSNP
rs754943068 3726 dbSNP
rs548309356 3727 dbSNP
rs946902431 3731 dbSNP
rs1043853662 3732 dbSNP
rs1338169741 3737 dbSNP
rs1275702073 3739 dbSNP
rs772693214 3739 dbSNP
rs952971898 3739 dbSNP
rs1005780849 3746 dbSNP
rs1301891995 3755 dbSNP
rs1464905923 3759 dbSNP
rs902800116 3765 dbSNP
rs768272718 3766 dbSNP
rs1429605418 3768 dbSNP
rs1421595949 3769 dbSNP
rs1015616537 3776 dbSNP
rs879454490 3778 dbSNP
rs1052760004 3781 dbSNP
rs1482177259 3788 dbSNP
rs1341903050 3794 dbSNP
rs1238949696 3802 dbSNP
rs961638670 3806 dbSNP
rs563301067 3808 dbSNP
rs982124544 3814 dbSNP
rs1220009443 3815 dbSNP
rs760775660 3815 dbSNP
rs1324927156 3834 dbSNP
rs183187012 3835 dbSNP
rs531055687 3853 dbSNP
rs1303733683 3854 dbSNP
rs1446705399 3856 dbSNP
rs1205590559 3858 dbSNP
rs1398828730 3860 dbSNP
rs544298361 3860 dbSNP
rs928076503 3860 dbSNP
rs75093980 3861 dbSNP
rs990641633 3871 dbSNP
rs915046978 3878 dbSNP
rs1246281091 3883 dbSNP
rs1415708797 3885 dbSNP
rs1183897941 3896 dbSNP
rs867617077 3899 dbSNP
rs552343329 3906 dbSNP
rs62207425 3913 dbSNP
rs1480694369 3914 dbSNP
rs1476258663 3921 dbSNP
rs147306647 3924 dbSNP
rs923639282 3925 dbSNP
rs944405158 3927 dbSNP
rs1040038049 3928 dbSNP
rs1315308482 3930 dbSNP
rs187917402 3933 dbSNP
rs1334000198 3939 dbSNP
rs995915012 3955 dbSNP
rs1049936104 3963 dbSNP
rs1291799409 3968 dbSNP
rs1385808630 3969 dbSNP
rs994698117 3970 dbSNP
rs1027481483 3971 dbSNP
rs1438903781 3973 dbSNP
rs1378213750 3984 dbSNP
rs1180461989 3990 dbSNP
rs1419548480 3991 dbSNP
rs1381224489 3998 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*