miRTarBase - #MIRT023244 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM74   
Synonyms NET36
Description transmembrane protein 74
Transcript NM_153015   
Expression
Putative miRNA Targets on TMEM74
3'UTR of TMEM74
(miRNA target sites are highlighted)
>TMEM74|NM_153015|3'UTR
   1 TTCTGGTTGTGAATATCTTGAGAGTCTGCCTTGGCATTTTATAATATGAAAAAAGTTAATTTATAAAAATTCACAGTGCA
  81 ATTTATTTGCCTGGCAAGAAAAGTTTATTTCACAAACCAACAGCCAGTAAGTGTTTTTGTTCTCTATGTGTCTTCTATTT
 161 AGAAGAAAAGCCATGTAAGATGTATAAGAAACCACAACCAGCCACACCTATCCTTCTGAAGAGCTGAAGGCTAATTAATC
 241 TGTAATGGCCAAGAACTTCTACTTCGATAGAAAAATATTTCTAATGACCCAGTCTACAAATTATTTCTTTTACACAAATA
 321 TATGATGTTATTCTTTGGACACTAGGTGGTCCTACACACAGTAGGATCAATTGCTAATCTACTTTGTGAAAAAGAACTAA
 401 GCACTAATCAATAATAAGGCTTACATCTAATTCTCAAAGGTGCTTATCCATTTTCTTGCTAAATTATCCTTCTTGTAATT
 481 TGGCTAAACACTAAAACATGGAATTTTTAGTTTGAATATTTTGAAGTTTGAGGATGTTGGGCTTTCCTTATTGTAAAAAA
 561 TGTTATGTTTGAAATTATTCCTGTTTTCAAAAATGGTAATTAAGTCATTAGGATAAACTTTCTAATAAAAAAAAATTATG
 641 TAAATCATTGTAAGACCAATGTGAATTTAAACCACAGTGTTGGTGCCAGATATTAGCCAGGGTCACAGGCTCTTTTTTAA
 721 AATGAAGTCAAATTAGTTACTGATATAAGTTTTATATTTTGTGATTTTGCCATCATACTGGTTATCTGTGCTCTTGAAGT
 801 CTGCTGGTTCTCACACCAGCAGCAAGAGGCAAGGCATGAGACATTTTAAATATATTTCCAGACATCTAAACATCTAGACA
 881 GGCCTGAGTCATGATTGGCTCTGGTGTGCTTCCAGGTAACATCTTGTTATTGCTGTTTGGGGAAAACCACCAATAGAATT
 961 GCAGCTAGACTTTTGGGGACTGTGCCTCGCAGGCTGTATCACTTGCTGTAGGCCAAGCAACGAGCACTTCCCTCATGGTA
1041 GCAACAGTCCTTAAGCCCAAAGCCAAAAAAAAATAAAATGGAAAGAGAGATTCAATACACTGATTTAATGGGGACTGTAG
1121 TCATCGTCAGAACTCACCTCCCACTCACAGTGGTCTAGATGTCATTCAGCAACTGTGAACTCTTGCCTCATGCAGCACAA
1201 ACTCTTCTCTAAGAGCAGCATGATGAGCAAGGTGCTCACTTTGCAAGACACACACTGGGTGTTCACAGTGACAGACCGCC
1281 TCATTATGGTGACGGTTCAGAAAAGGGATGGGAAATGCAGCCTCAGAAATACCTTACATTTTGCAACTCTGCCTGGAGGT
1361 TTTTCCAACCTGTGCTCTAAGAGTTGTTGTAACTTCCATGATTGTGTTACCAGGATCAGGGGGTCATTCTTAAAAAGAGG
1441 ACAGGAGCTGGGAATTGGTATGAGACAGCAGGAATGAGGAAGTAAGAAAGTGATTTCTTTGCAGATTTTTAAAGGCTATT
1521 TCAAATGTCTGAAGTTTGTGGTGTTGTGGACAACTGTGGAATACATGGGTGACTTTGGCAAAATGTGTGAATCAGGATAT
1601 TTATGTGGATGAGCTCTCATGGGTGTCAGATTGATTTGATGAGTGAGGTATGCTGCATATGACTTAAGGGTTGAACTGAA
1681 ATACAAAAAGGGAGGCTCAGAAGATAGTAAAAAGAGAGGATGGGCATATGAAAGAATTATTAAGTAAAAATGAGAAATTA
1761 TATGGCCATCAGAGGAAGCTAGATGTAGTTAATTGCCTTATGTTATAGAGCAATACTGATTACTGAAAAGAAAGAATTGA
1841 GATGACATAAACATGATTTTTGCTTTCTGTTGCTGTATTTTTGTGCTTTTTGAACAAACTTTGTTTTACTGTGACTCTCA
1921 TTTCATGATTTTTGTTGAGGCTGCCTTACCAGTGGTATAAGTTTTATATTCTGAAGGTTTCTAAGTCCAGCTCTAGCCTG
2001 CTTAAGGATCCACTTTGGATGATGTTGAAACAAGAAGGAAACGATCTGCTGAGTGAGTAGGTCTGAGCTGTGTGTTAAAA
2081 AAAGAAGGCATTAAAAAAAAGAAGGCATTAAAGAAAAAACTAATGTTTATTCATAGAAGCTAAATGAGATCAACTGAGTT
2161 TTTATTTATTGGTGAAACAGGATTAATTAGCCAAATGGCAGACTAAACTGAATTAATGTGGAATCAATTTTCAGTTTATG
2241 AAGGAAGAGGAGTTTGGGAATCAAGTGTTAGGAGGTCTTTTCACTTGATAATAAAGCTTTTCATGTGGAAGCATTTAATG
2321 AATCTTGCAGGGCTACCAAATAATATAGATTTGATCTAGAGGTAACATTTTGAAAAATGCCATTTTGGAAAAAAAATATT
2401 CAACGGGGGAGAAAAAGACCTAACACATCAAAATACATTTCCTTTCTTTTCCCTAGAATGCTATAATTTCCTTTAAAATT
2481 TAAAATCGAAATGTGGTAAGTAAATGCACACTTCAACATTATTTAAATCTGCTAACATATAGAGCACCTCTCTTTTAAGG
2561 TTCTACTTATCTGAGGGCAAACCATTACACATTACATGATTTTGAAAATCATCTGAATGACTTCTTTTGGGCTGTGGTGA
2641 CATTATTCAGATACTTGCCTTAATCGACTTTTCCCTGGGTATTTGGTTTATGTAGCCCTTATCCATCCTGCCTGAATTCA
2721 ATATGAAGATTACTTGAATTTAAAATGATGGTAACACAGGCAAAGAAAAGCCATGTGCTTTATTTCCTGTTTTTCCCAAT
2801 CTGACAAAGAGTGTTTTTGGCTCTAGAGGTACTTTGGCAAGACCAGGTGATGCATTCTATAGACATTGGGCATACAATAC
2881 CTATAGTTTTGGTCTTGCATCCTTCATGGAGATTTGTGACCTTCCGTCTGTCTCTTCAATATGGTGCTGGTTGTTACCTG
2961 TGAAAGTTTTTATTGCTAGTCCTAGAGAAGAAAAACATATTTCAGTGGTTCTAGGTCTTTAGCTTATTTACATGGTTTTA
3041 GAAATCTAAACTCAAGAGTCATCTTCCTAGTCTCAATGAGAAGACAGCTCGTCTTTCAGCAGTGTGGCCCAATGGGGTGA
3121 GTTACAGAAAGAAAGCTGTCTTTCTCCTTTATTACTGGGATCTACACGCTGCTGGTGGATGATTTAAGGCTCCTAATATC
3201 TTTATAAGCCAGTTCTTTTTAGGGCACCTTAAACTGTTAGTGGTAGAGTTTGCAAAGAGTTTTCTTTGCAGCGCTGTGTG
3281 TCCTTCCCACCCATTGGGAGCTCTTAAAGCAGATCACATAATAAGATGTACTGGCCCCTCATATAAAGAACAGCTTTTCG
3361 TCATGCTCCCCACTGTGTAGGTGATTTATAGTTTACAGGAAGACAAGACTGCTTGGAACCATGAAGTTCTTGGAGGCCAT
3441 GGTTGCTTTTACCCACATGACTGCTATAACCCTTGATTCTGTTCTATCAAGTTACTTGCCTTGATATCATCACATGCTTT
3521 GCTGTCTGCTTAAAATATGAGTTCATCCCCCTCATACTTATTTGTTTTAGGGACCCAATTGGACCAGTGCTGGCACATGC
3601 CCTTCAAGGTACAATTTCTGAAAAGAGACTGCGCTGCCAAACTTATGTGTGCCTTTACCTCAGTCCCCCCAGTATAAGGG
3681 GTGACTTAATCTTGATAAATGAGTGACTGAGCACCATGCTAGTTAAATATTGAGAATTAAAAGCCTGAACCCAATGGCTC
3761 TATTTTTTTTTACCACCTTCTGACAAGCAAAAATTCTAGGCAGGAGCATGTGAACATTTTGGTCTTCATCTTTCACGTGT
3841 GCAATGATAGGTGTATGCAAAATTTTACTTGGATTAATTGTCAAGTTAAAAAAGTGTTCTATATGTATATCTCTTAGGAG
3921 AAGGTTTTTCAACCTGAAGGTCAGATTTCATTGCAGCAATTAATGCCATCAAAAAAACGTGGTCTGACAAAAAAGATTCA
4001 CAACCTTTGCCAGTGGTTCACCTATTACAGCAAGATGTAATACTATCAATACTTACTGTTCTCTGTAATGGGTTTAACCT
4081 TTCCCAGAATTGGACATAAAGAATGACTACGATGAGAAGATTATAATGAAGTCTTACTGGCTTTTCCTAGTCTAAAAAGA
4161 GTACTTAAGAAAGAGAATTAACATATCATTTCCTTTTGGCTGATTTTTAGCTATATCTGTTTTTGGTTCATAATATTCTA
4241 TATTATCATCTCACAAATTTTATAAGTCTTGGGAAATAATTTGCCTGCCTAGTGAATTGACACTGTAAAAAGCAAGACGT
4321 TATTTTAAACACATAAAACTAATTTCAAGAATCTGTGGCTTACACTCAAGAGTGTACTCGTGGTTTATGTTTGTGTGCAG
4401 ATTTATGTGCACTCAAGTCTATGTGCATTTGGACTATATTTTATAGTTATACAGCTTTAATATCCAAAGTTATTGTTAGA
4481 ATAATTTTATTATAGGAATTTGGCATGCCTTACTATTGACATTAAGAAGAAGAGAAGTCTTTCACAAGTCATGAATGAAG
4561 AATTTGGAATCAGCCTCAGAATGAGATGCCATAATTATTATAAACCTGTTTTGGTTGTTCAGCCTCCCACAAATATTTAT
4641 TAATTTGTTTTTTAACCTCTCAATTTCAGGCTCATGAGAGTGTGAGATATTTGGAAATTATTTTACCGTGAATTGTTATT
4721 TTATTTCAGGGGACTATGGGGAGTATATTCCTTTGTTTCAAATTTGGGTAACTCTCCTGTGTTTCAGGAACAGCTCTCCC
4801 TATTTTTTCACTGCCATCTTCAGGCTTCCTAGCCAGGCTCCAAACAAATGTCATATAAGAAAGAAAGATTAATTATTACA
4881 TATTGTGTATTGAGAGTTTGTACCCTGTGGTTCTCATCGTGCTGTTAATTTTACTTTTCTTGCCAAACAAAAATAATTTG
4961 ACATTGATTATGTGCTTTTTGATATTTTCAAGGGCAATTATTAAGGTTATGAGCTCTTTCTTAGGGCACTTGATGCCTTA
5041 TATGTTAATAGCAAGTGTGTCATATCATTTTAAAATAAAACTATTCAAAGGCTTTATTGTGTTTATTAAGCTTAATTTAA
5121 ATTGGAATCTGTAATGCTGATTTGGTCTTTTAAAATTATATTTGAAATTATTTGTCCAAAAAAATTAAAATGAATATTTA
5201 CCCCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAA--CAGUGUGAGGu 5'
            |||| | ||  ||||::|||| 
Target 5' agAACAGCTTTTCGTCATGCTCCc 3'
3347 - 3370 142.00 -14.60
2
miRNA  3' guUUGUGGUAAC-AGUGUGAGgu 5'
            ||: |::| | |:||||||  
Target 5' agAAT-CTGTGGCTTACACTCaa 3'
4348 - 4369 135.00 -9.70
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |::|  | || ||||||:| 
Target 5' taAGTA--AATG-CACACTTCa 3'
2497 - 2515 135.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31500652 6 COSMIC
COSN31576506 11 COSMIC
COSN30502997 16 COSMIC
COSN30461551 20 COSMIC
COSN31507540 24 COSMIC
COSN30470138 69 COSMIC
COSN17177561 72 COSMIC
COSN6904412 77 COSMIC
COSN30125639 91 COSMIC
COSN18733204 94 COSMIC
COSN30535733 96 COSMIC
COSN30575870 137 COSMIC
COSN20076308 169 COSMIC
COSN17315602 170 COSMIC
COSN30140626 187 COSMIC
COSN9522729 193 COSMIC
COSN26818794 212 COSMIC
COSN30144323 265 COSMIC
COSN20105800 480 COSMIC
COSN27132683 525 COSMIC
COSN32056255 604 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1215152484 6 dbSNP
rs1469235710 8 dbSNP
rs1289607587 18 dbSNP
rs191423732 27 dbSNP
rs1316274346 30 dbSNP
rs897850157 31 dbSNP
rs1353499139 34 dbSNP
rs1280609830 35 dbSNP
rs1045735995 36 dbSNP
rs764301669 38 dbSNP
rs762911272 42 dbSNP
rs1212644670 48 dbSNP
rs1441915263 49 dbSNP
rs752730949 50 dbSNP
rs1467414940 55 dbSNP
rs1180907280 60 dbSNP
rs529408315 68 dbSNP
rs1419031092 76 dbSNP
rs1022798157 78 dbSNP
rs915776031 81 dbSNP
rs991306246 94 dbSNP
rs960149952 103 dbSNP
rs374672541 106 dbSNP
rs1004380482 111 dbSNP
rs935818786 119 dbSNP
rs1389632740 132 dbSNP
rs1314816101 139 dbSNP
rs1334893993 139 dbSNP
rs375056069 139 dbSNP
rs886759624 144 dbSNP
rs925747921 146 dbSNP
rs1319576455 153 dbSNP
rs1224895167 157 dbSNP
rs1233848862 164 dbSNP
rs1480534256 166 dbSNP
rs977159456 183 dbSNP
rs1175968989 186 dbSNP
rs1489717808 197 dbSNP
rs1258954545 198 dbSNP
rs1475573003 210 dbSNP
rs1382607768 211 dbSNP
rs967072194 222 dbSNP
rs1029290226 234 dbSNP
rs569821021 253 dbSNP
rs1467401274 265 dbSNP
rs966357748 266 dbSNP
rs1353672844 268 dbSNP
rs1460316801 281 dbSNP
rs1304497180 284 dbSNP
rs995046033 286 dbSNP
rs1413570282 288 dbSNP
rs542981904 293 dbSNP
rs1290933376 297 dbSNP
rs899457072 303 dbSNP
rs1018264740 314 dbSNP
rs550010393 317 dbSNP
rs1007757216 322 dbSNP
rs887926796 324 dbSNP
rs1283005093 330 dbSNP
rs1027804234 338 dbSNP
rs1451874699 348 dbSNP
rs1210189314 351 dbSNP
rs533229969 359 dbSNP
rs890636916 362 dbSNP
rs1051843834 366 dbSNP
rs1419144948 370 dbSNP
rs1426450561 376 dbSNP
rs1177986408 378 dbSNP
rs1347104483 394 dbSNP
rs993596576 399 dbSNP
rs1311036273 401 dbSNP
rs1361876547 403 dbSNP
rs564395023 407 dbSNP
rs1269226466 411 dbSNP
rs924604756 414 dbSNP
rs13277037 426 dbSNP
rs1384481281 432 dbSNP
rs1213115123 437 dbSNP
rs1045764572 440 dbSNP
rs947379328 463 dbSNP
rs1256569458 470 dbSNP
rs185719298 475 dbSNP
rs547545020 475 dbSNP
rs1216669968 484 dbSNP
rs147657301 486 dbSNP
rs398073366 486 dbSNP
rs75724458 486 dbSNP
rs894427008 491 dbSNP
rs1484687699 492 dbSNP
rs1395423272 495 dbSNP
rs1453630131 510 dbSNP
rs1056098179 516 dbSNP
rs1261979992 526 dbSNP
rs1215814300 533 dbSNP
rs868063621 537 dbSNP
rs925801172 543 dbSNP
rs149230795 546 dbSNP
rs561572449 558 dbSNP
rs371404179 559 dbSNP
rs951171707 561 dbSNP
rs945800321 565 dbSNP
rs62509434 566 dbSNP
rs1342298230 569 dbSNP
rs995099736 580 dbSNP
rs1372152897 582 dbSNP
rs1234092230 583 dbSNP
rs1301872365 586 dbSNP
rs1353489094 588 dbSNP
rs1224362937 597 dbSNP
rs1283692414 604 dbSNP
rs899509432 604 dbSNP
rs576055617 614 dbSNP
rs1295298611 620 dbSNP
rs1467867250 621 dbSNP
rs1380747758 627 dbSNP
rs1191523123 636 dbSNP
rs199590180 636 dbSNP
rs557089207 636 dbSNP
rs561885771 636 dbSNP
rs1157438431 639 dbSNP
rs976477756 640 dbSNP
rs1364276246 650 dbSNP
rs753849263 651 dbSNP
rs543621838 657 dbSNP
rs1052404023 661 dbSNP
rs910829751 677 dbSNP
rs1440536774 682 dbSNP
rs903235982 689 dbSNP
rs986808519 690 dbSNP
rs1363757037 692 dbSNP
rs947348773 704 dbSNP
rs1426461555 709 dbSNP
rs577887615 714 dbSNP
rs1273977546 715 dbSNP
rs558005530 718 dbSNP
rs1334461821 719 dbSNP
rs1426424379 727 dbSNP
rs1027835315 733 dbSNP
rs938623606 739 dbSNP
rs146632888 744 dbSNP
rs78593115 746 dbSNP
rs1024389108 750 dbSNP
rs868652658 752 dbSNP
rs763421010 769 dbSNP
rs1225376702 772 dbSNP
rs1357670741 782 dbSNP
rs951226869 784 dbSNP
rs181277718 786 dbSNP
rs1172424523 797 dbSNP
rs188449157 802 dbSNP
rs370385910 807 dbSNP
rs760656884 808 dbSNP
rs963717909 812 dbSNP
rs774359362 814 dbSNP
rs1018381006 820 dbSNP
rs1294004813 821 dbSNP
rs1309527769 823 dbSNP
rs1007806742 825 dbSNP
rs955163574 830 dbSNP
rs1030590270 835 dbSNP
rs77504677 838 dbSNP
rs76204859 839 dbSNP
rs1195077200 842 dbSNP
rs998983323 843 dbSNP
rs903368263 852 dbSNP
rs1210933355 856 dbSNP
rs1256159402 865 dbSNP
rs1343734128 866 dbSNP
rs1304959361 868 dbSNP
rs1473968235 875 dbSNP
rs1194861100 876 dbSNP
rs1373362505 882 dbSNP
rs764218148 883 dbSNP
rs145251313 895 dbSNP
rs1391344038 903 dbSNP
rs576317036 913 dbSNP
rs1385860810 914 dbSNP
rs140220313 925 dbSNP
rs1011694350 944 dbSNP
rs1055770465 947 dbSNP
rs1437155950 951 dbSNP
rs894459889 969 dbSNP
rs549972124 973 dbSNP
rs1413071809 975 dbSNP
rs1320529429 982 dbSNP
rs185263551 988 dbSNP
rs904407172 989 dbSNP
rs1041569671 990 dbSNP
rs570692429 992 dbSNP
rs1374537383 993 dbSNP
rs922382926 996 dbSNP
rs1484404268 1000 dbSNP
rs1206388457 1002 dbSNP
rs928509535 1004 dbSNP
rs547658205 1012 dbSNP
rs1446091078 1019 dbSNP
rs763095544 1021 dbSNP
rs1388671986 1026 dbSNP
rs73313563 1027 dbSNP
rs1174796332 1046 dbSNP
rs1395081100 1049 dbSNP
rs1464549273 1054 dbSNP
rs1200946083 1055 dbSNP
rs1452745069 1059 dbSNP
rs1290723967 1064 dbSNP
rs1250397478 1065 dbSNP
rs919773949 1069 dbSNP
rs561675378 1072 dbSNP
rs201056166 1074 dbSNP
rs910880399 1074 dbSNP
rs964173894 1074 dbSNP
rs1302507861 1077 dbSNP
rs910894355 1080 dbSNP
rs983772274 1088 dbSNP
rs952277503 1093 dbSNP
rs1030563434 1094 dbSNP
rs1260838561 1096 dbSNP
rs1349376970 1098 dbSNP
rs1202980031 1102 dbSNP
rs920844039 1108 dbSNP
rs1470100376 1113 dbSNP
rs1194657977 1117 dbSNP
rs182239417 1120 dbSNP
rs962191934 1122 dbSNP
rs1024454682 1125 dbSNP
rs1431968114 1126 dbSNP
rs1014766690 1137 dbSNP
rs958784066 1138 dbSNP
rs999119203 1143 dbSNP
rs1453220578 1144 dbSNP
rs967524642 1149 dbSNP
rs1396971260 1150 dbSNP
rs1461721253 1152 dbSNP
rs1034766623 1163 dbSNP
rs531273971 1169 dbSNP
rs77019993 1175 dbSNP
rs1041602363 1195 dbSNP
rs1010047152 1208 dbSNP
rs1307674968 1211 dbSNP
rs146700207 1213 dbSNP
rs1236333933 1218 dbSNP
rs1040856513 1222 dbSNP
rs1335091157 1230 dbSNP
rs1306233357 1231 dbSNP
rs1389549216 1232 dbSNP
rs942455349 1236 dbSNP
rs775664816 1237 dbSNP
rs577801580 1240 dbSNP
rs907220229 1244 dbSNP
rs564380658 1246 dbSNP
rs1251954473 1249 dbSNP
rs541708489 1252 dbSNP
rs1180130555 1253 dbSNP
rs1420235949 1259 dbSNP
rs1048575835 1274 dbSNP
rs1046935892 1277 dbSNP
rs770171639 1278 dbSNP
rs1478087813 1283 dbSNP
rs1298671287 1288 dbSNP
rs898331043 1289 dbSNP
rs1407389416 1291 dbSNP
rs1180304125 1294 dbSNP
rs920876762 1298 dbSNP
rs972326863 1309 dbSNP
rs1239240057 1312 dbSNP
rs572659727 1320 dbSNP
rs1310213282 1321 dbSNP
rs1320288833 1325 dbSNP
rs1038200637 1330 dbSNP
rs1252348654 1331 dbSNP
rs942556736 1333 dbSNP
rs910921956 1337 dbSNP
rs986584228 1345 dbSNP
rs190712615 1346 dbSNP
rs923628415 1358 dbSNP
rs1411975448 1364 dbSNP
rs992971058 1367 dbSNP
rs959080380 1374 dbSNP
rs1170894662 1378 dbSNP
rs1372381483 1381 dbSNP
rs1427772922 1383 dbSNP
rs1314699915 1384 dbSNP
rs535502039 1393 dbSNP
rs967664909 1394 dbSNP
rs1379011927 1397 dbSNP
rs1309776074 1398 dbSNP
rs776953501 1399 dbSNP
rs1451607218 1403 dbSNP
rs1300647242 1404 dbSNP
rs1363654727 1409 dbSNP
rs185413021 1413 dbSNP
rs1296786950 1415 dbSNP
rs1338319912 1419 dbSNP
rs1021796274 1421 dbSNP
rs978758853 1422 dbSNP
rs1226813437 1424 dbSNP
rs990690673 1430 dbSNP
rs968670348 1433 dbSNP
rs556677321 1437 dbSNP
rs958906612 1448 dbSNP
rs1235885055 1452 dbSNP
rs771498106 1457 dbSNP
rs1186849478 1466 dbSNP
rs747504134 1469 dbSNP
rs1447483940 1472 dbSNP
rs1175436372 1480 dbSNP
rs376176055 1494 dbSNP
rs1433498186 1500 dbSNP
rs1173376466 1518 dbSNP
rs1019871411 1526 dbSNP
rs1430975732 1537 dbSNP
rs570655889 1544 dbSNP
rs1199361708 1545 dbSNP
rs889568710 1546 dbSNP
rs1433429488 1548 dbSNP
rs547274476 1555 dbSNP
rs12677617 1557 dbSNP
rs1349247966 1559 dbSNP
rs777164441 1561 dbSNP
rs1276625520 1585 dbSNP
rs1318854645 1589 dbSNP
rs1216742065 1590 dbSNP
rs1247715576 1590 dbSNP
rs534055707 1603 dbSNP
rs746306565 1616 dbSNP
rs1253496650 1617 dbSNP
rs1188518706 1618 dbSNP
rs1446638051 1628 dbSNP
rs771545991 1629 dbSNP
rs1409508480 1650 dbSNP
rs1400844622 1657 dbSNP
rs747788253 1659 dbSNP
rs1157905770 1669 dbSNP
rs896836803 1676 dbSNP
rs34953934 1682 dbSNP
rs1455920561 1690 dbSNP
rs1038292679 1691 dbSNP
rs1036664509 1692 dbSNP
rs1436350562 1693 dbSNP
rs942503384 1695 dbSNP
rs1224412717 1702 dbSNP
rs940925291 1707 dbSNP
rs199951280 1719 dbSNP
rs1215296751 1723 dbSNP
rs1051273059 1724 dbSNP
rs778579945 1726 dbSNP
rs923597256 1727 dbSNP
rs1357026422 1728 dbSNP
rs149702065 1729 dbSNP
rs1234594668 1733 dbSNP
rs375400697 1734 dbSNP
rs1180840609 1744 dbSNP
rs946374606 1744 dbSNP
rs139504461 1746 dbSNP
rs1315668514 1747 dbSNP
rs1395643411 1748 dbSNP
rs1405200371 1750 dbSNP
rs927391654 1751 dbSNP
rs1442961689 1762 dbSNP
rs531188097 1762 dbSNP
rs1287845961 1768 dbSNP
rs1192215306 1769 dbSNP
rs1235348708 1772 dbSNP
rs978832338 1772 dbSNP
rs990435816 1786 dbSNP
rs1355376233 1790 dbSNP
rs1207844603 1805 dbSNP
rs1401267444 1811 dbSNP
rs1360557530 1812 dbSNP
rs562180660 1813 dbSNP
rs1423222431 1816 dbSNP
rs1020252054 1819 dbSNP
rs1203759096 1820 dbSNP
rs1248946324 1834 dbSNP
rs1486393661 1835 dbSNP
rs1188204563 1837 dbSNP
rs1367598816 1839 dbSNP
rs769613959 1839 dbSNP
rs988735485 1844 dbSNP
rs1164188536 1851 dbSNP
rs1034553567 1856 dbSNP
rs1422224545 1860 dbSNP
rs981915295 1862 dbSNP
rs1240546750 1863 dbSNP
rs1308017771 1869 dbSNP
rs971488265 1877 dbSNP
rs1488671444 1884 dbSNP
rs1025691726 1887 dbSNP
rs1340105445 1887 dbSNP
rs994088939 1894 dbSNP
rs965716900 1896 dbSNP
rs551847713 1897 dbSNP
rs532123528 1899 dbSNP
rs1227543437 1901 dbSNP
rs1272462362 1908 dbSNP
rs371064391 1909 dbSNP
rs376152502 1911 dbSNP
rs1007165006 1915 dbSNP
rs150996811 1916 dbSNP
rs541280781 1918 dbSNP
rs1254988152 1928 dbSNP
rs1440369273 1944 dbSNP
rs572670619 1948 dbSNP
rs889610500 1951 dbSNP
rs1194931102 1952 dbSNP
rs1244175143 1957 dbSNP
rs1450548415 1958 dbSNP
rs1168510001 1961 dbSNP
rs1388868864 1968 dbSNP
rs745624490 1977 dbSNP
rs1173253676 1983 dbSNP
rs1017233744 1991 dbSNP
rs1394477843 2001 dbSNP
rs995262709 2010 dbSNP
rs1006835719 2018 dbSNP
rs1326790457 2021 dbSNP
rs896869374 2023 dbSNP
rs1036737796 2024 dbSNP
rs193162319 2027 dbSNP
rs896083401 2032 dbSNP
rs997929127 2042 dbSNP
rs1234333062 2044 dbSNP
rs1254874450 2044 dbSNP
rs1342327470 2046 dbSNP
rs779990295 2055 dbSNP
rs1206516682 2057 dbSNP
rs1284606166 2063 dbSNP
rs937565334 2065 dbSNP
rs12681286 2067 dbSNP
rs1043174340 2070 dbSNP
rs1246671222 2075 dbSNP
rs1285810978 2084 dbSNP
rs1340608530 2084 dbSNP
rs1042165082 2088 dbSNP
rs947479868 2099 dbSNP
rs117911409 2100 dbSNP
rs1352103071 2101 dbSNP
rs1456462823 2101 dbSNP
rs1318331457 2105 dbSNP
rs1324669593 2105 dbSNP
rs1300579454 2113 dbSNP
rs900859603 2113 dbSNP
rs988807280 2119 dbSNP
rs1328846410 2120 dbSNP
rs965394299 2121 dbSNP
rs74889111 2123 dbSNP
rs985413746 2126 dbSNP
rs954063596 2133 dbSNP
rs1026820856 2138 dbSNP
rs1417754666 2144 dbSNP
rs1266587595 2155 dbSNP
rs1365334252 2164 dbSNP
rs1210942231 2167 dbSNP
rs1267345795 2168 dbSNP
rs1431444251 2172 dbSNP
rs750314352 2186 dbSNP
rs961150761 2189 dbSNP
rs75008658 2190 dbSNP
rs1015336170 2195 dbSNP
rs115090731 2201 dbSNP
rs918646507 2203 dbSNP
rs114451892 2215 dbSNP
rs1458282898 2217 dbSNP
rs1197346773 2218 dbSNP
rs188745379 2221 dbSNP
rs568276772 2224 dbSNP
rs11985668 2227 dbSNP
rs763045624 2247 dbSNP
rs1016957475 2249 dbSNP
rs1222160974 2257 dbSNP
rs1288459465 2265 dbSNP
rs752881715 2266 dbSNP
rs1007214149 2271 dbSNP
rs1437037104 2276 dbSNP
rs1270546501 2277 dbSNP
rs1245992340 2280 dbSNP
rs954019505 2297 dbSNP
rs947551812 2299 dbSNP
rs1198123105 2303 dbSNP
rs913348193 2317 dbSNP
rs1318152274 2332 dbSNP
rs1482804319 2334 dbSNP
rs1282145499 2337 dbSNP
rs1420302792 2343 dbSNP
rs1053114581 2348 dbSNP
rs1221123533 2355 dbSNP
rs1369050489 2361 dbSNP
rs1163842367 2366 dbSNP
rs1366599491 2378 dbSNP
rs1463430800 2379 dbSNP
rs1275988475 2382 dbSNP
rs944097369 2388 dbSNP
rs576775299 2397 dbSNP
rs902368433 2397 dbSNP
rs912578885 2397 dbSNP
rs1379461041 2403 dbSNP
rs985824569 2404 dbSNP
rs184148430 2405 dbSNP
rs1320345714 2408 dbSNP
rs1353126982 2410 dbSNP
rs1333781323 2417 dbSNP
rs142613369 2427 dbSNP
rs765487783 2445 dbSNP
rs759754092 2462 dbSNP
rs77335585 2465 dbSNP
rs551759759 2466 dbSNP
rs1435010577 2472 dbSNP
rs1181534811 2475 dbSNP
rs927529292 2485 dbSNP
rs1015411211 2487 dbSNP
rs1013348682 2488 dbSNP
rs950191538 2498 dbSNP
rs1389484475 2509 dbSNP
rs1427198755 2517 dbSNP
rs1231024456 2524 dbSNP
rs369665826 2533 dbSNP
rs1180256255 2540 dbSNP
rs777041407 2544 dbSNP
rs972771939 2547 dbSNP
rs1437734830 2548 dbSNP
rs35768398 2557 dbSNP
rs1033356344 2560 dbSNP
rs1365134023 2561 dbSNP
rs1226230172 2563 dbSNP
rs139779534 2564 dbSNP
rs962805141 2565 dbSNP
rs1312895548 2566 dbSNP
rs909864342 2583 dbSNP
rs1254552667 2591 dbSNP
rs1002276404 2595 dbSNP
rs771230298 2596 dbSNP
rs1278630433 2603 dbSNP
rs1223782605 2622 dbSNP
rs1447617385 2629 dbSNP
rs557588856 2633 dbSNP
rs1371794827 2634 dbSNP
rs1425240487 2639 dbSNP
rs191641242 2649 dbSNP
rs1021818787 2652 dbSNP
rs147419290 2659 dbSNP
rs1459107794 2663 dbSNP
rs1321677686 2668 dbSNP
rs1388411757 2680 dbSNP
rs1433503770 2686 dbSNP
rs527865305 2687 dbSNP
rs891982890 2697 dbSNP
rs761092330 2698 dbSNP
rs1334992435 2708 dbSNP
rs944137344 2711 dbSNP
rs867582798 2714 dbSNP
rs1359814966 2717 dbSNP
rs966521741 2719 dbSNP
rs1209077651 2734 dbSNP
rs562346188 2750 dbSNP
rs542536092 2760 dbSNP
rs1049785298 2761 dbSNP
rs532043901 2779 dbSNP
rs932630241 2781 dbSNP
rs1400099053 2795 dbSNP
rs1378374073 2797 dbSNP
rs562827630 2799 dbSNP
rs556184891 2801 dbSNP
rs1463423302 2802 dbSNP
rs919862688 2806 dbSNP
rs546237676 2808 dbSNP
rs974003087 2810 dbSNP
rs1477373678 2820 dbSNP
rs939888254 2828 dbSNP
rs1440104133 2830 dbSNP
rs908381406 2832 dbSNP
rs1472694193 2839 dbSNP
rs1158032881 2844 dbSNP
rs1242245455 2853 dbSNP
rs371544334 2855 dbSNP
rs1456044278 2860 dbSNP
rs960527655 2861 dbSNP
rs1033849308 2864 dbSNP
rs577242498 2866 dbSNP
rs111972957 2869 dbSNP
rs967670235 2870 dbSNP
rs1315701527 2875 dbSNP
rs1021894123 2876 dbSNP
rs145366280 2879 dbSNP
rs1011797797 2883 dbSNP
rs574539031 2901 dbSNP
rs1450994054 2903 dbSNP
rs1219328691 2904 dbSNP
rs1031877515 2907 dbSNP
rs897325876 2911 dbSNP
rs1037192973 2920 dbSNP
rs554797513 2921 dbSNP
rs941531165 2925 dbSNP
rs1398072151 2926 dbSNP
rs368380647 2928 dbSNP
rs1288409630 2931 dbSNP
rs1415109148 2936 dbSNP
rs891239586 2941 dbSNP
rs139831463 2948 dbSNP
rs1362489267 2956 dbSNP
rs1372479891 2965 dbSNP
rs147452439 2979 dbSNP
rs932642556 2997 dbSNP
rs1348885049 2998 dbSNP
rs1449901388 3000 dbSNP
rs1284535190 3003 dbSNP
rs1355435778 3012 dbSNP
rs922623263 3015 dbSNP
rs1420162699 3032 dbSNP
rs1050251179 3041 dbSNP
rs976648364 3046 dbSNP
rs1203832718 3055 dbSNP
rs1249104591 3056 dbSNP
rs1443819759 3057 dbSNP
rs966656439 3064 dbSNP
rs1238389091 3070 dbSNP
rs1425238625 3076 dbSNP
rs1162148646 3077 dbSNP
rs1020792615 3090 dbSNP
rs989272655 3091 dbSNP
rs932697464 3092 dbSNP
rs1168069093 3101 dbSNP
rs1368832253 3103 dbSNP
rs898509732 3111 dbSNP
rs1038343987 3112 dbSNP
rs547142957 3116 dbSNP
rs1335167185 3127 dbSNP
rs939922299 3128 dbSNP
rs908458170 3132 dbSNP
rs1255746872 3134 dbSNP
rs1299659959 3134 dbSNP
rs186772731 3136 dbSNP
rs1217993309 3141 dbSNP
rs1490327329 3148 dbSNP
rs1290111276 3149 dbSNP
rs1247405311 3152 dbSNP
rs1322660070 3153 dbSNP
rs1295158115 3155 dbSNP
rs1212969496 3157 dbSNP
rs1271822610 3158 dbSNP
rs1342459053 3159 dbSNP
rs1346569200 3161 dbSNP
rs1002390692 3162 dbSNP
rs12056801 3167 dbSNP
rs566495321 3168 dbSNP
rs1014449228 3174 dbSNP
rs980950807 3175 dbSNP
rs1291610142 3183 dbSNP
rs1459277975 3200 dbSNP
rs967744047 3212 dbSNP
rs1371389366 3215 dbSNP
rs1479088567 3220 dbSNP
rs771504980 3227 dbSNP
rs1350202769 3228 dbSNP
rs1169321222 3234 dbSNP
rs1322338403 3236 dbSNP
rs1389161335 3240 dbSNP
rs1434252714 3242 dbSNP
rs1295391181 3244 dbSNP
rs1332253163 3248 dbSNP
rs1021926847 3249 dbSNP
rs1037250254 3252 dbSNP
rs371114732 3266 dbSNP
rs1273827719 3268 dbSNP
rs546366976 3273 dbSNP
rs956322587 3276 dbSNP
rs1465674029 3280 dbSNP
rs1032324414 3284 dbSNP
rs1260270743 3291 dbSNP
rs1008417044 3294 dbSNP
rs1049825392 3297 dbSNP
rs955747241 3307 dbSNP
rs1479562547 3308 dbSNP
rs1161711311 3317 dbSNP
rs932752903 3318 dbSNP
rs1028462652 3321 dbSNP
rs1456511576 3324 dbSNP
rs1480421190 3326 dbSNP
rs1286988266 3329 dbSNP
rs976783952 3330 dbSNP
rs1386805290 3331 dbSNP
rs778870003 3335 dbSNP
rs1229834295 3336 dbSNP
rs1288661068 3354 dbSNP
rs1330169953 3355 dbSNP
rs747742513 3359 dbSNP
rs529841776 3360 dbSNP
rs1259440609 3363 dbSNP
rs1489774403 3371 dbSNP
rs1211003554 3372 dbSNP
rs1266735477 3374 dbSNP
rs531889673 3375 dbSNP
rs1320256498 3379 dbSNP
rs1252827488 3383 dbSNP
rs1278973053 3389 dbSNP
rs10955496 3396 dbSNP
rs1343672224 3403 dbSNP
rs184570650 3407 dbSNP
rs1370016836 3413 dbSNP
rs1458323664 3414 dbSNP
rs768488861 3419 dbSNP
rs887060135 3421 dbSNP
rs1388384938 3437 dbSNP
rs748933907 3440 dbSNP
rs1391188651 3452 dbSNP
rs939262309 3456 dbSNP
rs532006451 3457 dbSNP
rs1463784605 3466 dbSNP
rs970915837 3467 dbSNP
rs926465017 3481 dbSNP
rs149384655 3482 dbSNP
rs993083372 3488 dbSNP
rs961708581 3498 dbSNP
rs1015771758 3502 dbSNP
rs1265439097 3512 dbSNP
rs1357297947 3516 dbSNP
rs1468855474 3517 dbSNP
rs546550292 3524 dbSNP
rs1201653686 3527 dbSNP
rs1275568794 3539 dbSNP
rs192192902 3541 dbSNP
rs1175747711 3542 dbSNP
rs1006247979 3544 dbSNP
rs914983294 3546 dbSNP
rs1186665158 3547 dbSNP
rs755903866 3560 dbSNP
rs956353588 3563 dbSNP
rs1258980835 3567 dbSNP
rs560576363 3572 dbSNP
rs1050387914 3574 dbSNP
rs996933037 3578 dbSNP
rs1342978412 3581 dbSNP
rs901225245 3582 dbSNP
rs550030212 3587 dbSNP
rs1041168097 3588 dbSNP
rs574880936 3592 dbSNP
rs1381264278 3594 dbSNP
rs913932177 3602 dbSNP
rs1275416743 3609 dbSNP
rs911538578 3613 dbSNP
rs987472296 3615 dbSNP
rs1257984203 3619 dbSNP
rs1483419571 3623 dbSNP
rs1199688687 3626 dbSNP
rs1331594936 3630 dbSNP
rs955616530 3632 dbSNP
rs560709937 3633 dbSNP
rs1378778837 3636 dbSNP
rs781132337 3637 dbSNP
rs1359403395 3638 dbSNP
rs1331634144 3639 dbSNP
rs1451381647 3643 dbSNP
rs997016022 3645 dbSNP
rs926467723 3646 dbSNP
rs757115640 3658 dbSNP
rs1361274894 3660 dbSNP
rs1017018508 3665 dbSNP
rs1173807934 3666 dbSNP
rs1467047924 3667 dbSNP
rs1303619216 3668 dbSNP
rs531712644 3669 dbSNP
rs1223177426 3670 dbSNP
rs544018594 3671 dbSNP
rs1004240467 3675 dbSNP
rs1209272376 3679 dbSNP
rs887129063 3683 dbSNP
rs1247348595 3684 dbSNP
rs77783929 3688 dbSNP
rs752892723 3696 dbSNP
rs961677193 3699 dbSNP
rs1432213048 3703 dbSNP
rs1173883073 3705 dbSNP
rs7845796 3707 dbSNP
rs189098189 3730 dbSNP
rs953112616 3732 dbSNP
rs1258418791 3743 dbSNP
rs753994073 3744 dbSNP
rs1345138105 3746 dbSNP
rs1201084282 3751 dbSNP
rs1044909163 3758 dbSNP
rs946537467 3760 dbSNP
rs1237800213 3762 dbSNP
rs1355595443 3764 dbSNP
rs35888121 3772 dbSNP
rs901354636 3772 dbSNP
rs997384327 3772 dbSNP
rs1228793872 3773 dbSNP
rs915014272 3776 dbSNP
rs1315021790 3779 dbSNP
rs1223741064 3789 dbSNP
rs572745186 3790 dbSNP
rs1041137464 3802 dbSNP
rs1490061775 3810 dbSNP
rs1446911233 3816 dbSNP
rs7845404 3822 dbSNP
rs1335670033 3835 dbSNP
rs535924054 3836 dbSNP
rs138801400 3837 dbSNP
rs879619233 3848 dbSNP
rs1407770063 3851 dbSNP
rs1399446280 3852 dbSNP
rs548774201 3860 dbSNP
rs572699630 3875 dbSNP
rs1167602872 3878 dbSNP
rs1296902770 3880 dbSNP
rs183652169 3884 dbSNP
rs1421986062 3888 dbSNP
rs1352589144 3894 dbSNP
rs987114715 3894 dbSNP
rs1054229305 3897 dbSNP
rs955853319 3900 dbSNP
rs926491537 3902 dbSNP
rs569509730 3903 dbSNP
rs1290507384 3904 dbSNP
rs1188452567 3911 dbSNP
rs949195354 3924 dbSNP
rs1483162702 3933 dbSNP
rs1446516894 3954 dbSNP
rs1180710097 3971 dbSNP
rs1232654448 3978 dbSNP
rs1261043251 3978 dbSNP
rs1214450142 3979 dbSNP
rs921509065 3981 dbSNP
rs1161714403 3982 dbSNP
rs917779071 3985 dbSNP
rs552897233 3986 dbSNP
rs1489223320 3989 dbSNP
rs1286535394 3990 dbSNP
rs971771523 4003 dbSNP
rs1227502162 4009 dbSNP
rs773427192 4013 dbSNP
rs1285616459 4016 dbSNP
rs962853797 4019 dbSNP
rs1339280128 4022 dbSNP
rs908870493 4026 dbSNP
rs150677321 4055 dbSNP
rs1017090651 4056 dbSNP
rs1402457859 4058 dbSNP
rs772674100 4059 dbSNP
rs1342334270 4061 dbSNP
rs373834287 4080 dbSNP
rs1035436975 4081 dbSNP
rs953076972 4082 dbSNP
rs1028962838 4084 dbSNP
rs1003545581 4089 dbSNP
rs560774329 4090 dbSNP
rs369848733 4110 dbSNP
rs1019833724 4118 dbSNP
rs1023487130 4123 dbSNP
rs530104335 4124 dbSNP
rs1009645237 4128 dbSNP
rs1475785042 4131 dbSNP
rs1167493397 4137 dbSNP
rs565829790 4152 dbSNP
rs1415918538 4159 dbSNP
rs1334526039 4162 dbSNP
rs1405149193 4177 dbSNP
rs1032428572 4183 dbSNP
rs1322553202 4185 dbSNP
rs1421654533 4187 dbSNP
rs1001248497 4198 dbSNP
rs1226077144 4201 dbSNP
rs1267996030 4212 dbSNP
rs905207457 4213 dbSNP
rs1219488733 4221 dbSNP
rs893651791 4229 dbSNP
rs112867278 4231 dbSNP
rs1052184914 4240 dbSNP
rs949329690 4242 dbSNP
rs879122689 4245 dbSNP
rs935076884 4247 dbSNP
rs1449667876 4256 dbSNP
rs1192597644 4268 dbSNP
rs1291674684 4277 dbSNP
rs1479118076 4279 dbSNP
rs1177498654 4281 dbSNP
rs1210135195 4283 dbSNP
rs1428336955 4288 dbSNP
rs1468046491 4293 dbSNP
rs79422180 4296 dbSNP
rs1385610754 4301 dbSNP
rs558823237 4304 dbSNP
rs141923075 4307 dbSNP
rs1332374824 4310 dbSNP
rs1436743159 4317 dbSNP
rs538983147 4318 dbSNP
rs564784163 4319 dbSNP
rs775239806 4333 dbSNP
rs1340551354 4334 dbSNP
rs1270529705 4349 dbSNP
rs975681254 4358 dbSNP
rs1205107718 4365 dbSNP
rs1259730433 4370 dbSNP
rs1453470001 4379 dbSNP
rs984576031 4380 dbSNP
rs1268468217 4385 dbSNP
rs1434858987 4387 dbSNP
rs1333261964 4389 dbSNP
rs1364207580 4393 dbSNP
rs1452942905 4405 dbSNP
rs941567772 4412 dbSNP
rs1156809522 4413 dbSNP
rs910061127 4421 dbSNP
rs1424760861 4424 dbSNP
rs921638578 4426 dbSNP
rs975659938 4433 dbSNP
rs138491065 4436 dbSNP
rs1019883364 4439 dbSNP
rs988266774 4445 dbSNP
rs1336787290 4450 dbSNP
rs767270603 4458 dbSNP
rs951587941 4459 dbSNP
rs956911543 4462 dbSNP
rs1032810136 4477 dbSNP
rs1223351554 4478 dbSNP
rs1035096426 4485 dbSNP
rs1489912540 4492 dbSNP
rs982542159 4493 dbSNP
rs1184674144 4500 dbSNP
rs1000987964 4515 dbSNP
rs1418288138 4516 dbSNP
rs905175467 4517 dbSNP
rs569951694 4519 dbSNP
rs1444668660 4533 dbSNP
rs1428611354 4534 dbSNP
rs1190553823 4535 dbSNP
rs1023560568 4537 dbSNP
rs1363218982 4543 dbSNP
rs1431238462 4544 dbSNP
rs1013450157 4551 dbSNP
rs896373627 4552 dbSNP
rs1305434556 4568 dbSNP
rs145865213 4573 dbSNP
rs1385661934 4577 dbSNP
rs1036240560 4578 dbSNP
rs75421082 4588 dbSNP
rs190831151 4593 dbSNP
rs1207474284 4601 dbSNP
rs893684735 4604 dbSNP
rs552657554 4606 dbSNP
rs564671573 4613 dbSNP
rs1193884662 4626 dbSNP
rs1258053755 4627 dbSNP
rs1445141330 4633 dbSNP
rs1182970393 4634 dbSNP
rs1318010899 4640 dbSNP
rs999357294 4657 dbSNP
rs1382852288 4661 dbSNP
rs890233010 4662 dbSNP
rs1051504400 4664 dbSNP
rs1170642769 4670 dbSNP
rs931701997 4673 dbSNP
rs202070086 4676 dbSNP
rs543186267 4680 dbSNP
rs1037339692 4691 dbSNP
rs573709543 4694 dbSNP
rs745721052 4705 dbSNP
rs557079572 4706 dbSNP
rs1218044446 4707 dbSNP
rs537185606 4708 dbSNP
rs569472273 4722 dbSNP
rs1380598619 4723 dbSNP
rs930140168 4726 dbSNP
rs928096447 4738 dbSNP
rs1307100957 4741 dbSNP
rs1375086405 4743 dbSNP
rs62509433 4750 dbSNP
rs982229182 4756 dbSNP
rs1264753956 4763 dbSNP
rs757280590 4769 dbSNP
rs916583135 4771 dbSNP
rs1202883791 4774 dbSNP
rs988403625 4775 dbSNP
rs746866908 4788 dbSNP
rs957981831 4793 dbSNP
rs542565400 4797 dbSNP
rs1426346577 4804 dbSNP
rs552807573 4809 dbSNP
rs116052743 4810 dbSNP
rs778971450 4818 dbSNP
rs1176275240 4824 dbSNP
rs1404575625 4825 dbSNP
rs1433543518 4826 dbSNP
rs969535533 4830 dbSNP
rs1361428162 4831 dbSNP
rs954586530 4832 dbSNP
rs1030550804 4833 dbSNP
rs1023683342 4836 dbSNP
rs550823510 4843 dbSNP
rs900216348 4851 dbSNP
rs1037412233 4867 dbSNP
rs1261133901 4869 dbSNP
rs960715119 4869 dbSNP
rs1216475230 4876 dbSNP
rs1014766981 4877 dbSNP
rs1438875038 4880 dbSNP
rs1192508061 4882 dbSNP
rs187494800 4884 dbSNP
rs1269178805 4885 dbSNP
rs1480943038 4887 dbSNP
rs1199106199 4891 dbSNP
rs1005885141 4902 dbSNP
rs1236065980 4908 dbSNP
rs182808402 4910 dbSNP
rs377293148 4915 dbSNP
rs1344612215 4917 dbSNP
rs560987130 4918 dbSNP
rs930188746 4919 dbSNP
rs778107979 4935 dbSNP
rs550657084 4939 dbSNP
rs1207377198 4941 dbSNP
rs1443603040 4949 dbSNP
rs1281121122 4950 dbSNP
rs796344646 4963 dbSNP
rs928160128 4964 dbSNP
rs1279982122 4965 dbSNP
rs536931381 4968 dbSNP
rs1351965640 4982 dbSNP
rs1283485864 4995 dbSNP
rs530913570 5006 dbSNP
rs1241222219 5011 dbSNP
rs1378693097 5023 dbSNP
rs1291916700 5026 dbSNP
rs1490076772 5027 dbSNP
rs900208602 5032 dbSNP
rs1245339430 5041 dbSNP
rs1471363040 5047 dbSNP
rs564696689 5052 dbSNP
rs140708752 5055 dbSNP
rs1417357197 5059 dbSNP
rs912929621 5067 dbSNP
rs1366331259 5069 dbSNP
rs1052671594 5072 dbSNP
rs1301599223 5082 dbSNP
rs1355996211 5086 dbSNP
rs1313420660 5093 dbSNP
rs1442686944 5100 dbSNP
rs1278839142 5121 dbSNP
rs935638117 5122 dbSNP
rs1248139130 5128 dbSNP
rs528344380 5128 dbSNP
rs1358188804 5136 dbSNP
rs958014250 5139 dbSNP
rs979593380 5140 dbSNP
rs1439873230 5170 dbSNP
rs923915438 5180 dbSNP
rs1205700629 5183 dbSNP
rs978047252 5191 dbSNP
rs954752928 5199 dbSNP
rs916640355 5206 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1