miRTarBase - #MIRT023231 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDC42EP3   
Synonyms BORG2, CEP3, UB1
Description CDC42 effector protein 3
Transcript NM_006449   
Expression
Putative miRNA Targets on CDC42EP3
3'UTR of CDC42EP3
(miRNA target sites are highlighted)
>CDC42EP3|NM_006449|3'UTR
   1 CAAGATGCCAACTTTTTTCCTTTGGGGTAAAAGGTACAAAAACAAACTAACCACAGTTGAAGAGAAGGGCTTCCGGAGCT
  81 GTATTTGCAGTTTTGTGTTGGGTTTTCTAAAATAATATTCTTACAAAGTATTTTTTTACCTGTTATGCCCTGTTTGCAAA
 161 AACAATTTAGAAAAAAACAACAAAGCAAAACCTATCTTGGCAAAAAAAGGAAGTGAGTCAGAGCCCATTTTCAGGAGGCA
 241 TTGGTGATGTTCGGCTCACATATTGTTTGCAGACACACAAGAAATCTGGCTTGGCCAGGATTGGCACTAGCTATGAAGGG
 321 CTGAGCGAGTCACATTAAGGAACTTCACGGAACTTTATAGCACTCCGACATTTTCTGAGCAAGAGGAAGTCAAAATTTAT
 401 TTAACACCTAAGCCTTTTTGTAGACTCTTTTCTATATATTGCTTAGGCTCACCATAGCGAATTCTCCAGTGTTAAAACTT
 481 TTCTGTTTTCACATTTGAACTTTATGGGTTTTGGGGATTTTCTTGTAGTTCTTATATATCCCTATATATTATATCTATAT
 561 TGCAAAATTTTGACTGTCAGCTACATGTTGGTAAGACACAGGCAAAGTATTACTGTAACTAAGTTATTTTTAAAGTTAAA
 641 ATATATTTTTACGTGCCTTTGGCTTTTTATTGCAGAGTCTACATTTTATAGATTCTACATCAGATGTTGTCACTTATTTC
 721 CATTGGGATTCCATTGTAAGCTGTGTATGTGCGTGTTTGGAAAAGTGTATTCATACTTAGTTTTTTTTTCTTCATCTGTT
 801 ATCATACTTTTAACAGCAACCAATAACGGATTGTAAAGTGTAAAGGCACAGGTTACTCATGATGCTTCTGCAGAGACTGT
 881 GGGCTACACCACATATGTTATTTGGAAATATAGGTATTTTAGTACAGTACATACTTGCATTACATAGGTACTTCAAGCAA
 961 CACAATAAAAAGTAAATGATAAAGTGAACTTGCTTGTTTATAGTAATAAACAAGACCATAAGAGAATAAGTATAGCTAGA
1041 GAAATTGCTTCTCTGAAATGTACATGAGCCCTTAAGGTAAGAGATGATTTCCATCTACTCTCATTTTGATTACTTCCTTA
1121 TGGTTTGAGAGGCTAGAAACTGAGCCTCTCTACTTTTGGAAAAATGAACATGTGAGGTCAGATTTTTTTTTTTTTTTTTA
1201 AGTCAGCACTGATGCCACCCTCTCAGTGGTCATTTCTGAGCATCTTCCTGACTTGAACACCTTCTACAGCAAACTCTTGC
1281 AAGTCCAGTTTCATCCCTGTAAGGCAAATGTCTTTTCACGCAGAAAGTGCCATATAGACGAGATAAAGGCAGCTAAAACG
1361 AGGGCAGTAGAGAGCACTTACCCGACCCCAAGGTGCCAGAGATGCCCTGAGGATGGTGGTTAAGGAAACAGGAGCAGGAA
1441 ATGTACACACAGATTCCTGTCCCTTTGCCAACTACTCCTTCCCCATCAAAGAAAAACACTTGCACACAGTAACTACCAGC
1521 TCCTTCTCTCAAACTTGTATTTCTCCTGGAAATGTATCTCAGAAATGACCTCCTCTCCCAACCACTTCAACGATTCTTTC
1601 TTTGGGTTTGGGGTTCTTGCAGTTCTATCATCTAAAATAACCTTTGGACTGCAGGTAAAATGCAATTAGGACAACTAACC
1681 AAGTAGACGAAACAAGTTCCCCTAGGCAGGGGTGTCCAATATTTTAGCTTCCCTGGACCGCATTGGAAGAATTTTCTTGG
1761 GCCACATGTAAAACACACTAACACTAACCATAGTTGATGAGCTTAAAAAAATAAAAATAGAAAATTGCAAAAAAAAAAAA
1841 AAAAAAAAATCTCAGACTGTTTTAAGAAAGTTTAAAAATTTGTGTTGGACTTCATGCGGGCCACAGGTTGGACAAGCTTG
1921 CCCTAGGGCATTGTGTGCTTTCCGTAACTTCTCAGTTGTATTTCGTTATCCATGACTCTCCAGTGTTTTTTCTGTTGGAC
2001 CACACCCGTCACAGTTCACAGTTCCAAAGAGAAATTTCCCAGCCTATTCTAAATCTTGTTAATGACGAAGAGTCCAATGT
2081 ATCTCATTATTTGTAGCCAATTTTAGACTCTTTTCAATACCTCCCCCCCATTTTAATTAGTATTGATCATATTCAGTCTT
2161 TCATTTTACTCTTCATCTGTAGCGTGACCTCAAGGTAAAGATGAAACTATTTCATGAAAAGGGGAGGAGTATGGCTGTGC
2241 ATTAGCTCTACTCCCTCTCTGGTAAGTACTGGGGAGAGAACAGCCCTGCCAGTACTGGGTTTGATAGATTCTAAATATTA
2321 ATCACACATCCTGCCTACAGTTAGCCATTTTAGTTTCTGGGAGTTCTTTCATGTACATTTTCTTCCATTAATTGAATTAG
2401 GTATAATTGAGATGGCAATAAATATGCCCGTATTAGAAAGAGGAAACAAAGCTACATGCGGCTTATGATTTTGTTGAGTC
2481 ACTTCTCCCGAGGCAGCCTTTCCAATGCCTGGTCCCTTCCCCTGAGAGCAGGTGGACTGCTGGTGGTGGCTTTCTTTCCT
2561 GCAGAGAGGCACTTTAGACCCATACCTGCTGTGAGCTGAATTGATGTTCTCATCCTGTGAACCTTCTCCCACTTTAACCT
2641 AATTTATCTTTACTTGTTTAAAGATAAGGAAACCCAAGATGTACTTTATTTGCAAACTCAAAGCAAATGGCGAGCCACCT
2721 GTGACCCAGTAACCAGAAAAGAAACCATGCCATTTGTATAAGTAGAGACACTTCTTGTTGAGGTAGGCAAGGCTCTTGTG
2801 AGCGATTTTTTTCCCCTAGTGAGACCTAACAAAAGACAAGCTATATCATTTCTGCCTGAAATTATCTGCTTGAAAAGATC
2881 AAAATATCAGGATACTTAGCTCTTCACAAATATGAAGTCATTATCACATTTCACTGAGCCAGAAATCACTGTTAACAGCA
2961 CACACAAAAGACTACACTGGTTGAACAGCAAAGAGAAACCCGGGTCTCCAGAATCACAGTTTAGTCCTTCTATATTACTG
3041 CAAGTGACCTGTTTTTTCTGAAGGCTCCCCGCAAATGAAGTCCTGGAATGGAAAAAATCCATAAGTCCATAAATTAACTT
3121 GATAAATATTTTAGAACAGACAAAAGAAAATATTGAGTGATGTAGTTCTAATCCTCCTAATATGGAACCTGGCAAGACTG
3201 AATCATTTTACTGTGAAATATATAAACACAATAGAATGAGCCAACATGATGGTTTCTCTCCAGTAAGAGTTTTTCTTTTG
3281 GAAATGAGGTTAACCTAGCCCCAAATCTAGCAATTCTCATAAAATCCGATTTTAGAATTAGCCTCCCAGATTAATCTGAA
3361 TGATTGACTTATTTTTTCTTAGGCAAGTCAGTAAGCCACCCACTAGACAGCCATATCCAGCAAAATAAGAGAAGTTTCCA
3441 GATGCCAAATGATAAGCCACCATCAACCCAGCGGGGAAGCCTTCTGGTTGGTTTGGCTGTATGAGATTCAGGAAGGCCAG
3521 AATACCCAAAATTATTCACACGACGTTAACTTATTGGTACTGGCTAAGCAATACATGTATTTCCTAAAGGAGGAGATGGT
3601 CTTTTGGTTGATTTATGGACACACTTGTTTCATCTGACTGTAAATATATTGCATGCTTTATTCTGATGGTGCACTATTTC
3681 ATCCAGCAAGCTTTTCATCTGAGAATGTTTAATGTTGACCTTATTCTTAGAGCAAGTAGATCTAAATATTTTTCAGCTGA
3761 GTTATTAGGGAGTCATTATTCTGTGGTACAATGCTGCAAAAAGCATCATGTGGAAGAATGGGAACTATGCTTACTTTATG
3841 AAGTGATGTATAACACAATGAAATCTGTTTTACAACTACTGTGCTGCATTTAATTATCTTCCATTTTTGCTGTTAAAAAA
3921 AAAAAATCCGTTAATGATGTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :| ::|||| |||||:|:| 
Target 5' atGAAGTCATTATCACATTTCa 3'
2912 - 2933 140.00 -15.80
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               | | || | :|||||| 
Target 5' cacggAACTTTATAGCACTCCg 3'
346 - 367 137.00 -13.70
3
miRNA  3' guuUGUGGUAA-------CA---GUGUGAGGu 5'
             |::|||||       ||    |||||:| 
Target 5' accATGCCATTTGTATAAGTAGAGACACTTCt 3'
2744 - 2775 131.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31534351 11 COSMIC
COSN30144650 12 COSMIC
COSN26970006 17 COSMIC
COSN30491620 33 COSMIC
COSN19705640 64 COSMIC
COSN30190228 89 COSMIC
COSN30161237 90 COSMIC
COSN31524793 123 COSMIC
COSN25462705 130 COSMIC
COSN20047158 131 COSMIC
COSN28725603 143 COSMIC
COSN5503317 159 COSMIC
COSN31490743 161 COSMIC
COSN30169264 194 COSMIC
COSN28868077 202 COSMIC
COSN1238379 265 COSMIC
COSN31552397 304 COSMIC
COSN32161763 375 COSMIC
COSN31579034 385 COSMIC
COSN31516401 397 COSMIC
COSN26220410 452 COSMIC
COSN7803342 459 COSMIC
COSN15121655 570 COSMIC
COSN31590767 624 COSMIC
COSN30541046 653 COSMIC
COSN6180642 831 COSMIC
COSN20096527 923 COSMIC
COSN20096526 940 COSMIC
COSN17038221 1141 COSMIC
COSN27530716 1182 COSMIC
COSN20096524 1183 COSMIC
COSN23750629 1359 COSMIC
COSN32055948 1625 COSMIC
COSN17698857 2459 COSMIC
COSN24928362 2502 COSMIC
COSN19173661 2671 COSMIC
COSN22684600 2794 COSMIC
COSN32062752 2983 COSMIC
COSN5792042 3624 COSMIC
rs9742 3472 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs2231504 1 dbSNP
rs538505267 2 dbSNP
rs1371146800 7 dbSNP
rs1437602882 9 dbSNP
rs200940679 11 dbSNP
rs1408074036 15 dbSNP
rs780253982 17 dbSNP
rs1365964514 21 dbSNP
rs1163295912 25 dbSNP
rs1473599734 27 dbSNP
rs1436760623 29 dbSNP
rs1297893014 33 dbSNP
rs1310886976 34 dbSNP
rs1230172805 38 dbSNP
rs1383633502 39 dbSNP
rs758076957 48 dbSNP
rs368612852 51 dbSNP
rs1322300038 55 dbSNP
rs1474128474 62 dbSNP
rs1220783931 73 dbSNP
rs1256538589 74 dbSNP
rs1211584372 75 dbSNP
rs1486617580 78 dbSNP
rs767454399 79 dbSNP
rs1448923444 83 dbSNP
rs2231505 88 dbSNP
rs15628 95 dbSNP
rs1406420195 96 dbSNP
rs1164718254 100 dbSNP
rs1392663439 124 dbSNP
rs771112737 138 dbSNP
rs1262174873 139 dbSNP
rs1242121168 140 dbSNP
rs899259670 147 dbSNP
rs1387516606 152 dbSNP
rs536069214 153 dbSNP
rs1441197257 156 dbSNP
rs1432224628 158 dbSNP
rs1038081307 159 dbSNP
rs1004906767 163 dbSNP
rs751600175 164 dbSNP
rs1047007869 173 dbSNP
rs766266499 178 dbSNP
rs949975044 178 dbSNP
rs1268979108 180 dbSNP
rs1416938909 183 dbSNP
rs1213950207 196 dbSNP
rs1239233314 197 dbSNP
rs529988249 198 dbSNP
rs1318192663 200 dbSNP
rs937062996 201 dbSNP
rs1416421472 206 dbSNP
rs561065365 209 dbSNP
rs150670255 217 dbSNP
rs762909958 221 dbSNP
rs1401413717 226 dbSNP
rs925749456 231 dbSNP
rs559984348 234 dbSNP
rs1398544293 248 dbSNP
rs978821181 253 dbSNP
rs187861124 254 dbSNP
rs776928189 255 dbSNP
rs1300995043 256 dbSNP
rs1352309602 257 dbSNP
rs1161749945 261 dbSNP
rs1228742011 270 dbSNP
rs1461109578 278 dbSNP
rs1418771170 280 dbSNP
rs913482447 283 dbSNP
rs529854468 298 dbSNP
rs987682515 301 dbSNP
rs376302340 304 dbSNP
rs1029135900 305 dbSNP
rs562305794 306 dbSNP
rs1255991241 313 dbSNP
rs974954391 326 dbSNP
rs963771276 327 dbSNP
rs1411623120 337 dbSNP
rs1192354098 343 dbSNP
rs1459833312 344 dbSNP
rs1016386551 348 dbSNP
rs1425504987 349 dbSNP
rs1413384571 353 dbSNP
rs544131862 363 dbSNP
rs1447116755 366 dbSNP
rs141975323 367 dbSNP
rs564186120 369 dbSNP
rs760759579 370 dbSNP
rs1410303077 372 dbSNP
rs570906209 377 dbSNP
rs148180171 383 dbSNP
rs1438425596 384 dbSNP
rs1273383022 395 dbSNP
rs1346030703 408 dbSNP
rs1235555852 410 dbSNP
rs1014098991 413 dbSNP
rs895757008 425 dbSNP
rs1055535676 427 dbSNP
rs1316424209 429 dbSNP
rs765535444 431 dbSNP
rs1491573164 432 dbSNP
rs1201523759 433 dbSNP
rs1246891763 442 dbSNP
rs904264085 450 dbSNP
rs1171382927 454 dbSNP
rs7735 458 dbSNP
rs746359541 466 dbSNP
rs774903063 468 dbSNP
rs1328338830 473 dbSNP
rs945788500 477 dbSNP
rs1321687714 482 dbSNP
rs1323925757 491 dbSNP
rs1330325375 501 dbSNP
rs1440374229 504 dbSNP
rs1440173169 505 dbSNP
rs912866697 514 dbSNP
rs1395528528 518 dbSNP
rs1367440248 524 dbSNP
rs987146184 544 dbSNP
rs1251225412 550 dbSNP
rs1462859938 551 dbSNP
rs933534016 551 dbSNP
rs553976771 557 dbSNP
rs530918764 559 dbSNP
rs1475692011 560 dbSNP
rs963620949 570 dbSNP
rs1187440054 579 dbSNP
rs1370875943 580 dbSNP
rs1016849926 582 dbSNP
rs183734740 585 dbSNP
rs1163785355 587 dbSNP
rs749663165 590 dbSNP
rs575102259 599 dbSNP
rs983523873 601 dbSNP
rs950818221 613 dbSNP
rs777431761 614 dbSNP
rs749648374 623 dbSNP
rs1435868470 627 dbSNP
rs1215147988 639 dbSNP
rs1436504529 641 dbSNP
rs1324781481 643 dbSNP
rs1013564569 644 dbSNP
rs1285307258 650 dbSNP
rs556781248 652 dbSNP
rs538567576 653 dbSNP
rs1269603815 656 dbSNP
rs1010187340 675 dbSNP
rs1207742032 688 dbSNP
rs1273540788 690 dbSNP
rs191628111 693 dbSNP
rs1371784313 695 dbSNP
rs1043288660 703 dbSNP
rs1009959958 704 dbSNP
rs1328220492 711 dbSNP
rs1444833220 712 dbSNP
rs552244487 717 dbSNP
rs1035972656 719 dbSNP
rs1002620497 721 dbSNP
rs1352604103 724 dbSNP
rs1327951927 726 dbSNP
rs1457919165 729 dbSNP
rs1051409214 733 dbSNP
rs1382790603 738 dbSNP
rs905615599 742 dbSNP
rs922178275 743 dbSNP
rs1171660360 752 dbSNP
rs1044025442 753 dbSNP
rs1237798982 759 dbSNP
rs533565171 764 dbSNP
rs1258661242 765 dbSNP
rs1395160501 766 dbSNP
rs1200588682 767 dbSNP
rs1005857964 774 dbSNP
rs1468296486 779 dbSNP
rs1184284473 780 dbSNP
rs1252195914 783 dbSNP
rs888666847 784 dbSNP
rs1158649804 785 dbSNP
rs942286851 790 dbSNP
rs1439867662 791 dbSNP
rs909354831 806 dbSNP
rs566418631 808 dbSNP
rs1413414033 812 dbSNP
rs186884058 814 dbSNP
rs1351482913 818 dbSNP
rs1391241827 820 dbSNP
rs1304390308 822 dbSNP
rs1348774395 823 dbSNP
rs10694 827 dbSNP
rs1041642673 828 dbSNP
rs1372913623 832 dbSNP
rs532114923 833 dbSNP
rs564850520 834 dbSNP
rs1280310581 835 dbSNP
rs1442720447 837 dbSNP
rs911314292 846 dbSNP
rs985451058 851 dbSNP
rs1434015719 852 dbSNP
rs562367954 853 dbSNP
rs1175314296 865 dbSNP
rs1248647996 865 dbSNP
rs968693819 870 dbSNP
rs914601755 871 dbSNP
rs988726004 876 dbSNP
rs955977702 877 dbSNP
rs1034099608 882 dbSNP
rs1035497863 884 dbSNP
rs1394488009 885 dbSNP
rs1003120288 889 dbSNP
rs969807023 890 dbSNP
rs372860359 893 dbSNP
rs1371773003 895 dbSNP
rs1296773343 896 dbSNP
rs1370214046 897 dbSNP
rs1386930440 904 dbSNP
rs1302239537 905 dbSNP
rs1005952500 911 dbSNP
rs1230048500 912 dbSNP
rs143650183 924 dbSNP
rs751540431 928 dbSNP
rs532311840 936 dbSNP
rs555231343 937 dbSNP
rs182607170 945 dbSNP
rs1266931689 947 dbSNP
rs537123098 948 dbSNP
rs144639735 952 dbSNP
rs1255842282 981 dbSNP
rs143034717 983 dbSNP
rs897407148 989 dbSNP
rs1190647776 990 dbSNP
rs1486291894 993 dbSNP
rs1428393299 996 dbSNP
rs1168965384 999 dbSNP
rs1351911262 1026 dbSNP
rs997271674 1039 dbSNP
rs1041195356 1040 dbSNP
rs944216725 1041 dbSNP
rs911424364 1043 dbSNP
rs780146187 1044 dbSNP
rs942275809 1045 dbSNP
rs947494310 1061 dbSNP
rs1360687039 1062 dbSNP
rs914570519 1063 dbSNP
rs56719269 1066 dbSNP
rs1225679600 1092 dbSNP
rs1314849287 1099 dbSNP
rs1322090292 1100 dbSNP
rs1232508002 1102 dbSNP
rs1272751434 1104 dbSNP
rs988821300 1113 dbSNP
rs1047878573 1114 dbSNP
rs934523994 1116 dbSNP
rs928558857 1117 dbSNP
rs929511020 1117 dbSNP
rs572370645 1120 dbSNP
rs1485585343 1122 dbSNP
rs1185279331 1128 dbSNP
rs917998466 1128 dbSNP
rs1164706717 1131 dbSNP
rs1416185350 1135 dbSNP
rs970281600 1141 dbSNP
rs560503792 1145 dbSNP
rs139115779 1148 dbSNP
rs779541162 1150 dbSNP
rs574965503 1151 dbSNP
rs951832155 1153 dbSNP
rs1379860844 1157 dbSNP
rs1356049217 1158 dbSNP
rs1314591611 1160 dbSNP
rs1025902738 1169 dbSNP
rs1451054488 1176 dbSNP
rs1330971349 1177 dbSNP
rs1230387601 1179 dbSNP
rs1344056593 1180 dbSNP
rs1285295100 1181 dbSNP
rs1316396782 1182 dbSNP
rs993142486 1186 dbSNP
rs1159462178 1191 dbSNP
rs199977825 1199 dbSNP
rs1158773364 1200 dbSNP
rs1213791234 1200 dbSNP
rs1251768687 1200 dbSNP
rs1473815188 1200 dbSNP
rs538279768 1200 dbSNP
rs566832397 1200 dbSNP
rs57818649 1200 dbSNP
rs551761381 1207 dbSNP
rs1415135777 1208 dbSNP
rs1164663707 1211 dbSNP
rs968645197 1223 dbSNP
rs1398424325 1226 dbSNP
rs897376959 1227 dbSNP
rs1185259193 1228 dbSNP
rs1485623017 1231 dbSNP
rs1311002858 1235 dbSNP
rs1242767971 1238 dbSNP
rs988632946 1242 dbSNP
rs955821048 1258 dbSNP
rs1030180674 1259 dbSNP
rs997239172 1262 dbSNP
rs1210794252 1266 dbSNP
rs900269642 1266 dbSNP
rs1272741188 1267 dbSNP
rs556844675 1274 dbSNP
rs1232476657 1277 dbSNP
rs1232697679 1278 dbSNP
rs1020274195 1279 dbSNP
rs1008505088 1280 dbSNP
rs1433628952 1283 dbSNP
rs1171663456 1288 dbSNP
rs1372380946 1293 dbSNP
rs1327892383 1295 dbSNP
rs889950629 1297 dbSNP
rs80263106 1303 dbSNP
rs947421889 1305 dbSNP
rs1048006760 1310 dbSNP
rs1371802355 1317 dbSNP
rs577475042 1319 dbSNP
rs1301842959 1320 dbSNP
rs1344888307 1323 dbSNP
rs558993375 1326 dbSNP
rs1380449888 1337 dbSNP
rs534481070 1340 dbSNP
rs1053082919 1353 dbSNP
rs1360734258 1359 dbSNP
rs929561923 1360 dbSNP
rs1272673042 1363 dbSNP
rs896624868 1364 dbSNP
rs1223314232 1372 dbSNP
rs1056570386 1373 dbSNP
rs566376508 1381 dbSNP
rs1453239797 1382 dbSNP
rs934668639 1383 dbSNP
rs928680334 1384 dbSNP
rs1391875420 1386 dbSNP
rs1324780223 1397 dbSNP
rs554525895 1402 dbSNP
rs1462333464 1409 dbSNP
rs1393977408 1414 dbSNP
rs979442841 1417 dbSNP
rs1328145239 1426 dbSNP
rs1420468312 1432 dbSNP
rs977958405 1432 dbSNP
rs749953079 1437 dbSNP
rs1323920169 1440 dbSNP
rs1328292453 1441 dbSNP
rs981745352 1450 dbSNP
rs113677102 1452 dbSNP
rs1337837043 1456 dbSNP
rs1235581391 1457 dbSNP
rs915735940 1461 dbSNP
rs568601680 1462 dbSNP
rs1467718396 1468 dbSNP
rs984596170 1477 dbSNP
rs77265715 1478 dbSNP
rs571205320 1499 dbSNP
rs1447082763 1500 dbSNP
rs955956427 1501 dbSNP
rs1026034187 1503 dbSNP
rs765120277 1506 dbSNP
rs975938381 1507 dbSNP
rs1165331171 1509 dbSNP
rs191646630 1518 dbSNP
rs1017807797 1522 dbSNP
rs1005882846 1537 dbSNP
rs1387232358 1546 dbSNP
rs1018653225 1548 dbSNP
rs1008889134 1549 dbSNP
rs1025943899 1552 dbSNP
rs890054190 1557 dbSNP
rs993680428 1575 dbSNP
rs1252659080 1582 dbSNP
rs1294235502 1590 dbSNP
rs753019529 1592 dbSNP
rs1214518178 1594 dbSNP
rs1011767985 1598 dbSNP
rs893194598 1601 dbSNP
rs1056537433 1608 dbSNP
rs543242967 1619 dbSNP
rs938206208 1627 dbSNP
rs1444021442 1632 dbSNP
rs1188589645 1635 dbSNP
rs1296154494 1641 dbSNP
rs373100261 1642 dbSNP
rs934783561 1643 dbSNP
rs907194993 1645 dbSNP
rs1368112423 1654 dbSNP
rs1045763558 1656 dbSNP
rs1454344470 1659 dbSNP
rs1158022894 1665 dbSNP
rs1044236682 1680 dbSNP
rs1382907612 1686 dbSNP
rs948610396 1688 dbSNP
rs767488001 1689 dbSNP
rs1392364459 1690 dbSNP
rs1296818397 1694 dbSNP
rs1355219655 1704 dbSNP
rs1048852642 1705 dbSNP
rs1413384231 1710 dbSNP
rs930464941 1731 dbSNP
rs546593704 1736 dbSNP
rs919116233 1739 dbSNP
rs188416630 1740 dbSNP
rs1335941128 1741 dbSNP
rs934548487 1742 dbSNP
rs6728610 1743 dbSNP
rs1211505747 1748 dbSNP
rs1279597651 1751 dbSNP
rs184032695 1760 dbSNP
rs1484557012 1766 dbSNP
rs911515355 1767 dbSNP
rs985819214 1775 dbSNP
rs1181376548 1790 dbSNP
rs975934156 1794 dbSNP
rs866796558 1799 dbSNP
rs1455687985 1800 dbSNP
rs1394549396 1804 dbSNP
rs1375415286 1805 dbSNP
rs371620463 1812 dbSNP
rs1455756195 1814 dbSNP
rs1248603437 1815 dbSNP
rs368159883 1818 dbSNP
rs374244099 1820 dbSNP
rs1480158760 1821 dbSNP
rs1251858660 1826 dbSNP
rs964795085 1828 dbSNP
rs1234452156 1829 dbSNP
rs1302541934 1830 dbSNP
rs1345589606 1831 dbSNP
rs757364662 1832 dbSNP
rs775093513 1832 dbSNP
rs1302081869 1833 dbSNP
rs910389695 1842 dbSNP
rs1480188418 1844 dbSNP
rs984912707 1848 dbSNP
rs10573780 1850 dbSNP
rs1194296585 1850 dbSNP
rs1236639893 1850 dbSNP
rs1373992201 1850 dbSNP
rs1394581538 1850 dbSNP
rs1455624884 1850 dbSNP
rs1461849653 1850 dbSNP
rs199884124 1850 dbSNP
rs200620123 1850 dbSNP
rs376033452 1850 dbSNP
rs866393220 1850 dbSNP
rs1225030131 1851 dbSNP
rs1321206248 1851 dbSNP
rs147133290 1851 dbSNP
rs759391209 1851 dbSNP
rs780929200 1851 dbSNP
rs951843101 1852 dbSNP
rs1469952503 1855 dbSNP
rs1214569604 1863 dbSNP
rs1252381916 1864 dbSNP
rs1487586137 1867 dbSNP
rs1304356458 1888 dbSNP
rs530260041 1894 dbSNP
rs1011861319 1897 dbSNP
rs960930402 1898 dbSNP
rs957506385 1900 dbSNP
rs1374467380 1902 dbSNP
rs1461582992 1903 dbSNP
rs1310458178 1905 dbSNP
rs1433381984 1907 dbSNP
rs145544118 1923 dbSNP
rs1002371749 1927 dbSNP
rs1361236471 1928 dbSNP
rs544673319 1931 dbSNP
rs1294835432 1939 dbSNP
rs1335239574 1941 dbSNP
rs907292083 1942 dbSNP
rs1046104810 1943 dbSNP
rs905317854 1944 dbSNP
rs1012937310 1947 dbSNP
rs1467613194 1948 dbSNP
rs192048871 1955 dbSNP
rs1181334074 1964 dbSNP
rs559088312 1965 dbSNP
rs1485801559 1968 dbSNP
rs771446977 1969 dbSNP
rs540596011 1972 dbSNP
rs1011386894 1980 dbSNP
rs1259971232 1992 dbSNP
rs1475778671 1994 dbSNP
rs919085146 2000 dbSNP
rs1411246268 2007 dbSNP
rs185251316 2008 dbSNP
rs1484654765 2010 dbSNP
rs1159144706 2011 dbSNP
rs1279477662 2019 dbSNP
rs3731852 2029 dbSNP
rs1314738149 2031 dbSNP
rs1355838446 2033 dbSNP
rs773422854 2048 dbSNP
rs1346483713 2049 dbSNP
rs944416603 2052 dbSNP
rs1225711012 2054 dbSNP
rs934014319 2055 dbSNP
rs150140875 2066 dbSNP
rs3731853 2067 dbSNP
rs1290608743 2073 dbSNP
rs910348143 2079 dbSNP
rs1210669282 2081 dbSNP
rs141969429 2086 dbSNP
rs770246300 2088 dbSNP
rs919035968 2093 dbSNP
rs1406600416 2101 dbSNP
rs971695960 2104 dbSNP
rs1175411111 2106 dbSNP
rs1397910696 2108 dbSNP
rs1434057682 2112 dbSNP
rs1382876321 2115 dbSNP
rs914932372 2116 dbSNP
rs1454516913 2117 dbSNP
rs1280429600 2123 dbSNP
rs1034649246 2125 dbSNP
rs747745446 2129 dbSNP
rs1002842627 2130 dbSNP
rs577618274 2130 dbSNP
rs1349181386 2142 dbSNP
rs1276865518 2143 dbSNP
rs140881129 2145 dbSNP
rs151019436 2154 dbSNP
rs1232000222 2155 dbSNP
rs1456044020 2156 dbSNP
rs543468062 2158 dbSNP
rs1194913575 2167 dbSNP
rs1161144406 2175 dbSNP
rs114822846 2184 dbSNP
rs1256786242 2185 dbSNP
rs180732829 2188 dbSNP
rs1421388741 2195 dbSNP
rs567546774 2209 dbSNP
rs549250353 2214 dbSNP
rs1444882345 2218 dbSNP
rs1024381283 2226 dbSNP
rs1013442364 2229 dbSNP
rs1327951702 2233 dbSNP
rs17462775 2235 dbSNP
rs1233155214 2236 dbSNP
rs1273642456 2243 dbSNP
rs1350946733 2244 dbSNP
rs768216934 2250 dbSNP
rs746532324 2258 dbSNP
rs1269581369 2261 dbSNP
rs1315625843 2269 dbSNP
rs1231867185 2280 dbSNP
rs1253012444 2281 dbSNP
rs1467695833 2282 dbSNP
rs897750696 2283 dbSNP
rs1196654243 2287 dbSNP
rs1036582920 2294 dbSNP
rs1294482171 2304 dbSNP
rs1167067097 2308 dbSNP
rs944571638 2310 dbSNP
rs901140516 2311 dbSNP
rs868129488 2316 dbSNP
rs562833836 2317 dbSNP
rs1395292425 2331 dbSNP
rs189924822 2333 dbSNP
rs758441695 2335 dbSNP
rs542441836 2350 dbSNP
rs914901204 2351 dbSNP
rs1277895343 2357 dbSNP
rs1316455997 2357 dbSNP
rs1234747345 2359 dbSNP
rs1273493440 2363 dbSNP
rs1333502311 2364 dbSNP
rs1317733360 2369 dbSNP
rs1382812344 2371 dbSNP
rs1049355679 2373 dbSNP
rs1447462135 2376 dbSNP
rs930510504 2386 dbSNP
rs143978408 2396 dbSNP
rs1416886385 2404 dbSNP
rs1190300520 2415 dbSNP
rs971746977 2418 dbSNP
rs939110899 2425 dbSNP
rs185507204 2426 dbSNP
rs778559095 2427 dbSNP
rs757141370 2429 dbSNP
rs540820700 2430 dbSNP
rs970033622 2436 dbSNP
rs1464916469 2439 dbSNP
rs879464677 2442 dbSNP
rs989645373 2454 dbSNP
rs1339471230 2456 dbSNP
rs3731854 2458 dbSNP
rs767789991 2459 dbSNP
rs1468365451 2460 dbSNP
rs1274212922 2466 dbSNP
rs561637381 2469 dbSNP
rs1283857925 2478 dbSNP
rs542878932 2480 dbSNP
rs759560283 2482 dbSNP
rs1256566973 2489 dbSNP
rs80192514 2490 dbSNP
rs146670599 2497 dbSNP
rs1365603572 2505 dbSNP
rs1470588829 2508 dbSNP
rs1228310321 2509 dbSNP
rs1158551853 2511 dbSNP
rs1367409414 2512 dbSNP
rs1437159454 2513 dbSNP
rs1313818813 2516 dbSNP
rs1401961396 2523 dbSNP
rs1393866970 2524 dbSNP
rs1308768948 2531 dbSNP
rs1018674090 2534 dbSNP
rs1238841405 2541 dbSNP
rs1006920840 2542 dbSNP
rs1024934625 2543 dbSNP
rs773459179 2555 dbSNP
rs991526846 2557 dbSNP
rs1482189555 2558 dbSNP
rs538380053 2559 dbSNP
rs1252991483 2564 dbSNP
rs1406835444 2567 dbSNP
rs1458247425 2568 dbSNP
rs1394276223 2579 dbSNP
rs1178059913 2580 dbSNP
rs1378572459 2585 dbSNP
rs1167237438 2593 dbSNP
rs1455921572 2601 dbSNP
rs1174820554 2602 dbSNP
rs1377420671 2605 dbSNP
rs1449584421 2611 dbSNP
rs1464900021 2616 dbSNP
rs897627750 2618 dbSNP
rs181301460 2619 dbSNP
rs1191145992 2626 dbSNP
rs577271295 2635 dbSNP
rs1445606736 2654 dbSNP
rs1254926396 2656 dbSNP
rs766482502 2670 dbSNP
rs1328614580 2674 dbSNP
rs1453426834 2678 dbSNP
rs994818154 2679 dbSNP
rs552937701 2680 dbSNP
rs927766712 2681 dbSNP
rs897709401 2683 dbSNP
rs1014832866 2702 dbSNP
rs1251708409 2708 dbSNP
rs1318814959 2710 dbSNP
rs763431962 2711 dbSNP
rs1224270710 2721 dbSNP
rs1436413290 2734 dbSNP
rs1272978099 2741 dbSNP
rs980839796 2749 dbSNP
rs1192259110 2755 dbSNP
rs1267315596 2756 dbSNP
rs554488764 2757 dbSNP
rs4670746 2758 dbSNP
rs778989475 2760 dbSNP
rs989698005 2764 dbSNP
rs1464715514 2774 dbSNP
rs537526872 2776 dbSNP
rs770053363 2778 dbSNP
rs1168172183 2781 dbSNP
rs956956349 2781 dbSNP
rs1461556455 2784 dbSNP
rs1239887784 2787 dbSNP
rs893561656 2791 dbSNP
rs1053425704 2803 dbSNP
rs567306815 2804 dbSNP
rs923625673 2806 dbSNP
rs1295958556 2812 dbSNP
rs1339603207 2813 dbSNP
rs976941771 2813 dbSNP
rs1256466430 2814 dbSNP
rs367992930 2816 dbSNP
rs1337000878 2818 dbSNP
rs1222346466 2824 dbSNP
rs1264959518 2835 dbSNP
rs1276779741 2840 dbSNP
rs1188802810 2841 dbSNP
rs1264339204 2842 dbSNP
rs1438403121 2842 dbSNP
rs965832238 2843 dbSNP
rs1333735723 2844 dbSNP
rs1191036553 2850 dbSNP
rs114754851 2852 dbSNP
rs950385810 2862 dbSNP
rs1405632065 2863 dbSNP
rs190195743 2864 dbSNP
rs1347627317 2866 dbSNP
rs1372259741 2872 dbSNP
rs1289446034 2875 dbSNP
rs1359651132 2879 dbSNP
rs1397955213 2880 dbSNP
rs991621820 2886 dbSNP
rs185362863 2888 dbSNP
rs1312009366 2891 dbSNP
rs1425493086 2900 dbSNP
rs1026949195 2905 dbSNP
rs994682665 2917 dbSNP
rs897771833 2920 dbSNP
rs1027711354 2922 dbSNP
rs1488152145 2928 dbSNP
rs1192541289 2938 dbSNP
rs1214856898 2940 dbSNP
rs1468990133 2945 dbSNP
rs1036142943 2946 dbSNP
rs1232654331 2947 dbSNP
rs1180929843 2959 dbSNP
rs768536195 2961 dbSNP
rs1410989729 2974 dbSNP
rs1420417789 2975 dbSNP
rs1159158615 2983 dbSNP
rs1379568943 2994 dbSNP
rs962050882 3001 dbSNP
rs548700415 3002 dbSNP
rs1359530524 3003 dbSNP
rs1449021749 3004 dbSNP
rs1008806270 3006 dbSNP
rs143229833 3010 dbSNP
rs532546882 3011 dbSNP
rs768445914 3015 dbSNP
rs374499850 3024 dbSNP
rs546739196 3026 dbSNP
rs947804334 3027 dbSNP
rs1281041442 3032 dbSNP
rs893530987 3034 dbSNP
rs914884541 3035 dbSNP
rs1053467929 3040 dbSNP
rs1053519984 3049 dbSNP
rs935550346 3051 dbSNP
rs1208973683 3052 dbSNP
rs1235432227 3057 dbSNP
rs1481428094 3058 dbSNP
rs1287496705 3062 dbSNP
rs999315169 3064 dbSNP
rs1437673500 3065 dbSNP
rs1175509790 3066 dbSNP
rs902169821 3070 dbSNP
rs1352282948 3071 dbSNP
rs976910737 3095 dbSNP
rs1310971726 3099 dbSNP
rs746479020 3101 dbSNP
rs1332061534 3102 dbSNP
rs1376264090 3103 dbSNP
rs1359236438 3112 dbSNP
rs72795734 3117 dbSNP
rs1306348238 3120 dbSNP
rs917509682 3137 dbSNP
rs1055862506 3138 dbSNP
rs937500257 3142 dbSNP
rs920788942 3153 dbSNP
rs1406700106 3155 dbSNP
rs973454370 3160 dbSNP
rs9808575 3165 dbSNP
rs1456109102 3172 dbSNP
rs1247257043 3173 dbSNP
rs771765540 3175 dbSNP
rs149625742 3183 dbSNP
rs1187820461 3184 dbSNP
rs1483658140 3192 dbSNP
rs1239272567 3195 dbSNP
rs1421411578 3198 dbSNP
rs1467320341 3201 dbSNP
rs987877975 3204 dbSNP
rs1213648405 3213 dbSNP
rs1171742213 3221 dbSNP
rs565934363 3223 dbSNP
rs1282125381 3225 dbSNP
rs1326075458 3227 dbSNP
rs1332130262 3229 dbSNP
rs1436406175 3232 dbSNP
rs1268950224 3233 dbSNP
rs1342849620 3234 dbSNP
rs1028927751 3235 dbSNP
rs1218843982 3236 dbSNP
rs1257082435 3245 dbSNP
rs1315491961 3246 dbSNP
rs996123343 3247 dbSNP
rs367822432 3248 dbSNP
rs1291437548 3250 dbSNP
rs544600304 3260 dbSNP
rs577518023 3266 dbSNP
rs1194630382 3270 dbSNP
rs1423235919 3271 dbSNP
rs999250752 3274 dbSNP
rs1476983052 3275 dbSNP
rs902264978 3278 dbSNP
rs1046044047 3279 dbSNP
rs778913171 3284 dbSNP
rs893569047 3285 dbSNP
rs1053435416 3295 dbSNP
rs1320782818 3302 dbSNP
rs1277996022 3304 dbSNP
rs1231791604 3307 dbSNP
rs1013684486 3325 dbSNP
rs756941703 3327 dbSNP
rs1284211100 3328 dbSNP
rs1355123544 3330 dbSNP
rs1207975997 3338 dbSNP
rs1041276584 3341 dbSNP
rs1416136688 3348 dbSNP
rs755751487 3349 dbSNP
rs1488477812 3357 dbSNP
rs1055955597 3364 dbSNP
rs547643127 3370 dbSNP
rs920753771 3373 dbSNP
rs1189957307 3378 dbSNP
rs1369115837 3382 dbSNP
rs1472535309 3383 dbSNP
rs1424916522 3387 dbSNP
rs1037840414 3391 dbSNP
rs1161940815 3419 dbSNP
rs911364084 3425 dbSNP
rs1420859249 3429 dbSNP
rs986049406 3429 dbSNP
rs952815817 3431 dbSNP
rs1397417360 3437 dbSNP
rs1184880649 3440 dbSNP
rs920045662 3466 dbSNP
rs1242033389 3468 dbSNP
rs972708129 3468 dbSNP
rs1354269357 3469 dbSNP
rs1475113522 3470 dbSNP
rs9742 3472 dbSNP
rs115820452 3473 dbSNP
rs1257169578 3477 dbSNP
rs987461248 3478 dbSNP
rs1442089265 3483 dbSNP
rs1185445744 3490 dbSNP
rs954861087 3499 dbSNP
rs1440780398 3507 dbSNP
rs1158647449 3509 dbSNP
rs1378844488 3516 dbSNP
rs921951786 3518 dbSNP
rs1216278319 3519 dbSNP
rs555575726 3524 dbSNP
rs971072307 3526 dbSNP
rs974650315 3541 dbSNP
rs957948961 3542 dbSNP
rs1032139398 3544 dbSNP
rs1314714374 3545 dbSNP
rs1012522798 3546 dbSNP
rs537387326 3554 dbSNP
rs1053573099 3558 dbSNP
rs1344506861 3562 dbSNP
rs1202016648 3579 dbSNP
rs999275989 3580 dbSNP
rs1458321441 3585 dbSNP
rs966458895 3586 dbSNP
rs902143295 3597 dbSNP
rs1025134248 3600 dbSNP
rs1435457233 3603 dbSNP
rs1041121207 3605 dbSNP
rs564511270 3610 dbSNP
rs944277933 3615 dbSNP
rs890064666 3618 dbSNP
rs1013363272 3633 dbSNP
rs894814316 3634 dbSNP
rs1328719573 3636 dbSNP
rs1369575013 3639 dbSNP
rs1387289725 3640 dbSNP
rs1391756198 3649 dbSNP
rs1300252316 3656 dbSNP
rs1329203282 3660 dbSNP
rs1033342577 3667 dbSNP
rs1458690308 3670 dbSNP
rs920097998 3672 dbSNP
rs139401099 3673 dbSNP
rs1168916551 3676 dbSNP
rs1227545703 3677 dbSNP
rs1489721886 3682 dbSNP
rs899429013 3684 dbSNP
rs1428066751 3685 dbSNP
rs1267091494 3696 dbSNP
rs1390855009 3698 dbSNP
rs1479688575 3700 dbSNP
rs1037851443 3703 dbSNP
rs1190531182 3714 dbSNP
rs766437347 3728 dbSNP
rs928617280 3730 dbSNP
rs981874486 3733 dbSNP
rs1388285526 3738 dbSNP
rs970655805 3740 dbSNP
rs182303452 3750 dbSNP
rs539034339 3757 dbSNP
rs933425935 3768 dbSNP
rs1218268478 3769 dbSNP
rs758572120 3770 dbSNP
rs921894537 3772 dbSNP
rs1323640797 3775 dbSNP
rs1246135089 3777 dbSNP
rs1032183057 3786 dbSNP
rs1267186965 3805 dbSNP
rs1219180347 3807 dbSNP
rs1264361202 3810 dbSNP
rs974743533 3813 dbSNP
rs999244758 3821 dbSNP
rs1415317637 3829 dbSNP
rs1423939061 3831 dbSNP
rs1163951392 3834 dbSNP
rs571517761 3837 dbSNP
rs1383259476 3838 dbSNP
rs1202348405 3842 dbSNP
rs902280267 3847 dbSNP
rs1274749288 3848 dbSNP
rs1127373 3855 dbSNP
rs547093110 3858 dbSNP
rs925202911 3862 dbSNP
rs1287382289 3865 dbSNP
rs978061772 3871 dbSNP
rs1381384728 3873 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.494 7.1e-3 -0.549 2.7e-3 24 Click to see details
GSE28260 Renal cortex and medulla 0.554 2.5e-2 0.555 2.4e-2 13 Click to see details
GSE38226 Liver fibrosis -0.404 3.5e-2 -0.459 1.8e-2 21 Click to see details
GSE32688 Pancreatic cancer -0.315 4.0e-2 -0.316 3.9e-2 32 Click to see details
GSE14794 Lymphoblastoid cells 0.125 1.2e-1 0.157 7.0e-2 90 Click to see details
GSE42095 Differentiated embryonic stem cells -0.211 1.7e-1 0.227 1.5e-1 23 Click to see details
GSE21849 B cell lymphoma -0.185 1.7e-1 -0.162 2.0e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.188 1.8e-1 -0.090 3.3e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.281 2.9e-1 -0.371 2.3e-1 6 Click to see details
GSE19350 CNS germ cell tumors 0.157 3.1e-1 0.497 5.0e-2 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.114 3.2e-1 -0.340 7.1e-2 20 Click to see details
GSE27834 Pluripotent stem cells 0.095 3.6e-1 0.262 1.6e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.075 3.6e-1 -0.063 3.8e-1 24 Click to see details
GSE17498 Multiple myeloma -0.046 3.9e-1 0.081 3.1e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.041 4.2e-1 -0.156 2.3e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.023 4.3e-1 0.018 4.4e-1 64 Click to see details
GSE17306 Multiple myeloma -0.018 4.5e-1 0.097 2.5e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.414 0 -0.458 0 49 Click to see details
STAD -0.822 0.01 -0.643 0.04 8 Click to see details
HNSC 0.989 0.05 1.000 0.5 3 Click to see details
KICH 0.504 0.1 0.357 0.19 8 Click to see details
KIRP 0.455 0.11 0.017 0.48 9 Click to see details
CHOL 0.378 0.16 0.217 0.29 9 Click to see details
ESCA -0.466 0.21 -0.500 0.2 5 Click to see details
KIRC 0.147 0.22 0.142 0.23 29 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
THCA -0.093 0.44 0.300 0.31 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*