miRTarBase - #MIRT023239 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP13A3   
Synonyms AFURS1
Description ATPase 13A3
Transcript NM_024524   
Expression
Putative miRNA Targets on ATP13A3
3'UTR of ATP13A3
(miRNA target sites are highlighted)
>ATP13A3|NM_024524|3'UTR
   1 CAGTGAATCAGTCTCAGTGGTATTGCTGATAGCAGTATTCAGGAATATGTGATTTTAGGAGTTTCTGATCCTGTGTGTCA
  81 GAATGGCACTAGTTCAGTTTATGTCCCTTCTGATATAGTAGCTTATTTGACAGCTTTGCTCTTCCTTAAAATAAAAACAG
 161 AAAAATATATCGTCCTAACAGTTAAATTAACAATCAATCCATAAAGTCCTATATCTTCATTCAGCAACCCAAATATTACA
 241 TACATTTCCAGAATTTTCTTGATTGTTACTTTCAGTGATATTCTTTATATTGGGTACAGGAGAAGTTTGGTGTTTGGTAG
 321 GTTTTTCAACATTAGTTTTTGAGACTAGTTTACCTCTTCACATTTATGCTCACAACCCTCTTGTTAGAAAAGTCTGTGTT
 401 TATATACAGGCTGTAAGTTTGTGATTGATAAAAAGAAGATGAGTGTTAATTAGCCTCCAGTGAAAATATACTGAAAGCCT
 481 GTTTTCATTTGATTCCAATGTTTCTTCCAAAGAATTCTGTATAAACATATGCCAATTCCCTATGATGGTCTAGAGTTAGG
 561 AATGAGTGTTTATGGTGTTGCTTATAGAACAACTCAGGTAATCTCCATTTCTGGTTTTATATTTTCTGTACAAACTGCCT
 641 GGGTTTTATTTTTCTAATCAGCAAGGTGCTTCACTGCCTTCTTGAGACGCCTCTCAAAGCTCTTAAATGGCTCCTGTGCT
 721 ATGTGTGGTGTTGGCAGTCTAATTTGCTTCTGTTAAATGTTGTAGAACCTTTTTCACTAGGAAATAAGATTCATTTCTTT
 801 CGGCAGTAGATGTAGATTCATCTTTTAACGTTTCTTCAAATTTGTTTCTGTCAGGCTTTGTGTTATTTTAAATGGTTTTT
 881 TAAAATTTTCTTCTATGTTTTCAATTACCTAAAGACATAGGATAATAGTTTTTTTTAAGTTAGAATTTTACCTCATAAAA
 961 TTTTTTGAGGTTTGATGTATGTCTCTGTCTTATCAATAATGAGGCTTAAAAAATACTGGATTTGAATGGCTGCCGTTTTT
1041 TCAAAGCAATATGAATTTGATGAGTTTGTTTTATGCCATTAGGTGGCGCCAGAGGTCAGAACATGTCTATTTTGAATTGG
1121 ATCGTTACAAATGAGCATATTTGATGCGGAAATTTCTGGGAGAAAAAAAATTGAGGAAATAAAGTTAAAAAATTGACATT
1201 CATTGAGCCAAAAGAGATGTGGAGAAACATTTTTCACCTTTCTGTTTGGCCTGATTAACATTTAAATTCTTGCCAAAATT
1281 AAGGTAACTTTTAAAAAACACCTTTTATAGGTGGATCCAGCAGTCTGGCAACGCCCACAGTTACCACAACACAGAAAACT
1361 GATCGTGCTATAAAATGGACGCTAAACTATGAAAACAGTGTGACATTGTTCTCTGTTCTTCCAGAGCCAGTAACATGCTT
1441 GCTCGTGCTTTCTACTTCTAGCTGATCATTCTTTTCCCAACATATATTTACAAATTTACCAAATTTTACCTAGAATTTTA
1521 GGACCAAATGGTTCTCACTCTTTATGCTGCAAAGACCTGGATGATGTTTGGTAACTATAGAAAAATAGAAATTACACTCA
1601 GGATCACTGTTACTGCTATTGCCACTGATGATTCCTGCAAAAATATAATCGAAGTTTTCCATCAAATGTATAATATGCTA
1681 TTAATACACATTAGATGATAACAGTTGTTCCATGAATGATTCTATGAAGCTATGCATCTTAGACCTCTTGAGCTGTGAAT
1761 TAGCACTATTTTCTATAGTTACTTATTCTCTGGATCATTTTATAATTTCCATATTAATTTCAAATATGCTCGTGTTATTC
1841 TTCAGTGATTTCCACAATTGTGCATTTTATTCTTTGGTTTAAGTACTGAAGCATATAATGAAAGTAATTGCTAAGTAGCA
1921 GCTTAAAAATTCAATTATCCGATTGTATTTAACATCTTTAAGAGCATGATCATAAAGAGCTATTTTTGACACCCCCCCCC
2001 CACTTTTTTAACATTTAGAGTTAGTAAGGGTTTTATATCTCTTCTGTCCATATTGTTTTCAAAGGAATGAGGTGTTTAGG
2081 TGGCTGGAAAAGCATTTGTAGGAAGTTAGATTTGAATATAGACAAGGTGGGTTATTCACGTTGAGAATGTTATTTGAAGA
2161 ATGCCTGTGAAGCCAGGTGTGGGTTCTACTCAGTGCCATAGATAGACTGAGTCTTCTCTCGTAGGTTACCATTACATAGT
2241 AATTTTGATTCTGAATTTCACATTAAATTATTTGAGTTTATACAGACCTAAATTTTAAAATCTGTACATATATTATTTTG
2321 ATGTATTAAGATGAATATTGCTGATTTAAATTTTATTTATGCACATACTTAAAGGACAGAAATGTCTGGGAAAGTAATTG
2401 TTAAATAATGATATGTAACTTTTTAACTTTTTAAATAAATAACAAGATTTTTAATGTGTGTCTCCCTCAGGGTTGTTTAA
2481 AGTTTTTTTTCTCCCTCAAGTATAAATAGTGGTAACTATATGTTTTGTATCTTCTAGCACCAACTGCTGTAAAGCAATGC
2561 TGCAAATAATGCTTGAATACAAGTGGCTAAGCCAACAACAGAATAAATACTTTTATAGTAGTTTTATAATCCTGAAATTC
2641 GAAAGCTTTCCCAATTGCACTTGCATCTAAACAAAACTGTTGCAGTTTTTACTCTATTTATTTTGTTCCCCATGTTTATG
2721 AAAGTCCTGCACAGTTTCAAAGGCATGGTAAATAATATATCAATGTTTATGTAGTCTGTTACAGAAACAGCTATAGATAA
2801 CATTATCCAGTGAAGAGCAAAATTCAAGCTTTAGAAAATATTCATGCATGCAATTTTGACATATCTAAAAATAGGTTTTT
2881 GTATATTTATGGTGGGAGGTGGTTGGGAACTTTTAACAAAATGGGGTGTTAATTTTTGTACAGTCTGTGGGCATTTACAC
2961 ATTTTTAATGTATTAAAATTTGGTAATTATGTGTACATTAAATTAATAAAAGTTACTTCTAGTTATGATTTGTGAATTCC
3041 CTAAGACCTTGGATTTTTTTAAGTAACTTTATATCAGAAATGATACTGCATCTTTATATTTTTAAAATTGTATTGCTGCT
3121 CAAGAATGGTACCCTCTTGTCAAAAAGGCATACATTCATAATTGTACATTCAGCATTGTAAATAATCTTATGAAACCTTT
3201 TTTGATTGAAGCTATTCAAAATAAAAATTTTAATGAATGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
3281 AAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGgu 5'
              ||: ||||| |||:||  
Target 5' cattCATAATTGT-ACATTCag 3'
3153 - 3173 129.00 -11.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            || |: :   |:||||||  
Target 5' gaAAAATAGAAATTACACTCag 3'
1580 - 1601 128.00 -9.20
3
miRNA  3' guUUGUGGUAACAG-UGUGAGGu 5'
            |: :|:||| |: |||| || 
Target 5' aaAGAGCTATTTTTGACACCCCc 3'
1974 - 1996 128.00 -8.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31502261 2 COSMIC
COSN18717881 17 COSMIC
COSN31523001 86 COSMIC
COSN30466830 93 COSMIC
COSN31486221 117 COSMIC
COSN30126386 171 COSMIC
COSN30121810 258 COSMIC
COSN23563175 512 COSMIC
COSN5042429 657 COSMIC
COSN7758805 785 COSMIC
COSN7599522 1159 COSMIC
COSN7599521 1468 COSMIC
COSN20074765 1507 COSMIC
COSN28636693 1567 COSMIC
COSN30174512 1627 COSMIC
COSN1939620 1670 COSMIC
COSN26555606 1687 COSMIC
COSN30092422 1734 COSMIC
COSN30560288 1739 COSMIC
COSN30584444 1791 COSMIC
COSN19706108 1828 COSMIC
COSN30171142 1845 COSMIC
COSN28677715 1922 COSMIC
COSN31539595 1929 COSMIC
COSN19543970 1958 COSMIC
COSN20090978 1991 COSMIC
COSN20099555 1991 COSMIC
COSN15664019 1992 COSMIC
COSN20090977 2002 COSMIC
COSN23286164 2035 COSMIC
COSN25724324 2337 COSMIC
COSN1939618 2405 COSMIC
COSN22836421 2447 COSMIC
COSN9717947 2577 COSMIC
COSN27043670 2604 COSMIC
COSN16947219 2727 COSMIC
COSN22373505 2750 COSMIC
COSN22028745 2834 COSMIC
COSN17654842 2932 COSMIC
COSN16944769 3030 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1256640422 4 dbSNP
rs1450547406 5 dbSNP
rs1379294464 7 dbSNP
rs374940660 10 dbSNP
rs761847595 11 dbSNP
rs925867412 12 dbSNP
rs753912223 13 dbSNP
rs1168093686 15 dbSNP
rs1406830763 20 dbSNP
rs764363138 21 dbSNP
rs760872928 23 dbSNP
rs775785167 34 dbSNP
rs770792579 35 dbSNP
rs987785787 37 dbSNP
rs1282783421 38 dbSNP
rs762864781 40 dbSNP
rs773246248 43 dbSNP
rs769894341 45 dbSNP
rs1472880705 49 dbSNP
rs974617739 56 dbSNP
rs745921952 78 dbSNP
rs1219925922 88 dbSNP
rs1344069374 90 dbSNP
rs1176386007 92 dbSNP
rs1251757476 95 dbSNP
rs1374314171 103 dbSNP
rs1432392123 105 dbSNP
rs925051708 107 dbSNP
rs1226613319 116 dbSNP
rs776893419 147 dbSNP
rs1305764946 165 dbSNP
rs1303485043 168 dbSNP
rs979633494 169 dbSNP
rs1371689766 170 dbSNP
rs1221154677 171 dbSNP
rs1405678466 172 dbSNP
rs1302316879 177 dbSNP
rs1347451379 184 dbSNP
rs1276902293 191 dbSNP
rs529796953 191 dbSNP
rs375311582 193 dbSNP
rs1009088431 197 dbSNP
rs1412014603 205 dbSNP
rs950515947 211 dbSNP
rs1023899503 223 dbSNP
rs1191396973 224 dbSNP
rs1394040502 228 dbSNP
rs34928166 231 dbSNP
rs1025992925 232 dbSNP
rs1169891506 233 dbSNP
rs1370655723 240 dbSNP
rs994976598 242 dbSNP
rs1025541190 244 dbSNP
rs1353109963 245 dbSNP
rs1167762889 248 dbSNP
rs1438985361 250 dbSNP
rs546026679 256 dbSNP
rs994116518 264 dbSNP
rs1446147295 265 dbSNP
rs1370475856 272 dbSNP
rs1299893192 275 dbSNP
rs1343017128 277 dbSNP
rs1213914350 279 dbSNP
rs1270865257 279 dbSNP
rs899303042 281 dbSNP
rs1252175661 293 dbSNP
rs1055346004 294 dbSNP
rs1390220683 297 dbSNP
rs1474830008 308 dbSNP
rs1165669026 315 dbSNP
rs1417915329 317 dbSNP
rs1407609718 319 dbSNP
rs111562842 329 dbSNP
rs1480495606 345 dbSNP
rs1051717979 346 dbSNP
rs934168465 349 dbSNP
rs867505103 354 dbSNP
rs572140093 371 dbSNP
rs1250967707 375 dbSNP
rs1046373275 377 dbSNP
rs1268497248 382 dbSNP
rs1358330437 383 dbSNP
rs1240823377 391 dbSNP
rs945344363 392 dbSNP
rs1272284404 396 dbSNP
rs914002047 396 dbSNP
rs769606088 407 dbSNP
rs745473796 410 dbSNP
rs780875022 411 dbSNP
rs1053836332 412 dbSNP
rs201874130 421 dbSNP
rs527873297 425 dbSNP
rs79761598 426 dbSNP
rs1446073125 432 dbSNP
rs979171927 439 dbSNP
rs974686443 450 dbSNP
rs943282742 453 dbSNP
rs541927710 460 dbSNP
rs574507399 462 dbSNP
rs1166340994 467 dbSNP
rs1322949346 469 dbSNP
rs1417590187 477 dbSNP
rs969557615 478 dbSNP
rs1161841911 480 dbSNP
rs911775547 481 dbSNP
rs142965231 482 dbSNP
rs1342389250 483 dbSNP
rs1415286547 493 dbSNP
rs987168195 498 dbSNP
rs566991551 500 dbSNP
rs1229934633 510 dbSNP
rs370348334 521 dbSNP
rs1336633756 527 dbSNP
rs1203060749 530 dbSNP
rs1026024434 532 dbSNP
rs1442562550 534 dbSNP
rs994047812 535 dbSNP
rs1474514704 538 dbSNP
rs777945474 540 dbSNP
rs866219239 542 dbSNP
rs963550023 558 dbSNP
rs1033794082 565 dbSNP
rs1157085255 573 dbSNP
rs1017362496 582 dbSNP
rs1006951781 583 dbSNP
rs1303954666 590 dbSNP
rs186240701 592 dbSNP
rs1002890202 593 dbSNP
rs1469813644 601 dbSNP
rs1029774385 603 dbSNP
rs758790737 605 dbSNP
rs1236427126 616 dbSNP
rs1173723061 626 dbSNP
rs748895872 645 dbSNP
rs1025617849 655 dbSNP
rs998343885 662 dbSNP
rs1473361777 668 dbSNP
rs1277611714 671 dbSNP
rs1009577688 672 dbSNP
rs1364067557 674 dbSNP
rs1180786010 676 dbSNP
rs1417118326 679 dbSNP
rs892432639 680 dbSNP
rs779701570 688 dbSNP
rs751073323 689 dbSNP
rs1179907901 692 dbSNP
rs1379524218 696 dbSNP
rs1454897098 699 dbSNP
rs1173036651 705 dbSNP
rs1393406239 709 dbSNP
rs936725966 715 dbSNP
rs558157041 719 dbSNP
rs1395490379 721 dbSNP
rs904381303 722 dbSNP
rs1460877950 723 dbSNP
rs1325282146 724 dbSNP
rs1371224644 726 dbSNP
rs903490971 730 dbSNP
rs1038905704 737 dbSNP
rs1300598601 743 dbSNP
rs943168922 751 dbSNP
rs1261319334 758 dbSNP
rs1230254189 763 dbSNP
rs1252466170 764 dbSNP
rs755809937 769 dbSNP
rs1194397635 770 dbSNP
rs1255313274 774 dbSNP
rs1351631386 775 dbSNP
rs1279216689 776 dbSNP
rs947771531 789 dbSNP
rs911823286 792 dbSNP
rs370067535 801 dbSNP
rs1460430809 811 dbSNP
rs1316261717 813 dbSNP
rs757127967 814 dbSNP
rs74437536 819 dbSNP
rs962966910 820 dbSNP
rs1016872770 829 dbSNP
rs1382239594 830 dbSNP
rs985851017 833 dbSNP
rs1385181461 843 dbSNP
rs1225942848 850 dbSNP
rs954103085 853 dbSNP
rs1336009507 860 dbSNP
rs1213288907 864 dbSNP
rs973153768 873 dbSNP
rs963078056 881 dbSNP
rs1187140334 882 dbSNP
rs1261151128 887 dbSNP
rs1426636469 891 dbSNP
rs547892407 895 dbSNP
rs1029751381 898 dbSNP
rs879538062 902 dbSNP
rs980975043 904 dbSNP
rs1369985358 910 dbSNP
rs971268330 911 dbSNP
rs998276458 913 dbSNP
rs763757548 914 dbSNP
rs1025226586 917 dbSNP
rs1287760440 924 dbSNP
rs891938045 928 dbSNP
rs1010231102 931 dbSNP
rs1381018825 937 dbSNP
rs527595967 937 dbSNP
rs533205296 937 dbSNP
rs892504546 938 dbSNP
rs1190542566 943 dbSNP
rs1447676852 950 dbSNP
rs1271693872 951 dbSNP
rs1283755353 952 dbSNP
rs1203618253 953 dbSNP
rs1216831393 977 dbSNP
rs1032325170 981 dbSNP
rs762829140 987 dbSNP
rs899931880 993 dbSNP
rs894813123 1001 dbSNP
rs1258067147 1005 dbSNP
rs1474841656 1018 dbSNP
rs1040160216 1030 dbSNP
rs1381188299 1034 dbSNP
rs1419272588 1035 dbSNP
rs1158009304 1036 dbSNP
rs148379891 1037 dbSNP
rs568120774 1038 dbSNP
rs943220748 1043 dbSNP
rs890285358 1044 dbSNP
rs1051721648 1050 dbSNP
rs1376555020 1053 dbSNP
rs1414733671 1054 dbSNP
rs929204490 1055 dbSNP
rs1056106794 1058 dbSNP
rs918944524 1059 dbSNP
rs1376030778 1063 dbSNP
rs1224532497 1067 dbSNP
rs1300487409 1072 dbSNP
rs1432233907 1083 dbSNP
rs1037345282 1084 dbSNP
rs549716221 1088 dbSNP
rs143370761 1094 dbSNP
rs918395886 1104 dbSNP
rs1208691231 1106 dbSNP
rs972519611 1109 dbSNP
rs980888906 1117 dbSNP
rs1176428081 1121 dbSNP
rs970959044 1123 dbSNP
rs7611390 1124 dbSNP
rs1394002337 1127 dbSNP
rs988435126 1140 dbSNP
rs1332841150 1144 dbSNP
rs1383246743 1146 dbSNP
rs552175140 1147 dbSNP
rs985431619 1148 dbSNP
rs1297968070 1151 dbSNP
rs1371404104 1153 dbSNP
rs1032567276 1156 dbSNP
rs1236832007 1162 dbSNP
rs1000877449 1168 dbSNP
rs1475743703 1171 dbSNP
rs954146244 1171 dbSNP
rs7616001 1178 dbSNP
rs1018401110 1183 dbSNP
rs372708296 1185 dbSNP
rs1230986906 1187 dbSNP
rs1469514234 1189 dbSNP
rs1453524145 1192 dbSNP
rs976805456 1193 dbSNP
rs149218136 1208 dbSNP
rs544164490 1216 dbSNP
rs1031784099 1226 dbSNP
rs1422188818 1232 dbSNP
rs1170127860 1234 dbSNP
rs1000759640 1236 dbSNP
rs1443374503 1243 dbSNP
rs890327010 1244 dbSNP
rs1357774420 1249 dbSNP
rs535564955 1250 dbSNP
rs1326901211 1258 dbSNP
rs529774658 1270 dbSNP
rs1277327355 1280 dbSNP
rs1215673946 1293 dbSNP
rs993265758 1306 dbSNP
rs1370550262 1307 dbSNP
rs1434316322 1308 dbSNP
rs1339388183 1317 dbSNP
rs1339942425 1318 dbSNP
rs1269052607 1327 dbSNP
rs1213967516 1329 dbSNP
rs1270582531 1331 dbSNP
rs897757252 1332 dbSNP
rs1213912543 1338 dbSNP
rs1037545843 1339 dbSNP
rs941701566 1341 dbSNP
rs879093400 1346 dbSNP
rs1272080836 1354 dbSNP
rs1466861998 1361 dbSNP
rs562471547 1364 dbSNP
rs1476010648 1365 dbSNP
rs1044853714 1373 dbSNP
rs1428085484 1376 dbSNP
rs949144707 1380 dbSNP
rs1303400132 1381 dbSNP
rs776840188 1389 dbSNP
rs917651705 1390 dbSNP
rs771059715 1391 dbSNP
rs1363491806 1392 dbSNP
rs183023581 1394 dbSNP
rs1393974592 1396 dbSNP
rs113880770 1406 dbSNP
rs1320347709 1408 dbSNP
rs1327139140 1413 dbSNP
rs761024731 1424 dbSNP
rs1429932073 1429 dbSNP
rs1276286627 1433 dbSNP
rs576746713 1444 dbSNP
rs61257072 1445 dbSNP
rs778283493 1464 dbSNP
rs1166201003 1467 dbSNP
rs1353758172 1470 dbSNP
rs925528774 1480 dbSNP
rs979679726 1481 dbSNP
rs1284341435 1484 dbSNP
rs1445977639 1484 dbSNP
rs964076678 1493 dbSNP
rs1213052632 1499 dbSNP
rs1261574462 1502 dbSNP
rs1476493105 1509 dbSNP
rs1481477640 1510 dbSNP
rs1018680891 1527 dbSNP
rs896894620 1530 dbSNP
rs766814276 1531 dbSNP
rs1471917303 1534 dbSNP
rs1385739437 1536 dbSNP
rs1036815439 1541 dbSNP
rs1296423664 1543 dbSNP
rs941185976 1544 dbSNP
rs1415345539 1551 dbSNP
rs1292423468 1554 dbSNP
rs1338554165 1557 dbSNP
rs773795660 1558 dbSNP
rs1050077081 1561 dbSNP
rs546152462 1566 dbSNP
rs932600167 1586 dbSNP
rs922576445 1591 dbSNP
rs1025697413 1592 dbSNP
rs1486929181 1597 dbSNP
rs976731796 1599 dbSNP
rs772273076 1601 dbSNP
rs897622871 1602 dbSNP
rs1257248702 1608 dbSNP
rs748487202 1613 dbSNP
rs924682666 1625 dbSNP
rs1364531685 1626 dbSNP
rs145772393 1637 dbSNP
rs904885344 1640 dbSNP
rs1397018955 1642 dbSNP
rs1045147719 1645 dbSNP
rs553904248 1650 dbSNP
rs969256596 1652 dbSNP
rs535554991 1663 dbSNP
rs1023146034 1670 dbSNP
rs1162176746 1675 dbSNP
rs949052003 1676 dbSNP
rs896232842 1680 dbSNP
rs1392850140 1686 dbSNP
rs1329332312 1687 dbSNP
rs1052146356 1691 dbSNP
rs1444193411 1694 dbSNP
rs1222517304 1696 dbSNP
rs1348065955 1697 dbSNP
rs935525937 1702 dbSNP
rs1255860025 1707 dbSNP
rs1343493823 1711 dbSNP
rs1197882681 1720 dbSNP
rs925435493 1722 dbSNP
rs1289611445 1723 dbSNP
rs1244124307 1724 dbSNP
rs1356092876 1728 dbSNP
rs747642175 1734 dbSNP
rs780629086 1743 dbSNP
rs1254952656 1745 dbSNP
rs1372555349 1755 dbSNP
rs1173095249 1760 dbSNP
rs1035929756 1761 dbSNP
rs1463485598 1762 dbSNP
rs1438357022 1765 dbSNP
rs768354583 1768 dbSNP
rs746580802 1775 dbSNP
rs1327568331 1776 dbSNP
rs1422416088 1786 dbSNP
rs942930345 1790 dbSNP
rs1158759706 1791 dbSNP
rs911452123 1800 dbSNP
rs779776111 1803 dbSNP
rs1439432791 1811 dbSNP
rs1193492219 1812 dbSNP
rs1298594078 1813 dbSNP
rs1343313381 1822 dbSNP
rs987222016 1823 dbSNP
rs1246536466 1824 dbSNP
rs1230318981 1826 dbSNP
rs190436920 1831 dbSNP
rs955370321 1832 dbSNP
rs201096434 1833 dbSNP
rs1286946756 1838 dbSNP
rs1239537784 1841 dbSNP
rs1315139248 1843 dbSNP
rs1386472167 1844 dbSNP
rs1275209682 1845 dbSNP
rs758719986 1848 dbSNP
rs200011258 1857 dbSNP
rs1005311420 1858 dbSNP
rs1190637474 1859 dbSNP
rs1302355922 1859 dbSNP
rs779286915 1860 dbSNP
rs556231966 1862 dbSNP
rs879687908 1864 dbSNP
rs1298355794 1874 dbSNP
rs972791225 1876 dbSNP
rs1049601965 1878 dbSNP
rs1452600318 1885 dbSNP
rs1372278789 1886 dbSNP
rs757818952 1887 dbSNP
rs1177572215 1892 dbSNP
rs1463809999 1895 dbSNP
rs1434288826 1903 dbSNP
rs1429149261 1916 dbSNP
rs932498085 1918 dbSNP
rs1478975289 1919 dbSNP
rs753947007 1921 dbSNP
rs538274525 1925 dbSNP
rs1460615250 1932 dbSNP
rs1291265839 1933 dbSNP
rs570737469 1934 dbSNP
rs552469274 1938 dbSNP
rs1384414401 1939 dbSNP
rs769429344 1940 dbSNP
rs1340456513 1941 dbSNP
rs761147700 1944 dbSNP
rs1401948983 1949 dbSNP
rs961887164 1953 dbSNP
rs527557368 1954 dbSNP
rs1006118986 1960 dbSNP
rs1221167936 1962 dbSNP
rs185581435 1964 dbSNP
rs1486925490 1968 dbSNP
rs1205801837 1974 dbSNP
rs1041018798 1977 dbSNP
rs1476816852 1980 dbSNP
rs1308739146 1989 dbSNP
rs758861949 1991 dbSNP
rs374156178 1992 dbSNP
rs60210039 1992 dbSNP
rs1023517389 1993 dbSNP
rs1287815971 1994 dbSNP
rs979225444 1994 dbSNP
rs1372363821 1996 dbSNP
rs1315144121 1998 dbSNP
rs1013671385 1999 dbSNP
rs896150381 2001 dbSNP
rs1491022818 2002 dbSNP
rs3836225 2002 dbSNP
rs397876388 2002 dbSNP
rs767285736 2002 dbSNP
rs796767353 2002 dbSNP
rs933101684 2002 dbSNP
rs1179906012 2003 dbSNP
rs1454512005 2003 dbSNP
rs947512143 2003 dbSNP
rs1157506409 2004 dbSNP
rs916003416 2010 dbSNP
rs14414 2024 dbSNP
rs935054044 2030 dbSNP
rs1336141174 2043 dbSNP
rs1447668376 2050 dbSNP
rs1301487651 2065 dbSNP
rs1468324149 2074 dbSNP
rs960230001 2077 dbSNP
rs1347132535 2079 dbSNP
rs1160114657 2083 dbSNP
rs1400419805 2091 dbSNP
rs1236390083 2096 dbSNP
rs1406234547 2107 dbSNP
rs1311565184 2118 dbSNP
rs1207699917 2121 dbSNP
rs1234446450 2128 dbSNP
rs1480737704 2130 dbSNP
rs1185873048 2131 dbSNP
rs904043484 2139 dbSNP
rs1243110806 2140 dbSNP
rs972289788 2144 dbSNP
rs9878016 2159 dbSNP
rs546823356 2163 dbSNP
rs377047250 2177 dbSNP
rs529912773 2178 dbSNP
rs960992608 2181 dbSNP
rs1426436063 2183 dbSNP
rs1414419096 2188 dbSNP
rs1015274772 2198 dbSNP
rs1356680888 2207 dbSNP
rs1466333304 2210 dbSNP
rs1331000290 2216 dbSNP
rs1262064032 2218 dbSNP
rs181177423 2220 dbSNP
rs72607888 2221 dbSNP
rs11900 2227 dbSNP
rs1247965883 2228 dbSNP
rs987032919 2229 dbSNP
rs1217447545 2236 dbSNP
rs189239650 2237 dbSNP
rs1314318637 2239 dbSNP
rs1197797683 2250 dbSNP
rs140298913 2261 dbSNP
rs1469557465 2262 dbSNP
rs972821009 2266 dbSNP
rs1245669597 2267 dbSNP
rs1289586901 2269 dbSNP
rs1430262417 2271 dbSNP
rs1477969233 2283 dbSNP
rs962750517 2304 dbSNP
rs1016945756 2305 dbSNP
rs1422077806 2308 dbSNP
rs1478319630 2310 dbSNP
rs1170416783 2311 dbSNP
rs546485727 2312 dbSNP
rs1463258095 2315 dbSNP
rs374883168 2316 dbSNP
rs1165826783 2325 dbSNP
rs1349442097 2325 dbSNP
rs1425723298 2330 dbSNP
rs777745229 2359 dbSNP
rs1162239109 2361 dbSNP
rs1421476074 2362 dbSNP
rs1263219228 2379 dbSNP
rs984596059 2384 dbSNP
rs1186662247 2388 dbSNP
rs1217750431 2390 dbSNP
rs1276089761 2393 dbSNP
rs969209341 2395 dbSNP
rs1024011083 2405 dbSNP
rs1013494051 2406 dbSNP
rs758451897 2411 dbSNP
rs1030651849 2413 dbSNP
rs999166025 2419 dbSNP
rs1217327410 2421 dbSNP
rs567221920 2425 dbSNP
rs1244270588 2427 dbSNP
rs151066144 2433 dbSNP
rs1224371839 2435 dbSNP
rs903621250 2438 dbSNP
rs1359902437 2440 dbSNP
rs915988227 2442 dbSNP
rs1421985147 2446 dbSNP
rs1476308772 2458 dbSNP
rs1242507567 2466 dbSNP
rs1043463857 2477 dbSNP
rs1413366634 2479 dbSNP
rs572603949 2482 dbSNP
rs1309245572 2491 dbSNP
rs1320408140 2491 dbSNP
rs1399377414 2492 dbSNP
rs752538229 2494 dbSNP
rs889959949 2496 dbSNP
rs1245047255 2498 dbSNP
rs1283179293 2499 dbSNP
rs1353826150 2500 dbSNP
rs1051819434 2504 dbSNP
rs991571221 2506 dbSNP
rs146684625 2508 dbSNP
rs934248172 2514 dbSNP
rs1488886343 2527 dbSNP
rs918611818 2533 dbSNP
rs1305212330 2535 dbSNP
rs1037011931 2541 dbSNP
rs1365346968 2548 dbSNP
rs1237083170 2549 dbSNP
rs1471948517 2557 dbSNP
rs972262187 2560 dbSNP
rs962291396 2562 dbSNP
rs1016953246 2563 dbSNP
rs941330844 2581 dbSNP
rs1301758870 2589 dbSNP
rs909971957 2593 dbSNP
rs559246034 2602 dbSNP
rs1338314191 2609 dbSNP
rs542057545 2616 dbSNP
rs1028070218 2617 dbSNP
rs1352419321 2618 dbSNP
rs73889860 2625 dbSNP
rs556268702 2626 dbSNP
rs537924720 2629 dbSNP
rs1420943374 2631 dbSNP
rs762009638 2634 dbSNP
rs992507208 2640 dbSNP
rs960629382 2641 dbSNP
rs1019476295 2644 dbSNP
rs998710301 2655 dbSNP
rs1238848678 2658 dbSNP
rs1207891067 2664 dbSNP
rs1439098465 2668 dbSNP
rs570840683 2671 dbSNP
rs558641990 2683 dbSNP
rs774478592 2690 dbSNP
rs1043400260 2694 dbSNP
rs139437389 2696 dbSNP
rs185926558 2698 dbSNP
rs1316160129 2708 dbSNP
rs1399885074 2708 dbSNP
rs1411284827 2710 dbSNP
rs1285360494 2712 dbSNP
rs1375702482 2719 dbSNP
rs1022094733 2728 dbSNP
rs1224351758 2733 dbSNP
rs894466784 2734 dbSNP
rs1305024730 2743 dbSNP
rs570777581 2747 dbSNP
rs548495981 2748 dbSNP
rs182148172 2752 dbSNP
rs889981610 2754 dbSNP
rs1051255340 2756 dbSNP
rs998738329 2758 dbSNP
rs76390303 2759 dbSNP
rs762835995 2763 dbSNP
rs909459415 2768 dbSNP
rs1433698723 2772 dbSNP
rs1198148393 2774 dbSNP
rs941404202 2776 dbSNP
rs189645011 2778 dbSNP
rs76813681 2790 dbSNP
rs1480546370 2796 dbSNP
rs150930223 2797 dbSNP
rs948812155 2801 dbSNP
rs917296491 2806 dbSNP
rs1463775506 2807 dbSNP
rs80136368 2810 dbSNP
rs960496666 2816 dbSNP
rs923859004 2818 dbSNP
rs965105717 2829 dbSNP
rs1019404156 2832 dbSNP
rs1176555454 2837 dbSNP
rs1279259335 2839 dbSNP
rs1317498239 2842 dbSNP
rs1217104250 2846 dbSNP
rs1267289462 2846 dbSNP
rs978002348 2860 dbSNP
rs1456441629 2861 dbSNP
rs967741801 2870 dbSNP
rs546324073 2872 dbSNP
rs112690318 2874 dbSNP
rs1489241519 2881 dbSNP
rs1194083726 2883 dbSNP
rs1422700559 2884 dbSNP
rs1021501485 2893 dbSNP
rs1011914763 2895 dbSNP
rs1007076592 2913 dbSNP
rs953839483 2917 dbSNP
rs894445185 2933 dbSNP
rs1389145717 2934 dbSNP
rs1402452421 2938 dbSNP
rs1204445816 2944 dbSNP
rs1323056875 2947 dbSNP
rs528079897 2947 dbSNP
rs1340360334 2950 dbSNP
rs1398554313 2951 dbSNP
rs1029797869 2954 dbSNP
rs1322583647 2977 dbSNP
rs998367630 2983 dbSNP
rs1241546276 2985 dbSNP
rs1002853906 2990 dbSNP
rs1263804139 2991 dbSNP
rs897326149 2992 dbSNP
rs1336726282 2997 dbSNP
rs760827090 3002 dbSNP
rs115503599 3007 dbSNP
rs1217341414 3016 dbSNP
rs1036441507 3018 dbSNP
rs773211859 3022 dbSNP
rs1183387310 3029 dbSNP
rs546031834 3044 dbSNP
rs775426889 3047 dbSNP
rs1385682847 3049 dbSNP
rs575377853 3051 dbSNP
rs1044419465 3058 dbSNP
rs1422047448 3061 dbSNP
rs557116327 3061 dbSNP
rs922202472 3061 dbSNP
rs1360451835 3065 dbSNP
rs895906988 3075 dbSNP
rs1304981841 3093 dbSNP
rs975061016 3094 dbSNP
rs184890113 3096 dbSNP
rs769771065 3103 dbSNP
rs1455091731 3104 dbSNP
rs35453719 3108 dbSNP
rs574715374 3109 dbSNP
rs1364158057 3121 dbSNP
rs977575433 3139 dbSNP
rs967200833 3140 dbSNP
rs34250988 3147 dbSNP
rs1285140343 3153 dbSNP
rs1351463411 3157 dbSNP
rs1211916980 3181 dbSNP
rs550362648 3183 dbSNP
rs1180896547 3187 dbSNP
rs1482707160 3189 dbSNP
rs1179824922 3190 dbSNP
rs1239633384 3195 dbSNP
rs1437728225 3202 dbSNP
rs1021888646 3206 dbSNP
rs939208723 3210 dbSNP
rs958854911 3222 dbSNP
rs1399512786 3228 dbSNP
rs1184249910 3231 dbSNP
rs1178646556 3242 dbSNP
rs923764066 3242 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.355 6.2e-2 0.036 4.4e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.329 6.3e-2 0.074 3.7e-1 23 Click to see details
GSE28544 Breast cancer 0.202 1.7e-1 0.082 3.5e-1 24 Click to see details
GSE17306 Multiple myeloma -0.105 2.4e-1 0.100 2.5e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.149 2.4e-1 0.194 1.8e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.149 2.4e-1 -0.082 3.5e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.135 2.6e-1 0.035 4.3e-1 25 Click to see details
GSE17498 Multiple myeloma -0.095 2.8e-1 -0.127 2.2e-1 40 Click to see details
GSE14794 Lymphoblastoid cells -0.032 3.8e-1 -0.020 4.3e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.05 3.9e-1 0.175 1.7e-1 32 Click to see details
GSE38226 Liver fibrosis -0.06 4.0e-1 -0.046 4.2e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.007 4.8e-1 0.124 1.6e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.016 4.8e-1 0.055 4.3e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.014 4.9e-1 -0.257 3.1e-1 6 Click to see details
GSE19350 CNS germ cell tumors -0.006 4.9e-1 0.213 2.5e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.577 0.07 0.548 0.08 8 Click to see details
ESCA -0.573 0.16 -0.400 0.25 5 Click to see details
KIRC 0.185 0.17 0.214 0.13 29 Click to see details
LIHC 0.115 0.22 0.147 0.16 49 Click to see details
CHOL 0.189 0.31 0.217 0.29 9 Click to see details
THCA 0.289 0.32 0.600 0.14 5 Click to see details
KICH 0.169 0.34 0.214 0.31 8 Click to see details
HNSC -0.25 0.42 0.500 0.33 3 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
KIRP -0.019 0.48 0.067 0.43 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*